Chapter I

Bacopa monniera extract enhance the learning ability of rats: up-regulating

tryptophan hydroxylase-2 (Tph2) and serotonin transporter (SERT)

expression

30

INTRODUCTION

Ayurveda, an alternative system of medicine in India, uses a number of plants

for the treatment of a variety of diseases. The ancient classical ayurvedic treatment has

classified many plants under Medhya rasayana, i.e., medicinal plants rejuvenating

intellect and memory (Rai et al. 2003). Several studies tested the in vivo efficacy of

plant extracts to identify biologically active compounds that could act as nootropic

agents (Khalifa 2001; Rai et al. 2001; Das et al. 2002; Achliya et al. 2004; Mohandas

Rao et al. 2005; Russo & Borrelli 2005; Zhao et al. 2006; Kimani & Nyongesa 2008).

Behavioural and biochemical evaluations demonstrated that the plant extracts have the

potential to act on the CNS and mediate neuromodulatory effects.

Bacopa monniera Linn. (Family: Scrophulariaceae), commonly known as

Brahmi, is a creeping herb with bitter taste found in marshy areas in India (Chunekar

1960; Satyavati et al. 1976). It has been used in the Indian system of Ayurvedic

medicine to enhance cognitive function (Russo & Borrelli 2005). B. monniera leaf

extract contain various active alkaloids such as nicotine, brahmine and herpestine, and

triterpenoid saponins such as bacoside A and B (Chatterji et al. 1963; 1965; Schulte

et al. 1972; Kulshreshtha & Rastogi 1973; 1974; Chandel et al. 1977). Subsequently,

several other saponin compounds such as bacopaside I, II, III, IV and V as well as

bacopasaponin C were identified (Chakravarty et al. 2001; 2003). It has been tested for

its neuropharmacological effects like anxiolytic (Singh & Singh 1980), learning and

memory (Singh & Dhawan 1997), and anti-depressant (Sairam et al. 2002). Earlier

study reported that the ethanolic extract of B. monniera enhances the learning and

retention in rats (Singh & Dhawan 1982; 1992; Singh et al. 1988; Vollala et al. 2010).

It has been reported that B. monniera increases the 5-HT level thereby enhancing the

31

learning ability and memory retention in rats (Singh & Dhawan 1997). It also alter the

glutamate receptor binding and NMDA R1 gene expression in epileptic rats (Khan et al.

2008), reducing hypobaric hypoxia induced spatial memory impairment (Hota et al.

2009) and attenuate the Nω-nitro-L-arginine (L-NNA) induced amnesia (Saraf et al.

2009). Furthermore, therapeutic effect of B. monniera treatment has been demonstrated

as neuroprotective effect against the cholinergic degeneration (Uabundit et al. 2010),

reversing diazepam (Saraf et al. 2008; Prabhakar et al. 2008) and scopolamine-induced

memory deficit (Zhou et al. 2009; Saraf et al. 2010).

Neurotransmitters such as DA, 5-HT and NE are involved in basic

physiological, behavioural and endocrine functions (Greengard 2001). Among them,

5-HT is involved in regulation of many physiological processes such as sleep-wake

cycle, motor activity, feeding, nociception and thermoregulation (Jacobs & Azmitia

1992; Struder & Weicker 2001) and a variety of brain functions such as control of

mood, aggression, anxiety, pain, learning and memory, and sexual behaviour (Buhot

1997; Mann 1999; Lovinger 1999; Gainetdinov et al. 1999). Many studies correlated

the memory performance with the systems extracellular 5-HT level, and demonstrated

that depletion of tryptophan and manipulation of 5-HT receptors affect the memory

formation (Schiapparelli et al. 2005; van der Veen et al. 2006).

In the CNS, serotonergic neurons localized as clusters within the raphe nuclei;

the caudal group neurons direct their axons to spinal cord and the rostral group

neuronal axons innervate almost all regions of brain. Biosynthesis of 5-HT is regulated

by the rate-limiting enzyme tryptophan hydroxylase (Tph) (Kim et al. 2002). There are

two forms of Tph; Tph1 is expressed in gut, pineal gland, spleen and thymus, which are

32

responsible for most peripheral 5-HT, whereas Tph2 is neuronal specific which

predominates in brain stem and involved in central 5-HT synthesis (Cote et al. 2003;

Walther & Bader 2003). Chamas and co-workers (1999) indicate that elevation of Tph

expression leads to an enhancement of Tph activity and 5-HT synthesis. 5-HT is

synthesized in 5-HT neuronal cell body, most of which are found to be positive for

SERT immunoreactivity (Fujita et al. 1993). Clearance of synaptic and extra-synaptic

5-HT is the principal function of SERT, and this process involves regulation of SERT

gene transcription-translation (Neumaier et al. 1996; Morikawa et al. 1998; Mossner

et al. 2001). Altered SERT expression is implicated for multiple forms of

psychopathology, including schizophrenia and drug addiction; therefore, SERT has

become a potential therapeutic target for behavioural disorders (Zhao et al. 2006).

In addition, there is a paucity of data concerning the detailed mechanisms

behind the nootropic action of B. monniera, unraveling the bearings between the

behavioural and molecular events. Although a number of studies have explored the

various pharmacological activities of B. monniera, very little is known about its

interaction with serotonergic system. To gain more insight, the present study designed

to examine the interaction of B. monniera extract (BME) with serotonergic system

during different phases of learning and memory.

33

MATERIALS AND METHODS

1.2.1 Animals

Postnatal day (PND)-14 Wistar rat pups were housed in rectangular

polypropylene cages (43 x 27 x 15 cm). Paddy husk was used as bedding material

which was replaced once in two days. The animals had access to commercial standard

rodent chow and fresh water ad libitum. The animals were maintained under standard

12:12 h light-dark conditions, constant temperature (22 ± 1 ºC), and 60% relative

humidity. The experiments were conducted between 10:00 h and 17:30 h in a

semi-soundproof laboratory.

1.2.2 Plant material and extraction method

B. monniera plant was collected from the wild, Tiruchirappalli (10º48’10.39”N;

78º41’55.40”E), Tamilnadu, India and was taxonomically identified and authenticated

by Rapinat Herbarium, St Josephs college, Tiruchirappalli, India and the specimen is

preserved in the herbarium (specimen voucher No. RHT 63872). The shade-dried and

powdered leaves of B. monniera were weighed and soaked in water for 24 h. Water

was discarded and the residual plant material was extracted thrice with ethanol (95%)

by maceration (Phrompittayarat et al. 2007) (Figure 1.1). The obtained BME filtrates

was pooled and then evaporated to dryness using a rotary evaporator (Buchi Rotavapor,

Switzerland) under reduced pressure.

34

B. monniera leaves

Dried and powdered

Soaked for 24 h in 300 ml of double distilled water

Water squeezed and plant material soaked in 200 ml of 95% ethanol for 72 h at RT

(MACERATION)

Extract filtered through Whatman No.1 filter paper

Residue obtained was extracted twice using the same procedure

Filtrate combined and evaporated to dryness under reduced pressure with rotary

evaporator

Figure 1.1 Standardized procedure to extract bacosides from B. monniera leaves.

35

1.2.3 Identification of bacoside – Thin Layer Chromatography (TLC)

The presence of bacoside was initially determined using thin layer

chromatography (TLC). First the TLC plate (60F.sub.254, Silica gel, Merck) was

activated by incubating at 100 ºC for 1 h. TLC chamber was saturated for 1 h with

mobile phase containing in the composition of ethyl acetate: methanol: distilled water

(60: 14: 10). Standardized bacoside BESEB CDRI-08 (M/s Lumen Marketing Co.,

Chennai) along with the sample of BME (5.0 mg) was dissolved in 2 ml methanol and

each 2 µl was applied on TLC plates and run in mobile phase. The plate was developed

to a height of 8 cm and the spots were visualized with the help of developing agent

(vanillin: sulphuric acid: ethyl acetate = 1g: 5 ml: 5 ml) followed incubating plates at

110 ºC for 15 min.

1.2.4 HPLC analysis of BME

Sample preparation

BME (500 mg) was dissolved in 50 ml of methanol, sonicated for 10-15

minutes, cooled, made up to 100 ml with methanol, and filtered through a 0.45 µ

membrane filter prior to injection into the chromatographic system.

Instrumentation

The presence of bacoside was determined using Shimadzu HPLC system

equipped with a SPD-M10 AVP photodiode array detector (PDA) Deepak et al. (2005).

The mobile phase consists of A-0.25% orthophosphoric acid in water and

B-acetonitrile. The analysis took 45 min and the column oven temperature was

maintained at 25 °C. The combination of mobile phase A/B at different times was as

36

follows: at 0.00 min 75/25, at 25.00 min 60/40, at 35.00 min 40/60, at 38.00 min 75/25

and 45 min 75/25. The flow rate was 1.5 ml/min and the injection volume was 25.0 µl.

Separations were monitored at the wavelength of 205 nm and peak identities were

established by comparing the HPLC retention time with the reference compound.

Concentration of the bacosides was calculated using the formula described earlier

(Muthumary & Sashirekha 2007; Tiwari et al. 2010). The analysis repeated three times

to confirm the presence of compound in the extract.

1.2.5 Dose selection

A pilot study was conducted to establish the optimal dose of BME by evaluating

behaviour and toxicity. Rat pups aged PND-14 were randomly divided into four

groups as follows: (1) control (0.5% gum acacia + double distilled water) (n = 8);

(2) BME group I (20 mg/kg + 0.5% gum acacia) (n = 8); (3) BME group II

(30 mg/kg + 0.5% gum acacia) (n = 8); BME group III (40 mg/kg + 0.5% gum acacia)

(n = 8). During the brain growth spurt period (PND-15 to 29) (Mohandas Rao et al.

2005) the freshly prepared aqueous suspension was orally administered to the rats

everyday (10:00 – 11:00 h). Detailed experimental procedure adopted to select the

optimal dose shown in Figure 1.2.

37

Figure 1.2 Schematic representation of experimental method

Control (0.5 % gum acacia)

BME treated (20, 30 and 40 mg/kg BME)

(Behavioural analysis)

15 days - Oral administration

Wistar rats

(Rattus norvegicus)

Postnatal day (PND) - 14

PND – 15 to 29

Y-maze

Exploration (PND-30 & 31)

Learning (PND-32 to 37)

38

1.2.6 Bioassay of BME uptake

On PND-14 the pups were randomly divided into three groups control (n = 6),

BME (n = 6) and positive control (n = 6). From PND-15 to 29, rats were treated

accordingly. Two hours after the treatment on PND-29, the rats were sacrificed by

decapitation and blood samples were collected, and processed following the Sakuma

et al. (1987) procedure. The supernatant was transferred to a fresh micro centrifuge

tube and a 20 µl volume was injected in to the HPLC column (Torrance, CA, USA).

Standard was prepared with the concentration of 1 mg/ml in methanol and the working

concentration was prepared from the standard with methanol in the ratio of 1:20. The

standard and sample solutions were filtered through 0.45 µm syringe filter. The

separation was performed using a Shimadzu HPLC (Japan) system under the operating

conditions described earlier (Deepak et al. 2005).

1.2.7 Y-maze test

Y-maze apparatus consists of a start box, a stem (27.5 cm long) and the two

arms forming the arms of “Y” (both 27.5 cm long and diverging at 60º angle from the

stem). The arms are 5 cm width and 40 cm height, and each arm has a goal area

containing a food-well. The apparatus was designed with specifications described in

Van der Borght et al. (2007). The stem and start box of the Y-maze are separated with

a sliding door, which can be operated manually from the experimenter’s position and is

kept in a dimly lit, semi-sound proof room. The floor of the maze was covered with

husk, which was changed after each trial, in order to eliminate the olfactory stimuli.

The rat pups were randomly divided into control (n = 60) and BME (n = 60).

Following the BME administration, both group rats were allowed to explore the

39

Y-maze for five minutes prior to the training period on PND-30 and 31. Subsequently,

the acquisition test was conducted daily from PND-32 to 37, two trials per day. Each

rat was placed in the start box then the sliding door was released slowly after 20 sec.

Rats were allowed to move freely in the maze that leads to the goal area having the

food pellet by blocking the other arm that does not have the food pellet. Eight days

after the acquisition test, on PND-46, rats were subjected to memory test for eight days

(PND-46 to 53). In each trial, individual’s performance was recorded as number of

correct responses and latency to reach the food during the 5 min time.

1.2.8 Treatment schedule

PND-14 rat pups were randomly divided into three groups control (n = 6), BME

(n = 6) and positive control (n = 6). From PND-15 to 29, the control group rats

received 0.5% gum acacia, BME group rats received BME (40 mg/kg + 0.5% gum

acacia) and positive control group received bacoside A (12.52 mg/kg + 0.5% gum

acacia) by oral gavage using a ball ended feeding needle. Freshly prepared aqueous

suspension will be provided every day (10:00 h to 11:00 h) during the growth spurt

period (PND-15 to 29) (Mohandas Rao et al. 2005). Schematic representation of

experimental method is shown in Figure 1.3.

40

Figure 1.3 Schematic representation of experimental method

Positive Control

Negative Control BME group

Hindbrain tissue (Behavioral analysis)

Sacrificed at different phases

of behavioral test

(PND-29, PND-37, PND-45, PND-53)

15 days - Oral administration

of BME

Inter-experimental period

Expression pattern (Tph2 & SERT)

Wistar rats

(Rattus norvegicus)

Postnatal day (PND) - 14

PND – 15 to 29

Exploration

PND-30 & 31 PND-30 PND-30

Learning

PND-32 to 37 PND-31 PND-31

PND-38 to 45 24 hours 24 hours

Memory

PND-46 to 53 PND-32 PND-32

5-HT

DA

ACh

Glu

Neurotransmitter analysis

Y-maze Hole-board Passive avoidance

41

1.2.9 Behavioural test

Control and BME group rats were subjected to behavioural tests (Y-maze,

hole-board and passive avoidance test) to assess their learning ability and retention of

memory. Food restriction maintained as a motivation to animals at 80-85% of their

ad libitum (Toth & Gardiner 2000). All behavioural tests were conducted by an

investigator who was uninformed about the subject’s treatment.

1.2.10 Hole-board test

Hole-board apparatus was made up of a square wooden box (50 x 50 x 50 cm)

with four holes (3 cm diameter) at each corner. The apparatus was constructed based

on the specifications described by Saitoh et al. (2006). The apparatus was placed on a

turntable so that it could be rotated between trials during acquisition and retention.

Each rat was randomly assigned to a baited hole that remained the same for the rat

throughout testing. Rats allowed to learn the location of a baited hole in a single trial

and a retention test was conducted after 24 h.

Control (n = 12) and BME (n = 12) group rats were subjected to acquisition

session on PND-31; ten trials were given to each individual per session. Each trial

began by placing a rat into an opaque plastic start tube (open at both ends) positioned at

the center of the board. The tube was slowly removed, and the duration of each trial

was 3 min. During the trials, the animal allowed to explore the apparatus poking the

head into the hole to retrieve the food. The floor of the hole-board was cleaned of urine

and feces between trials. Retention test was conducted 24 hours after the acquisition on

PND-32. The protocol used during retention test was the same as that used during

42

acquisition. In each test the latency to reach the baited hole during the three minutes

test time was recorded.

1.2.11 Passive avoidance test

Passive avoidance (PA) task was a modification of Bures et al. (1983). The

training procedure is based on the innate preference of rodents for the dark chamber of

the apparatus. Exposure to inescapable shock in the dark chamber results in

suppression of this innate preference which serves as a measure of learning.

Rat pups were randomly divided into two groups as follows: control (n = 12)

and BME (n = 12) group. The apparatus consists of two compartments, separated by a

retractable guillotine door (6 × 6 cm); large illuminated safe compartment

(50 × 50 × 35 cm, with 25 W electric bulb) and smaller dark compartment (15 × 15 cm)

with an electrifiable grid. On PND-30, rat pups representing each group were

individually placed in the safe compartment and allowed to explore chambers for

3 min. On PND-31, rat pups were individually placed in the safe compartment, the

guillotine door was opened after 30 sec and the animal was allowed to enter the dark

compartment. Nine trials were given to each rat with 5 min of inter trial interval,

during the tenth trial, after the rat stepped completely with all its four paws into the

dark compartment, a mild inescapable foot shock (0.5 mA, 2 sec duration) was

delivered from the grid floor. Latency to enter the dark compartment was recorded for

each trial. At the end of the each trial, the rat was returned to its home cage. On

PND-32, rat pups from each group individually placed in the safe compartment with

door closed for 5 sec, and then the guillotine door was opened and allowed to enter the

43

dark compartment. The latency to enter the dark compartment was recorded and used

as a measure of retention.

1.2.12 Neurotransmitter analysis

Rats were decapitated and hindbrain was rapidly removed over dry ice and wet

tissue weighed. The tissue was homogenized in ice-cold perchloric acid (0.1 M)

containing reduced glutathione (1.6 mM) and Na2-EDTA (4.5 mM). The homogenates

were centrifuged at 12, 000 rpm at 15,777 x g for 20 min at 4 °C; the supernatant was

aspirated, filtered in a 0.22 μm membrane filter (Pall Life Sciences, Ann Arbor, MI,

USA) and stored at −80 °C until analysis. On PND-29, control (n = 6), BME (n = 6)

and positive control (n = 6) group level of different neurotransmitters 5-HT (EIA kit,

BioSource Europe S.A., Belgium), DA, Glu (EIA kit R&D Systems, MN, USA) and

ACh (Biodivision, CA, USA) was estimated from the homogenate respectively

according to the manufacturer’s instructions. In addition, 5-HT level was estimated

from animals representing each group (control and BME) at different phases of Y-maze

test: on PND-14 before BME treatment (n = 6), on PND-29 after BME treatment

(n = 6), after testing the learning ability on PND-37 (n = 6), and after the retention test

on PND-53 (n = 6).

1.2.13 Expression of Tph2 and SERT

Preparation of samples

The level of Tph2 and SERT mRNA expression in hindbrain was determined

from six animals representing each group (control and BME) before BME treatment on

PND-14 and at different phases of Y-maze test after the BME treatment on PND-29,

44

after testing learning ability on PND-37 and after the retention test on PND-53. Each

rat was sacrificed by cervical dislocation, the whole brain was dissected out and

hindbrain was rapidly removed over dry ice. Total RNA was isolated from hindbrain

tissue by using RNeasy Mini Kit (Qiagen, GmbH, Germany), according to the

manufacturer’s instructions. Total RNA was eluted in RNase free water containing

RNase inhibitor (1U/μl; Rnasin, Promega, Madison, USA). The concentration of RNA

was quantified by measuring the absorbance at 260 nm in a spectrophotometer (Optima

Inc, Japan).

Semi-quantitative RT-PCR

Total RNA (2.0 μg/sample) was reverse-transcribed using the AccessQuickTM

RT-PCR system (Promega, Madison, USA). First-strand cDNA was synthesized using

AMV reverse transcriptase in accordance with the manufacturer’s instructions. To

quantify the level of Tph2 and SERT expression, the semi quantitative RT-PCR method

was adopted. The degree of expression of the given genes was established by dividing

the amount of Tph2/SERT mRNA expression by the amount of β-actin mRNA

expression (Beaulieu et al. 2008). Specific primers were designed for Tph2, SERT, and

β-actin to amplify and estimate the level of expression (Table 1.1). Amplification

commenced with initial denaturation at 94 ºC for 2 min, followed by denaturing at

94 ºC for 45 sec, annealing for Tph2 (58 ºC for 45 sec), for SERT (55 ºC for 45 sec),

extension at 72 ºC for 45 sec, then final extension at 72 ºC for 10 min (MJ Mini

Gradient Thermal Cycler, Bio-Rad).

45

Table 1.1 Specific primers were designed and used to examine the expression pattern

of genes using semi-quantitative RT-PCR.

S. No. Gene Ta (ºC)

Size (bp)

Source (Genbank

accession number)

Primer Sequences

1. Tph2 58 ºC 648 NM_173839.2 For 5' ATGCAGCCCGCAATGATGAT 3' Rev 5' ACAACACCCCAAGTTTTAGT 3'

2. SERT 55 ºC 676 NM_013031.1 For 5' ATGGCCCTGAGCGATCTGGT 3' Rev 5' TCCCCACAAACTCATAGAGCA 3'

3. β-actin 55 ºC 350 AB004047 For 5' CATCCAGGCTGTGCTGTCCCT 3' Rev 5' TGCCAATAGTGATGACCTGGC 3'

Ta – primer annealing temperature.

46

For semi-quantitative measurements, we amplified the Tph2/SERT with β-actin

and optimized the number of PCR cycles (27, 30, or 33 cycles) to maintain

amplification within a linear range. 20 μl of each PCR product was electrophoresed on

agarose (1.0% w/v) gel containing ethidium bromide (0.5 μg/ml).

Images of the amplified products were acquired with a Molecular Imager

ChemiDoc XRS system (Bio-Rad, USA) and the intensity was quantified using image

analysis software (Quantity one, Bio-Rad, USA). Band intensity was expressed as the

relative peak density; Tph2/β-actin and SERT/β-actin product ratios were calculated as

indices of Tph2 and SERT mRNA expression.

1.2.14 Statistical analysis

Data were expressed as the mean ± standard error of mean (SEM) and plotted

with KyPlot (ver 1.0) for graphical representation. The results were statistically

evaluated using one way ANOVA in SigmaStat (ver 3.1). Differences were considered

significant if P < 0.05.

47

RESULTS

1.3.1 Thin Layer Chromatography (TLC)

The presence of bacoside in the B. monniera extract was analysed by TLC.

Retention factor (Rf) values indicate the presence of bacosides in the BME and it was

further confirmed by comparing the Rf of the commercially available pure bacoside

(Figure 1.4).

1.3.2 HPLC chromatogram of BME

B. monniera leaf ethanol extraction yield 11.87% of crude extract. Crude

extract was subjected to HPLC analysis and composition of bacosides present in the

extract was identified by comparing their retention times with those of the standard

bacoside mixture. The characterized B. monniera leaf extract contained 31.27%

bacosides, i.e. (1) bacopaside I (0.9%), (2) bacoside A3 (9.47%), (3) bacopaside II

(17.15%), (4) jujubogenin of bacopasaponin C (0.38%) and (5) bacopasaponin C

(3.37%) (Figure 1.5).

1.3.3 Uptake of BME

HPLC analysis demonstrated that the major marker compound bacoside A is

present in the serum after BME oral treatment on PND-29. The HPLC analysis revealed

that the serum of BME treated rats contained 75.0 µg/ml of bacoside A and the pure

bacoside A treated rats contained 109.0 µg/ml (Figure 1.6).

48

Figure 1.4 TLC showing the presence of bacosides. Retention factor (Rf) indicates

the presence of bacosides in the (L2) Bacopa monniera extract (BME) and

(L1) standard bacoside (BESEB CDRI-08).

Rf = 0.95

Rf = 0.82

Rf = 0.66

Rf = 0.57

Rf = 0.18

L1 L2

49

Figure 1.5 HPLC overlaid chromatogram of B. monniera extract (BME) along with

bacoside A and bacoside standard mix. Peaks were identified as follows

based on retention time: (1) Bacopaside I (2) Bacoside A3 (3) Bacopaside

II (4) Bacopasaponin C isomer (5) Bacopasaponin C.

50

Figure 1.6 HPLC analysis evidenced the uptake of bacoside A into the system, when

the rat pups were orally treated with BME from PND-15 to 29.

(A) Standard bacoside A (B) Pups treated with pure bacoside A (C) Pups

treated with BME (D) Pups treated with 0.5% gum acacia.

51

1.3.4 Dose selection

The rats treated with BME showed a dose-dependent enhancement in learning

and decreased latency towards reward in Y-maze test (Figure 1.7). BME group I

(20 mg/kg) rats showed 52.4% correct arm visits and BME group II (30 mg/kg) rats

showed 60.4% correct arm visits. When BME group I and II rat’s latency were

compared with control, there was no significant difference [20 mg/kg, F (1, 94) = 0.05,

P = 0.82; 30 mg/kg, F (1, 94) = 0.243, P = 0.624]. BME group III (40 mg/kg) rats

showed significantly [F (1, 94) = 11.46, P < 0.001] less latency with 87.5% correct arm

visits than the control group. Since, the BME (20 and 30 mg/kg) dose did not produce

any significant effect in learning, only 40 mg/kg dose was used for further comparative

analysis.

1.3.5 Y-maze test

Individual performance on Y-maze is shown in Figure 1.8. During learning,

BME treated group rats showed significantly less [F (1, 382) = 137.78, P < 0.001] latency

with high percentage of correct arm visits than the control group. Similarly, when the

retention of memory was tested, BME received rats exhibited significantly less latency

[F (1, 510) = 85.24, P < 0.001] and high percentage of correct arm visits than control.

These results suggest that BME significantly improves learning and retention of

memory.

52

Figure 1.7 Administration of BME from PND-15 to 29 BME showed a dose-

dependent enhancement in learning and decreased latency in Y-maze test.

(A) number of correct arm visits (B) latency to retrieve the reward. Values

expressed in mean ± SEM; *** P < 0.001.

(A)

(B)

53

Figure 1.8 Administration of BME from PND-15 to 29 enhances learning and

memory in Y-maze. (A) number of correct arm visits (B) latency to

retrieve reward during learning and retention. Values expressed in

mean ± SEM; ** P < 0.01, *** P < 0.001.

(A)

(B)

54

1.3.6 Hole-board test

BME treatment significantly reduced [F (1, 238) = 22.135, P < 0.001] latency

compared to control on PND-31 during acquisition in hole-board. Similarly,

significantly [F (1, 238) = 22.82, P < 0.001] less latency was recorded for the BME group

compared to control during the retention test on PND-32 (Figure 1.9).

1.3.7 Passive avoidance test

Results of passive avoidance test in exploration and retention of memory are

shown in Figure 1.10. During exploration, there was no significant difference

[F (1, 238) = 1.334, P = 0.249] between animals treated with BME and control group.

Interestingly, during retention test animals treated with BME did not show preference

to enter the dark compartment, and their recorded latency was significantly higher

[F (1, 238) = 223.74, P < 0.001] than control.

1.3.8 Level of neurotransmitters

Level of neurotransmitters was estimated in the hindbrain by ELISA following

treatment with BME. The analysis revealed that continuous treatment of BME from

PND-15 to 29 resulted elevation in levels of 5-HT, ACh and Glu, and reduced the level

of DA. Rats received BME showed significant increase in 5-HT level

[F (1, 10) = 591.12, P < 0.001] when compared to control. Similarly, ACh level was

increased in BME treated rats and positive control rats compared to control rats. The

estimated variation was not significantly different between BME and control

[F (1, 10) = 3.407, P = 0.139].

55

Figure 1.9 Effect of BME on hole-board test performance in acquisition and retention.

Values expressed in mean ± SEM; *** P < 0.001.

56

Figure 1.10 Transfer latency to enter the dark compartment in passive avoidance task.

Values expressed in mean ± SEM; *** P < 0.001.

57

However, significant difference was found between positive control and control

[F (1, 10) = 12.190, P = 0.025].

Likewise, estimated Glu level was higher in BME treated and positive control

rats compared to control. However, the variations was not significantly different

[control vs BME: F (1, 10) = 3.407, P = 0.139; control vs positive control:

F (1, 10) = 0.623, P = 0.513] between groups. In contrast, DA level was decreased in

BME received and positive control rats compared to control. The estimated variations

was significantly different [control vs BME: F (1, 10) = 20.31, P < 0.05; control vs

positive control: F (1, 10) = 117.76, P < 0.05] between groups. The 5-HT levels on

PND-29 did not differ between the BME and the positive control [F (1, 10) = 1.729,

P = 0.28] (Figure 1.11). We also analyzed the 5-HT level at different phases of

Y-maze test. On PND-29 and PND-37, 5-HT level was significantly higher

[F (1, 10) = 205.05, P < 0.001] in BME group than control. However, the estimated

significant difference in 5-HT levels [F (1, 10) = 1.029, P = 0.334] did not extended up to

PND-53 (Figure 1.12).

1.3.9 Expression of Tph2 and SERT

Effect of BME on serotonergic system was evaluated by estimating the expression

level of Tph2 and SERT mRNA. In BME group, a significant increase [F (1, 10) =

1176.073, P < 0.001] in Tph2 mRNA level was estimated on PND-29 (Figure 1.13)

compared to control, the trend continued upto PND-37 [F (1, 10) = 129.989, P < 0.001].

On PND-53 the level of Tph2 mRNA did not differ significantly [F (1, 10) = 3.157,

P = 0.106] between the BME and control group.

58

Figure 1.11 Effect of Bacoside and BME treatment during PND 14-29 on the level of

5-HT in hindbrain. Values expressed in mean ± SEM; *** P < 0.001.

59

Figure 1.12 Estimated level of 5-HT during different phases of behavioural study.

Values expressed in mean ± SEM; *** P < 0.001.

60

Figure 1.13 Semi-quantitative RT-PCR analysis shows expression pattern of (A) Tph2

mRNA during different phases of behavioural study, (B) Estimated level

of Tph2 expression. Values expressed in mean ± SEM; *** P < 0.001.

(A)

(B)

61

To explore whether the enhancement of 5-HT induce SERT expression; the

level of SERT mRNA was estimated. As shown in Figure 1.14, corresponding to Tph2

expression, similar expression pattern in SERT mRNA level was observed in the BME

group. The level of SERT mRNA expression was higher in BME group than control on

PND-29 [F (1, 10) = 284.671, P < 0.001] as well as on PND-37 [F (1, 10) = 22.748,

P < 0.001]. However, the estimated level of SERT mRNA expression revealed no clear

significant difference on PND-53 [F (1, 10) = 3.213, P = 0.103] between BME and

control group.

Taken together the behavioural, biochemical and expression analyses suggest

that BME treatment enhances the learning ability and memory, possibly through

modulating serotonin synthesis by up-regulating the expression of Tph2 and SERT.

62

Figure 1.14 Semi-quantitative RT-PCR analysis shows differential expression of

SERT, (A) expression pattern of SERT during different phases of

behavioural study, (B) Estimated level of SERT expression. Values

expressed in mean ± SEM; *** P < 0.001.

(A)

(B)

63

DISCUSSION

Effect of BME on neurotransmitter mediated learning and memory was

investigated, BME (40 mg/kg) was orally provided to the postnatal rats for fifteen days

(PND-15 to 29) during brain growth spurt period. The observed behavioural responses

in Y-maze, hole-board and passive avoidance test showed that BME treated rats

performed significantly higher than control group rats during acquisition and retention.

It does clearly indicate that oral administration of BME has enhanced the learning and

memory of rats and it was supported by earlier reports (Singh & Dhawan 1997; Vollala

et al. 2010). HPLC analysis showed the presence of bioactive compound in the serum

of BME treated rats, which demonstrated the uptake of BME into the system. To the

best of our knowledge, this is the first report on the determination of major biologically

active compound bacoside A in the serum after oral administration of BME.

Earlier studies have indicated that monoamine transmitters are essential to

mediate many physiological functions involved in behaviour, cognition, affection, and

emotion as well as neuroendocrine secretion (Mann 1999; Marien et al. 2004), and the

monoamine transporters determine the neurotransmitters intensity and duration of

signal at synapses (Hersch et al. 1997; Nelson 1998). The balanced function of various

neurotransmitters such as ACh, 5-HT (Reis et al. 2009), GABA (Kant et al. 1996) and

Glu (Saraf et al. 2009) were all reported to involve in the regulation of memory

formation. Among monoamine neurotransmitters, 5-HT is considered to be involved in

diverse physiological and behavioural regulations such as mood, sleep, aggression,

cognition, memory, and feeding, as well as depression (Dutton & Barnes 2008).

However, data on the effects of drugs based on 5-HT in learning and memory in

experimental systems from Aplysia to human, explains the role of 5-HT (Barbas et al.

64

2002; Meyer et al. 2009). It has been reported that the BME treatment increased the

level of 5-HT in hippocampus, hypothalamus and cerebral cortex (Sheikh et al. 2007),

and also modified the ACh concentration directly/indirectly through other

neurotransmitter systems. The observed effect of BME on learning and memory could

be directly or indirectly associated with serotonergic system, such as 5-HT metabolism,

release, transportation and action on its receptors. In the present study, the level of

5-HT significantly up-regulated after BME treatment, ACh level was altered and DA

level was reduced. These observations concluded that the bioactive compounds in

BME possibly influence 5-HT synthesis. The elevated 5-HT level possibly activates

their receptor, which may facilitate the release of ACh (Consolo et al. 1994). Notably,

on the other hand the inhibitory effects of cholinesterase activity of B. monniera also

alter the ACh level and enhance memory (Das et al. 2002; Joshi & Parle 2006). The

decreased cholinesterase activity might reduce the DA level and excess ACh turnover

which also possibly enhance the memory (Das et al. 2005). After the administration of

BME for a period of 15 days (PND-15 to 29), 5-HT level increased significantly, and

then attained basal level. However, the observed trend in the 5-HT level had drawn the

attention to examine the effect of BME on 5-HT system. Earlier study reported that

acute stress-induced 5-HT level is normalized by pre-treatment of BME (Sheikh et al.

2007), and that would be regulation of 5-HT level possibly by the negative feedback

mechanism of Tph2 (Fujino et al. 2002; Mo et al. 2008).

Since the Tph2 modulates the synthesis of 5-HT (Zhang et al. 2004), in order to

gain insight into the activation of BME in 5-HT metabolism, the expression pattern of

Tph2 was analysed. The semi-quantitative RT-PCR analysis revealed that the

expression pattern of Tph2 is similar to that of the pattern of 5-HT level. The

increasing level of Tph mRNA expression elevated Tph2 activity and 5-HT

65

metabolism, which profoundly could influence the synaptic 5-HT activity (Chamas

et al. 1999). In addition, SERT plays a key role in clearance of the released 5-HT

through transport across pre-synaptic membrane (Gainetdinov & Caron 2003). Several

clinically used antidepressant drugs act on the binding site of SERT and modulate the

extracellular level of 5-HT (Tatsumi et al. 1997). These influences paved way to

investigate whether BME treatment up-regulated SERT to increase 5-HT reuptake, it

provide the clue to examine the level of SERT expression. The obtained expression

pattern was similar to Tph2 expression in accordance to the age and treatment. The

up-regulated SERT expression could regulate the reuptake of released 5-HT, and could

control the duration and intensity of signals at the synapse. The enhanced level of

5-HT possibly activated the signaling pathway that could interact with MAPK/ERK,

which leading to the phosphorylation of CREB1 (Michael et al. 1998; Fioravante et al.

2006). Following treatment of B. monniera enhanced MAPK, PKA and

phosphorylation of CREB has also been reported recently (Saraf et al. 2010). Taken

together the behavioural, biochemical and expression of the present investigations, it is

suggested that BME treatment enhances the learning ability and memory, possibly

through modulating 5-HT synthesis and its transportation.

The present study demonstrates that bioactive compound present in ethanolic

extract of B. monniera enhances learning and retention of memory. The enhancement

of learning and memory possibly due the activation of serotonergic system, the

up-regulated Tph2 expression positively enhance the synthesis of 5-HT while the

up-regulated SERT expression could effectively transport 5-HT and regulate the

signaling pathway.