chapter-3 - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf ·...
TRANSCRIPT
![Page 1: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/1.jpg)
89
Chapter-3
MATERIALS AND METHODS
Page
3.1 Ethics Statement 91
3.2 Inclusion Criteria 91
3.3 Exclusion Criteria 91
3.4. Viruses 91
3.5 Pilot Study 91
3.5.1 Sample Size for standardizing the assays 92
3.5.2 Dengue Duo Rapid Test SD BIOLINE (KOREA)-Dengue 94
NS1Ag+Ab combo
3.5.3 Platelia™ Dengue NS1 Ag ELISA Biorad Laboratories 95
3.5.4 Panbio® Dengue Early ELISA (Inverness Medical Innovations, Australia) 96
3.5.5 Dengue IgG capture ELISA (Pan Bio pvt. Ltd, Queensland, Australia) 98
3.5.6 Dengue IgM capture ELISA (Pan Bio pvt. Ltd, Queensland, Australia) 99
3.5.7 RNA extraction 101
3.5.8 In-house NS1 serotype specific RT-PCR assay 103
3.5.8.1. Selection and synthesis of NS1 Serotype specific oligonucleotide 103
primers
3.5.8.2 Standardization of RT-PCR amplification 104
3.5.8.3 Dengue virus typing by second-round amplification with 105
type-specific primers
3.5.8.4 CDC DENV 1-4 Real-Time RT-PCR Assay 106
3.5.8.5 In vitro transcription and quantitation of RNA 107
3.5.8.6 Sensitivity of NS1 serotype specific RT-PCR assay 108
3.5.8.7 Specificity of NS1 RT-PCR assay 109
3.5.8.8 Inter run assay 108
3.5.8.9 Intra run assays 109
3.5.8.10 Precision 109
3.5.9 Reverse Transcription Loop-Mediated Isothermal Amplification 109
(RT-LAMP) Assay
![Page 2: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/2.jpg)
90
3.5.9.1 Design of DENV serotype-specific RT-LAMP primers 109
3.5.9.2 Optimization of the RT-LAMP reaction 113
3.5.9.3 Detection methods for RT-LAMP results 114
a. Agarose gel analysis 114
b. Visual Detection 114
3.5.9.4 Comparison of RT-LAMP with RT-PCR and CDC 1-4 115
real-time PCR
3.5.9.5 RT-PCR assay with F3, B3 primers 115
3.5.9.6 CDC DENV 1-4 Real-Time RT-PCR Assay 115
3.5.9.7 Performance parameters of DENV RT-LAMP 116
a. Sensitivity of serotype-specific dengue virus-specific 116
RT-LAMP assay
b. Specificity of RT-LAMP assay 116
c. Nucleotide Sequencing and Phylogenetic Analysis 116
d. Inter run assay 116
e. Intra run assay 116
3. 6 Clinical Samples for Main study 117
3.6.1 Serological assays 118
3.6.2 Molecular assays 118
3.6.2.1 RNA Extraction 118
3.6.2.2 Primers 118
3.6.2.3 NS1 Serotype-specific RT-PCR assay 119
3.6.2.4 NS1 Serotype-specific RT-LAMP assay 119
3.6.2.5 Template 119
3.6.2.6 NS1 serotype-specific RT-LAMP assay in Loopamp 119
real-time turbidimeter
3.6.2.7 CDC DENV 1-4 real-time RT-PCR Assay 119
3.7 To document Unusual and rare manifestations of Dengue in patients suffering 120
with Dengue fever/Dengue hemorrhagic fever/Dengue shock syndrome
3.8 Statistical analysis 122
![Page 3: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/3.jpg)
91
MATERIALS AND METHODS
3.1 Ethics Statement
The study was approved by the Institutional Ethics Committee of Nizam’s Institute of
Medical Sciences (EC/NIMS/1336/2012). Informed consent in English and local languages
was obtained to collect blood sample from all the study subjects (Annexure-I, II & III).
3.2 Inclusion Criteria
1) Patients of either sex above 17 years of age.
2) Patients presenting with acute febrile illness, having positive serological test for dengue
antigen (NS1) or antibody (IgM), or both.
3.3 Exclusion Criteria
The exclusion criteria includes: if routine lab tests, i.e. platelet count, complete blood count,
malaria parasite, chest X-ray, etc., were already done and those reports suggested bacterial
infections or any clinical diagnosis other than viral infections and if the patient or his/her
guardian refused to give their consent.
All the samples for the Pilot and Main study were collected by following Universal
precautions.
3.4 Viruses
Reference strains of the four dengue virus serotypes DENV-1, RR107 (KF289072), DENV-2,
GWL18(AY324614), DENV-3, ND143 (FJ644564), DENV-4, ND73 (HM237348) were
used in this study (Dash et al., 2004; Dash et al., 2011; Neeraja et al., 2013).
![Page 4: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/4.jpg)
92
3.5 Pilot Study
A pilot study preceded the original study. The process entailed the testing of the feasibility of
undertaking the full study by:
1. Designing the NS1 serotype-specific RT-PCR assay and RT-LAMP assay using
conserved NS1 region of the DENV genome as the target site.
2. Standardizing the assay’s performance and operational characteristics using plasma in
comparison with CDC 1-4 real-time RT-PCR assay.
3. Determining the performance characteristics of the RT LAMP using the Standard strains.
4. Statistical analysis of the results.
3.5.1 Sample Size for standardizing the assays
Serum and Plasma were collected from150 individuals with known Dengue status by ELISA.
1. 50 samples from individuals who were positive for NS1 antigen by ELISA and RT-PCR
positive by D1 and D2 consensus primers (Lanciotti et al.,1992) collected between day
1-5 post onset of fever, from Department of Microbiology, Nizam’s Institute of Medical
Sciences, Hyderabad and Sir Ronald Ross Institute of Tropical and Communicable
Diseases, Nallakunta, Hyderabad, Telengana.
2. 50 samples from individuals who were positive for Dengue specific anti-IgM positive by
ELISA and RT-PCR positive by D1 and D2 consensus primers (Lanciotti et al., 1992 )
collected between day 5-9 post onset fever from Department of Microbiology, Nizam’s
Institute of Medical Sciences, Hyderabad and Sir Ronald Ross Institute of Tropical and
Communicable Diseases,Nallakunta, Hyderabad, Telengana.
3. 50 samples from Individuals negative for Dengue Virus (Healthy volunteers from Blood
bank, Nizam’s Institute of Medical Sciences, Hyderabad).
4. Samples for specificity: 10 JE , 10 WNV archived samples from DRDE Gwalior and
10 HCV positive samples from our tertiary care hospital was performed to check for
specificity of serotype-specific dengue NS1 RT-PCR and RT-LAMP assay. Since clinical
symptoms of dengue mimic that of Chikungunya, 10 samples which were positive for
CHIKV RNA were also tested for specificity.
5. Samples for sensitivity: RNAfrom each serotype reference strain [DENV-1, RR107
(KF289072), DENV-2, GWL18 (AY324614), DENV-3, ND143 (FJ644564), DENV-4,
ND73 (HM237348)] with known copy number was tested both by DENV NS1 serotype
specific RT-LAMP and RT-PCR for sensitivity.
![Page 5: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/5.jpg)
93
SEROLOGICAL ASSAYS
MOLECULAR ASSAYS MOLECULAR ASSAYS
Figure 3.1. Testing Algorithm for standardization of serological and molecular assays in pilot study.
Serum / Plasma N= 150
(Known DENV Status)
Dengue Duo rapid
positive=150
Positive
Weak positive
Negative
NS1 antigen ELISA,
Dengue IgM & IgG
ELISA
Dengue IgM/
IgG positive/
Lanciottii PCR
Negative
NS1 antigen
positive/
Lanciottii PCR
NS1 serotype specific RT
PCR
CDC 1-4 Real time PCR
N=150
NS1 Serotype
specific RT
LAMP
Positives Negatives Positives Negatives Positives Negatives
![Page 6: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/6.jpg)
94
Diagnostic Assays
Serologic testing:
All the 150 serum samples were separated and screened for Dengue specific NS1 Ag by rapid
and ELISA method, Dengue-specific IgG and IgM antibodies by ELISA on the same day.
3.5.2 Dengue Duo Rapid Test SD BIOLINE (KOREA) - Dengue NS1Ag + Ab combo
SD Bioline Dengue Duo kit is a rapid, in vitro immune chromatographic, one step assay
designed to detect both dengue virus NS1 antigen and qualitative and differential test for the
detection of antibodies to Dengue virus (Dengue IgG/IgM) in human serum, plasma or whole
blood. The SD BIOLINE Dengue Duo rapid test kit is produced by Standard Diagnostics and
is a one-step immune chromatographic assay designed for the detection of both dengue virus
NS1 antigen and differential IgM/IgG antibodies to dengue virus in human whole blood,
serum, or plasma. The SD BIOLINE Dengue Duo rapid test contains two test devices; the left
side is for dengue NS1 antigen test, whereas the right side is for dengue IgG/IgM test. These
kits were designed based on the principle that when a specimen is added to the sample well,
anti-dengue IgG and IgM in the specimen will react with recombinant dengue virus envelope
proteins-colloidal gold conjugates and forms a complex of antibodies-antigen. This complex
will be captured by the relevant anti-human IgG and/or anti-human IgM immobilized on the
test device and generate a colored line when migrated along the length of the test device by
capillary action. Similarly, dengue NS1 antigen captured by the anti-dengue NS1 Ag-colloid
gold conjugate will migrate along the length of the device until being captured by the anti-
dengue NS1 antigen immobilized on the membrane strips and generate a color line. All tests
in this study were carried out in accordance with the manufacturer's instructions. Briefly, for
SD BIOLINE dengue NS1 Ag device, 100 µL of the test sample was added into the sample
well (S). Test results were interpreted at 15–20 minutes. Similarly, for SD BIOLINE dengue
IgG/IgM device, 10 µL of test sample was added into the sample well (S). This was followed
by the addition of 4 drops (90–120 µL) of assay diluent to the round shaped assay diluent
well. Results were interpreted at 15–20 minutes (Figure 3.2). The test results were examined
and interpreted according to the manufacturer instructions by three different readers to avoid
biasness.
![Page 7: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/7.jpg)
95
Figure 3.2. Dengue Duo Rapid Test for detection of NS1 Ag and IgG and IgM antibody.
3.5.3 Platelia™ Dengue NS1 Ag ELISA Biorad Laboratories
The test system (Platelia Dengue NS1 Ag ELISA, BioRad Laboratories, France) is based on a
one-step sandwich format microplate enzyme immunoassay to detect DENV NS1 antigen in
human serum or plasma. It makes use of murine monoclonal antibodies for capture and
detection. If NS1 antigen is present in the sample, an immune-complex MAb-NS1-
MAb/peroxidase will be formed. The presence of immune complex is demonstrated by
development of color reaction which is directly proportional to the amount of NS1 Ag present
in the sample. All the samples and controls were screened for the presence of NS1 Ag
according to the manufacturer’s recommendations. All sera were tested in a single well.
ELISA Procedure
1. Samples and controls were diluted 1:2 with sample diluent (50 µl sample diluent was
added to 50 µl of samples and controls and mixed well. The final dilution of the sample
was 1:2).
![Page 8: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/8.jpg)
96
2. 100 µl of diluted conjugate (conjugate is diluted 1:50 with conjugate diluent) was added
to the diluted samples and controls.
3. Microtitre plate (microplate wells coated with purified mouse anti- NS1 monospecific
antibodies horseradish peroxidase-labeled anti-NS1 monoclonal antibody) was incubated
for 90 min at 37°C.
4. Wells were washed six-times with wash buffer (Washing buffer diluted 1:20 with distilled
water).
5. 160 µl of substrate [Tetramethylbenzidine (<0.1%), H2O2(<1%)] was added into each
well and incubated for 30 min at room temperature in the dark.
6. The presence of immune-complex was demonstrated by a color development and the
enzymatic reaction was stopped by adding 100 µl of 1 N H2SO4.
7. The OD reading was taken with a spectrophotometer at a wavelength of 450–620 nm and
the amount of NS1 antigen present was determined by comparing the OD of the sample to
the OD of the cut-off control.
Interpretation of Results:
The decision as to whether NS1 antigen was considered to be present or absent in an
individual sample was based on comparisons of the OD for the sample with that of the cutoff
control serum. The cutoff value (CO) corresponded to the mean OD values for the cutoff
control duplicates provided in the kit. Sample results were expressed as a ratio, using the
following formula: sample ratio = S/CO, where S is the OD obtained for the sample.
According to the manufacturer’s recommendations, samples were considered (i) nonreactive
for dengue virus NS1 antigen if this ratio was less than 0.5, (ii) equivocal for dengue virus
NS1 antigen if this ratio was in the range of 0.5 to 1.0, and (iii) reactive for dengue virus NS1
antigen if a ratio of 1.0 or more was obtained.
3.5.4 Panbio® Dengue Early ELISA (Inverness Medical Innovations, Australia)
The Panbio Dengue Early ELISA is a capture ELISA for qualitative detection of NS1 antigen
in serum. Serum dengue NS1 antigen when present binds to anti-NS1 antibodies attached to
the polystyrene surface of microwells. After removal of residual serum by washing, HRP
conjugated Anti–NS1 MAb is added. After incubation and then washing of the microwells a
colourless substrate system, tetramethylbenzidine/hydrogen peroxide (TMB/H2O2) is added.
![Page 9: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/9.jpg)
97
The substrate is hydrolysed by the enzyme and the chromogen changes to a blue colour.
Addition of the stop solution will change the TMB in to yellow. Colour development is
indicative of the presence of dengue NS1 antigen in the test sample.
ELISA Procedure:
1. Samples, calibrators and controls were diluted 1:2 with sample diluent (75 µl sample
diluent was added to 75 µl of samples and controls and mixed well. The final dilution of
the sample was 1:2).
2. 100 µl of diluted samples and controls were added to their respective microwells and
incubated at 37oC for 60 min.
3. After washing 100 µl of HRP Conjugated Anti–NS1 MAb was added and incubated at
37oC for 60 min.
4. Antigen-antibody complexes were detected after washing by addition of 100 µl of substrate
chromogen solution and incubating in the dark at room temperature for 10 minutes.
5.The reaction was stopped by adding 100 µl of 1 N H2SO4 and the optical densities were
read at 450/620 nm within 30 minutes.
Interpretation of Results:
Calculations
The average absorbance of calibrator triplicates was calculated and multiplied by the
calibration factor. This is the cutoff (CO). Index value was calculated by dividing the sample
absorbance by the cutoff value (CO).
According to the manufacturer’s recommendations, samples were considered (i) negative for
dengue virus NS1 antigen if this index value was less than 0.9, (ii) equivocal for dengue virus
NS1 antigen if this index value was in the range of 0.9 to 1.1, and (iii) positive for dengue
virus NS1 antigen if index value of more than 1.1 was obtained.
![Page 10: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/10.jpg)
98
3.5.5 Dengue IgG capture ELISA (Pan Bio, Queensland, Australia)
The Panbio Dengue IgG Capture ELISA is for the qualitative detection of IgG antibodies to
dengue antigen in serum, as an aid in the clinical laboratory diagnosis of patients with clinical
symptoms consistent with dengue fever. Serum antibodies of the IgG class, when present,
combine with anti-human IgG antibodies attached to the polystyrene surface of the microwell
test strips. A concentrated pool of Dengue 1-4 Antigens is diluted to the correct working
volume with antigen diluent. An equal volume of the HRP conjugated monoclonal Antibody
(MAb) is added to the diluted antigen, which allows the formation of antigen-MAb
complexes. Residual serum is removed from the assay plate by washing, and complexed
antigen-MAb is added to the assay plate. After incubation and then washing of the
microwells a colourless substrate system, tetramethylbenzidine/hydrogen peroxide
(TMB/H2O2) is added. The substrate is hydrolysed by the enzyme and the chromogen
changes to a blue colour. Addition of the stop solution will change the TMB in to yellow.
Colour development is indicative of the presence of dengue anti-dengue IgM antibodies in
the test sample.
ELISA Procedure
1. All the samples, controls and calibrators were diluted 1:100 (10 µL of samples or controls
were added to 990 µL of Sample Diluent).
2. Antigen was diluted 1:250 with antigen diluents and mixed with equal volume of MAb
tracer in a clean glass vial.
3. Within 10 minutes after mixing the MAb Tracer and diluted antigen, 100 µL diluted
patient sample and controls were added into their respective microwells and incubated
for 60 minutes at 37ºC±1ºC.
4. After washing with 20x PBS the antigen-MAb tracer solution is mixed before transfer
and 100 µL of antigen-MAb complexes is added to the appropriate wells of the assay
plate. Plate is incubated for 60 minutes at 37ºC±1ºC.
5. Antigen-antibody complexes were detected after washing by addition of 100 µl of
substrate chromogen solution and incubating in the dark at room temperature for 10
minutes.
6. The reaction was stopped by adding 100 µl of 1 N sulfuric acid and the optical densities
were read at 450/620 nm within 30 minutes.
![Page 11: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/11.jpg)
99
Interpretation of Results:
Calculations
The average absorbance of calibrator triplicates was calculated and multiplied by the
calibration factor. This is the cutoff (CO). Panbio units were calculated as Index Value X 10.
Index value was calculated by dividing the sample absorbance by the cutoff value (CO).
According to the manufacturer’s recommendations, samples were considered (i) negative for
elevated IgG antibody levels if this index value was less than 1.8 (<18 Panbio units), (ii)
equivocal if this index value was in the range of 1.8 to 2.2 (18-22 Panbio units), and (iii)
positive for detectable elevated IgG antibodies, if index value of more than 2.2 (>22 Panbio
units) was obtained.
3.5.6 Dengue IgM capture ELISA (Pan Bio, Queensland, Australia)
The Panbio Dengue IgM Capture ELISA is for the qualitative detection of IgM antibodies to
dengue antigen in serum, as an aid in the clinical laboratory diagnosis of patients with clinical
symptoms consistent with dengue fever. Serum antibodies of the IgM class, when present,
combine with anti-human IgM antibodies attached to the polystyrene surface of the microwell
test strips. A concentrated pool of Dengue 1-4 Antigens is diluted to the correct working
volume with antigen diluent. An equal volume of the HRP conjugated monoclonal Antibody
(MAb) is added to the diluted antigen, which allows the formation of antigen-MAb
complexes. Residual serum is removed from the assay plate by washing, and complexed
antigen-MAb is added to the assay plate. After incubation and then washing of the
microwells a colourless substrate system, tetramethylbenzidine/hydrogen peroxide
(TMB/H2O2) is added. The substrate is hydrolysed by the enzyme and the chromogen
changes to a blue colour. Addition of the stop solution will change the TMB in to yellow.
Colour development is indicative of the presence of dengue anti-dengue IgM antibodies in
the test sample.
ELISA Procedure
1. All the samples, controls and calibrators were diluted 1:100 (10 µL of samples or controls
were added to 990 µL of Sample Diluent).
![Page 12: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/12.jpg)
100
2. Antigen was diluted 1:250 with antigen diluents and mixed with equal volume of MAb
tracer in a clean glass vial.
3. Within 10 minutes after mixing the MAb Tracer and diluted antigen, 100 µL diluted
patient sample and controls were added into their respective microwells and incubated
for 60 minutes at 37ºC±1ºC.
4. After washing with 20x PBS the antigen-MAb tracer solution is mixed before transfer and
100 µL of antigen-MAb complexes is added to the appropriate wells of the assay plate.
Plate is incubated for 60 minutes at 37ºC±1ºC.
5. Antigen-antibody complexes were detected after washing by addition of 100 µl of
substrate chromogen solution and incubating in the dark at room temperature for 10
minutes.
6. The reaction was stopped by adding 100 µl of 1 N sulfuric acid and the optical densities
were read at 450/620 nm within 30 minutes.
Interpretation of Results:
Calculations
The average absorbance of calibrator triplicates was calculated and multiplied by the
calibration factor. This is the cutoff (CO). Panbio units were calculated as Index Value X 10.
Index value was calculated by dividing the sample absorbance by the cutoff value (CO).
According to the manufacturer’s recommendations, samples were considered (i) negative for
elevated IgM antibody levels if this index value was less than 0.9 (<9 Panbio units), (ii)
equivocal if this index value was in the range of 0.9 to 1.1 (9-11 Panbio units), and (iii)
positive for detectable elevated IgM antibodies, if index value of more than 1.1 (>11 Panbio
units) was obtained.
Molecular assays
Prior to further processing, the stored plasma samples were thawed to room temperature.
The following molecular assays were performed and standardized on the plasma collected
from acute phase samples and reference strains as positive control.
![Page 13: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/13.jpg)
101
1. Initial screening of all 150 samples by D1 and D2 consensus primers from Lanciotti et al.
2. NS1 serotype specific RT-PCR assay standardized using CDC 1-4 Real time RT-PCR
assay as gold standard.
3. NS1 Serotype specific RT- LAMP assay standardized using CDC 1-4 Real time RT-PCR
assay as gold standard.
3.5.7 RNA extraction:
The viral RNA was extracted from 140µl of the serum/ plasma samples by using the QIAamp
viral RNA mini kit (Qiagen, Germany). Briefly, the sample was first lysed (lysis buffer)
under highly denaturing conditions to inactivate RNases and to ensure isolation of intact viral
RNA. Buffering conditions were then adjusted to provide optimum binding of the RNA to the
QIAamp membrane, and the sample was loaded onto the QIAamp Mini spin column. RNA
bound to the membrane, and other contaminants were efficiently washed away in two steps
using two different wash buffers. The RNA was eluted from the QIAspin columns in a final
volume of 50 µl of elution buffer and stored at -700 C until testing.
Figure 3.3. Schematic presentation of RNA Isolation.
RNA isolation Procedure: (Figure 3.3)
1. Pipetted 560 µl of prepared Buffer AVL containing carrier RNA into a 1.5 ml micro
centrifuge tube.
2. To this 140 µl plasma, was added, mixed by pulse-vortexing for 15 s and incubated at
room temperature (15–25°C) for 10 min.
3. Briefly centrifuged the tube to remove drops from the inside of the lid.
![Page 14: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/14.jpg)
102
4. 560 µl of ethanol (96–100%) was added to the sample, and mixed by pulse-vortexing for
15 sec. After mixing, briefly centrifuged the tube to remove drops from inside the lid.
(Only ethanol should be used since other alcohols may result in reduced RNA yield and
purity. In order to ensure efficient binding, it is essential that the sample is mixed
thoroughly with the ethanol to yield a homogeneous solution. 630 µl of the solution from
step was carefully applied to the QIAamp Mini column (in a 2 ml collection tube) without
wetting the rim.Cap was closed, and centrifuged at 6000 x g (8000 rpm) for 1 min.
QIAamp Mini column was placed into a clean 2 ml collection tube, the tube was
discarded containing the filtrate. Each spin column was closed in order to avoid cross-
contamination during centrifugation.
5. Centrifugation was performed at 6000 x g (8000 rpm) in order to limit micro centrifuge
noise. Centrifugation at full speed will not affect the yield or purity of the viral RNA. If
the solution has not completely passed through the membrane, centrifuge again at a
higher speed until all of the solution has passed through.
6. QIAamp Mini column was carefully opened and step 6 was repeated.
7. QIAamp Mini column was carefully opened, and 500 µl of Buffer AW1 was added to it.
The cap was closed, and centrifuged at 6000 x g (8000 rpm) for 1 min.
8. QIAamp Mini column was placed in a clean 2 ml collection tube (provided), and
discarded the tube containing the filtrate. (It is not necessary to increase the volume of
Buffer AW1 even if the original sample volume was larger than 140 µl).
9. QIAamp Mini column was carefully opened, and add 500 µl of Buffer AW2 was added to
it. Cap was closed and centrifuged at full speed (20,000 x g; 14,000 rpm) for 3 min. To
eliminate any chance of possible carryover, step 10 was performed, and then continued
with step 11. (Note: Residual Buffer AW2 in the elute may cause problems in
downstream applications. Some centrifuge rotors may vibrate upon deceleration, resulting
in flow-through, containing Buffer AW2, contacting the QIAamp Mini column.
Removing the QIAamp Mini column and collection tube from the rotor may also cause
![Page 15: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/15.jpg)
103
flow-through to come into contact with the QIAamp Mini column. In these cases, the
optional step 10 should be performed).
10. QIAamp Mini column was placed in a new 2 ml collection tube (not provided), and
discarded the old collection tube with the filtrate. (This step was a recommended step for
complete removal of the buffers) Centrifuged at full speed for 1 min.
11. QIAamp Mini column was placed in a clean 1.5 ml microcentrifuge tube (not provided).
Old collection tube was discarded containing the filtrate. QIAamp Mini column was
carefully opened and 60 µl of buffer AVE was added. Cap was closed and incubated at
room temperature for 1 min. Centrifuged at 6000 x g (8000 rpm) for 1 min.
Extracted Viral RNA was stored at –70°C until further use.
3.5.8 In house NS1 serotype specific RT-PCR assay
3.5.8.1 Selection and synthesis of NS1 Serotype specific oligonucleotide primers
Dengue virus consensus primers Dl and D2 targeting C-prM gene junction were synthesized
from available published sequences (Lanciotti R et al., 1992).
The nucleotide sequence of the NS1 gene of DENV, representative of respective genotype
and serotype strain was retrieved from GenBank accessed on April 2012.
For DENV-1, -2, -3 and -4 sequences listed as sylvatic strains were excluded. Segments of
these genomes were aligned using MegAlign software (DNAStar; Madison, WI). A
consensus sequence was generated for each serotype that showed bases conserved across
≥95% of sequences included in the alignment. This identified a region of the NS1 gene that
was highly conserved within each DENV serotype.
![Page 16: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/16.jpg)
104
Figure 3.4. Selection of target for NS1 Serotype-specific RT-PCR and RT-LAMP assay.
Using the 95% consensus sequence, primer quest software (Integrated DNA Technologies)
was used to generate primer sets directed against segments of the NS1 gene for all four
serotypes. The primer designed in house is shown in (Table 3.1). The primers were tested in
silico using BLASTn to query the NCBI nucleotide database.
The following criteria were used in designing the serotype specific primers:
(i) Maximum homology to the respective serotypes, (ii) Non-homology to other regions of
dengue virus genomes as well as to heterologous serotype and (iii) High melting temperature.
We found low probability of homodimer or heterodimer formation using OligoAnalyzer 3.1
(www.idtdna.com/analyzer) with predicted ∆G≥−9 kcal/mol. Oligonucleotides were
synthesized byActive TM
oligos from Imperial Life Science, Gurgaon, India. By using
serotype specific primers, single reaction NS1 serotype specific RT-PCR assay was
standardized for serotyping of dengue virus.
3.5.8.2 Standardization of RT-PCR amplification
Initially, the presence of the dengue specific RNA in the clinical samples was detected by
using consensus D1 and D2 primer.
PrimeScriptTM
One Step RT-PCR Kit Ver.2 (Takara Bio Inc.) which is designed to perform
RT-PCR in a single tube was utilized for RT-PCR amplification.
![Page 17: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/17.jpg)
105
Principle
PrimeScriptTM One Step RT-PCR Kit Ver.2.0 allows reverse transcription from RNA to
cDNA using PrimeScriptTM RTase and subsequent PCR amplification using TaKaRa Ex
Taq TM HS in the same tube.
Protocol
The reaction mixture was prepared as follows:
Amplification of RNA was carried out in 50 µl reaction volume with PCR mix containing
Prime Script TM 1 step Enzyme Mix and its buffer along with respective forward and reverse
primer in a thermal cycler (Applied Biosystems, USA). The thermal profile of the RT-PCR
reaction was reverse transcription at 50°C for 30 min, initial denaturation at 950C for 2 min,
followed by 35 cycles of denaturation at 950C for 1 min, annealing at 55
0C for 1 min,
extension at 720C for 2 min and final extension at 72
0C for 10 min. The PCR products were
gel purified from 2% composite agarose gel (NuSieve 3:1; FMC BioProducts, Rockland,
Maine).
3.5.8.3 Dengue virus typing by second-round amplification with type-specific primers
All the samples which were positive in 1
st round of RT–PCR, the extracted RNA was
subjected to amplification with NS1 serotype specific primers mentioned in Table 3.1. The
reaction mixture contained all the components described for the initial amplification reaction
with the following exceptions: primer D1 and D2 was replaced with the respective dengue
virus serotype NS1-specific primers (DENV1, DENV2, DENV3, DENV4) under same
Reagents Volume Final concentration
PrimeScriptTM 1 step Enzyme Mix 2 µl
2 X 1 step buffer 25 µl
Forward Primer (20 µM) (sense ) 1 µl 0.4 µM
Reverse Primer(20 µM) (anti-sense) 1 µl 0.4 µM
Template RNA X µl 10 µl
RNase Free deionized water up to 50 µl
![Page 18: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/18.jpg)
106
conditions with an annealing temperature of 600C. The reaction product was electrophoresed
on a 2% composite agarose gel (NuSieve 3:1; FMC BioProducts, Rockland, Maine) in 0.4 M
Tris,0.05 M sodium acetate, 4.01M EDTA buffer, and staining with ethidium bromide and
visualization in gel documentation system (SYNGENE, UK).
Table 3.1. Details of NS1serotype specific RT-PCR assay primer sets used for rapid detection and
differentiation of dengue virus serotypes 1, 2, 3 and 4 targeting NS1 region of the viral genome.
Sl.
No.
Primer
Name
Primer Sequence 5' to 3'
Genome
Position
Size in bp
of amplified
product
(primers)
1 D1 TCAATATGCTGAAACGCGCGAGAAACCG 134-161
511 2 D2 TTGCACCAACAGTCAATGTCTTCAGGTTC 616-644
3 DENV1 FP CGGCTCTATAGGAGGAGTGTT 108-129
308 4 DENV 1 RP TGTCCAGGTGTGAACTTCATTAG 392-415
5 DENV2 FP GGCCAAAGTCACACACTCTAT 86-107
313 6 DENV2 RP ATCCATCCTCACCTCTGTATCT 376-398
7 DENV3 FP GTGTGCTAGAGAGTGACATGAT 128-150
270 8 DENV3 RP CATGTATCGCAGAGGAGGAAG 376-397
9 DENV4 FP CAGACCTGGCAGATAGAGAAAG 625-647
291 10 DENV4 RP GATGCAGTAGTGGTCCTCAAA 894-915
FP- Forward primer, RP- Reverse primer, DENV- Dengue virus
3.5.8.4 CDC DENV 1-4 Real-Time RT-PCR Assay
A Real-time RT-PCR assay from CDC was used as a standard test for Dengue virus serotype
specific identification in ABI 7500 quantitative PCR system (ABI, USA). The assay is based
on Taqman chemistry including a panel of oligonucleotide primers and dual labeled
hydrolysis probe sets (D1, D2, D3, D4) employing Invitrogen SuperScriptTM
III Platinum®
one step quantitative kit.
All the primers and probes were reconstituted with 100 µL of Nuclease free water, and
allowed to stand at room temperature for 1 hr. After primers and probes are fully rehydrated,
pulse vortexing was done to ensure a homogeneous solution. The primers and probes were
aliquoted in sterile tubes for use to prevent contamination. The concentration of 4 primers
![Page 19: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/19.jpg)
107
(D1, D2, D3, D4) used was 5 nM and concentration of probes was 1 nM. The protocol for
CDC1-4 real time RT-PCR assay id shown in Table 3.2.
Table 3.2. Protocol for CDC 1-4 real time RT-PCR assay reaction.
Reagent
Volume
V olume/rx
Total Number
Reactions (N)
Total
Volume
Nuclease-free Water 2.2 µL N x 2.2 µL N = 10 + 1 = 11 24.2 µL
2X premix 12.5 µL N x 12.5 µL N = 10 + 1 = 11 137.50 µL
Primer D1-F 0.5 µL N x 0.5 µL N = 10 + 1 = 11 5.5 µL
Primer D1-R 0.5 µL N x 0.5 µL N = 10 + 1 = 11 5.5 µL
Primer D2-F 0.25 µL N x 0.25 µL N = 10 + 1 = 11 2.75 µL
Primer D2-R 0.25 µL N x 0.25 µL N = 10 + 1 = 11 2.75 µL
Primer D3-F 0.5 µL N x 0.5 µL N = 10 + 1 = 11 5.5 µL
Primer D3-R 0.5 µL N x 0.5 µL N = 10 + 1 = 11 5.5 µL
Primer D4-F 0.25 µL N x 0.25 µL N = 10 + 1 = 11 2.75 µL
Primer D4-R 0.25 µL N x 0.25 µL N = 10 + 1 = 11 2.75 µL
Probes (DENV-1-4) 0.45 µL N x 0.45 µL N = 10 + 1 = 11 4.95 µL SuperScriptTM III
RT/Platinum®Taq
Mix
0.5 µL N x 0.5 µL N = 10 + 1 = 11 5.5 µL
Total Volume 20 µL N x 20 µL 220 µL
The amplification was carried out in a 25µl reaction volume. Instruction and standard thermal
profile for sample screening was as follows, reverse transcription 50°C for 30 min, initial
denaturation and enzyme inactivation 95°C for 2 min, 45 cycles of extension at 95°C for 15
sec and 60°C for 1min of denaturation and annealing extension respectively (Chien et al.,
2006). The reagents include 2X buffer (Invitrogen One-step RT-PCR kit, USA) 12.5 µl,
enzyme mix 0.5µl, D1/D3 both forward and reverse primers 0.5µl (5nM), D2/D4 both
forward and reverse primers 0.25µl (5nM) and D1-D4 probe 0.45µl (1nM) each and DEPC
treated water added up to a total volume of 25µl. Finally, 5µl of viral RNA elute extracted
from different samples was added for Real-time RT-PCR assay.
3.5.8.5 In vitro transcription and quantitation of RNA
The template of specific target of each serotype was amplified using T7 forward primers and
respective reverse primers. Indian virus isolates [DEN-1, RR107 (KF289072), DEN-2,
GWL18 (AY324614), DEN-3, ND143 (FJ644564), DEN-4, ND73 (HM237348)] for each
![Page 20: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/20.jpg)
108
specific serotype were used for amplification of the product (D1-308 bp, D2-313 bp, D3-270
bp, D4-291 bp). RT-PCR amplified and Low melting gel purified PCR product was used as a
template for in vitro transcription. The amount of RNA transcript for each serotype was
found to be D1-1419 ng/µl, D2-14179 ng/µl, D3-15561 ng/µl, D4-14201 ng/µl respectively
which was calculated D1-6.9X1013
copies/µl, D2-8.0X1013
copies/µl, D3-102.08X1013
copies/µl, D4-8.61X1012
copies/µl.
3.5.8.6 Sensitivity of NS1 serotype-specific RT-PCR assay
The sensitivity of the DENV-1,-2,-3 and -4 NS1 RT-PCR specific assays was determined
through logarthimetic dilutions of in vitro-transcribed RNA.
3.5.8.7 Specificity of NS1 RT-PCR assay
The authenticities of the amplified products were established by nucleotide sequencing with
forward and reverse primers of each serotype using ABI 3130 sequencer. Further cross
reaction within 4 serotypes and with closely related members of flavivirus family i.e., 10 JE ,
10 WNV archived samples from DRDE Gwalior and 10 HCV positive samples from our
tertiary care hospital was performed to check for specificity of serotype specific dengue NS1
RT-PCR assay. Since clinical symptoms of dengue mimic that of Chikungunya, 10 samples
which were positive for CHIKV RNA were tested by NS1 RT-PCR for dengue. Panel of 50
healthy controls were also tested by dengue NS1 RT–PCR, to rule out possibility of false
positive reactions.
3.5.8.8 Inter run assay
Inter-assay variability for reproducibility was assessed by testing 10 samples by 2
investigators by in house developed NS1 serotype-specific RT-PCR assay on 3 days.
![Page 21: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/21.jpg)
109
3.5.8.9 Intra run assays
The intra-assay variability for repeatability was assessed by simultaneously testing the RNA
extracted from DENV NS1 antigen positive patient 10 times, by the NS1 serotype specific
RT-PCR assay, on the same day.
3.5.8.10 Precision
Both intra- and inter-run precision was done for each serotype at three concentrations (high-
positive, low-positive, and limit-of-quantitation) using reference RNA from CDC Real time
PCR kit.
3.5.9 Rapid Detection and Differentiation of Dengue virus Serotypes by NS1-specific
Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP)
assay
3.5.9.1 Design of DENV serotype-specific RT-LAMP primers
DENV serotype specific oligonucleotide primers were designed from NS1 region of DENV
genome. The nucleotide sequence of the NS1 gene of DENV, representative of respective
genotype and serotype strain was retrieved from GenBank (DENV-1, accession no.
EU863647; DENV-2, accession no.A F162448; DENV-3, accession no. EU371057; and
DENV-4, accession no KC620380) and was aligned with the available NS1 gene sequences
from global DENV strains including the circulating strains in India, to identify the conserved
regions using DNASIS software (Hitachi, Japan). The primers were selected based on
criteria described by Notomi et al., (2000).
The potential target region corresponding to the genome positions was selected from the
aligned sequences, and RT-LAMP primers were designed from conserved region of each
serotype using the Primer Explorer version 4 software (Eiken Chemical Co., Tokyo, Japan).
A set of six primers comprising two outer (F3 and B3), two inner (FIP and BIP) , and two
loop primers (FLP and BLP) that recognize eight distinct regions on the target sequence was
designed .The primers were selected based on criteria described previously by Notomi et al.,
(2000).
![Page 22: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/22.jpg)
110
Figure 3.5a. RT- LAMP primer details designed from Primer Explorer Version 4 from
Eiken genome site.
FIP: Forward Inner Primer (FIP) consists of the F2 region (at the 3' end) that is
complementary to the F2c region, and the same sequence as the F1c region at the 5' end.
F3 Primer: Forward Outer Primer consists of the F3 region that is complementary to the F3c
region.
BIP: Backward Inner Primer (BIP) consists of the B2 region (at the 3' end) that is
complementary to the B2c region, and the same sequence as the B1c region at the 5' end.
B3: Backward Outer Primer consists of the B3 region that is complementary to the B3c
region.
The Loop Primers:
Loop Forward & Loop backward primers containing sequences complementary to the single
stranded loop region (between the F1 and F2 regions or between the B1 and B2 regions,
respectively) on the 5' end of the dumbbell-like structure, provides an increased number of
starting points for DNA synthesis for the RT-LAMP method (Figure 3.5b).
![Page 23: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/23.jpg)
111
Figure 3.5.b. Loop Forward & Loop backward primers containing sequences complementary to the
single stranded loop region.
Proper primer design is crucial for performing RT-LAMP amplification. Primer regions can
be determined by using the Primer Explorer (special software to design RT-LAMP primers)
after considering the base composition, GC contents and the formation of secondary
structures. Tm value can be obtained by Nearest Neighbor method.
The following are the main points of primer design considered in designing by Primer
explorer.
1. Distance between primer regions
-The distance between 5' end of F2 and B2 is considered to be 120-180 bp, and the distance
between F2 and F3 as well as B2 and B3 is 0-20 bp.
-The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 40-60 bp.
2. Tm value for primer regions
About 60-65°C in the case of GC rich and Normal, about 55-60°C for AT rich.
3. The stability of primer end
The dG calculated on 6 bp from the following end regions should be less than -4kcal/mol, 5'
end of F1c/B1c and 3' end of F2/B2 as well as F3/B3.
4. GC contents
About 50-60% in the case of GC rich and Normal, about 40-50% for AT rich.
![Page 24: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/24.jpg)
112
5. Secondary structure
Primers should be designed so as not to easily form secondary structures. 3' end sequence
should not be AT rich or complementary to other primers.
6. Others
If the restriction enzyme sites exist on the target sequence, except the primer regions, they
can be used to confirm the amplified products.
All the designed primers were synthesized commercially (Active oligos, Imperial Life
Sciences, Gurgaon, India).
The primers were selected based on criteria described previously by Notomi et al (2000). The
details of each primer with regard to their positions in the genomic sequences are shown in
Table 3.3. All primers were assessed for specificity before use in LAMP assays with a
BLAST search with sequences in GenBank.
![Page 25: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/25.jpg)
113
Table 3.3. Details of NS1 Serotype-Specific RT-LAMP assay primer sets used for rapid detection and
differentiation of dengue virus serotypes 1, 2, 3, and 4 targeting NS1 region of the viral genome.
Virus
Serotype Primer Sequence (5′ → 3′) Target
Size
DENV-1
F3 TGTGGGAAAACTGGTACAC 191bp
B3 CCTGGACCATGACTCCTAG
FIP ATCCCTATTCCTATTTTCATGGTCCTTTTCAGATCTTTGGAACTGCGT
BIP CTGCTGACATGGCTGGGATTATTTTGTACAGTGTGACCATGCC
FLP CACCGCTGAACAAAACTCCAT
BLP TCCCTTTCAATGACGTGTATCG
DENV-2 F3 CAAACAGCAGGACCTTGG 199bp
B3 ATCCATCCTCACCTCTGT
FIP ACATTCTTCGGTTACCACCACTTTTTGCAAGCTTGAGATGGACT
BIP AGAGGGCCTTCTTTAAGAACAACTTTTTGGTGGTAGTGTGCAAGA
FLP TGGTCCCTTCGCAGAAATCAA
BLP CACTGCCTCAGGAAAACTCATAA
DENV-3 F3 CCCTCATAGAGGTGAAAACC 186bp
B3 TGAAGTCCAGCTCCAATT
FIP GGAATGATCATGTCACTCTCTAGCTTTTGCACATGGCCAAAATCAC
BIP AGAGTCTAGCTGGTCCTATTTCGTTTTTTCCTAAGTGCCAGGGTC
FLP ACACCGTTGCTCCAAAGAGT
BLP CAACACAACTACAGGCCCG
DENV-4 F3 CGAGCTAAACTATGTTCTCTG 185bp
B3 TCAAAAATGTGCTATTTCTTGC
FIP TGCCTTTGGTTAACACCCCTTTTTTTGGAAGGAGGACATGACCT
BIP GAGCACTCACACCTCCAGTGTTTTTCTGGAGTGAAGATTTTTGC
FLP GGCATAGCCCTGGCGATAA
BLP GAATGCCCCGGAACAACAGTCAC
F3, forward outer primer; B3, backward outer primer; FIP, forward inner primer; BIP,
backward inner primer; FLP, forward loop primer; BLP, backward loop primer.
3.5.9.2 Optimization of the RT-LAMP reaction
LAMP was carried out in a final reaction volume of 25 µl. The reaction mixture contained 15
µl of Isothermal Master Mix ISO-001 (Optigene, U.K.) containing, Geobacillus species
DNApolymerase, thermostable inorganic pyrophosphatase, optimized buffer including
MgCl2, dNTPs and ds-DNA dye (Optigene, U.K.), 1 µl Primer mix consisting of 6 primers
each for DENV-1, DENV-2, DENV-3, and DENV-4 (F3 and B3 primers at 0.2 µM, FIP and
BIP primers at 0.8 µM, LF and LB primers at 0.4 µM), 0.25 Units AMV reverse
transcriptase (Promega, Madison, WI), 3.75 µl Nuclease free water and 5 µl extracted
nucleic acid.
![Page 26: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/26.jpg)
114
The LAMP assay was run at temperatures between 62 to 67oC and time between 60 min to 35
min in the real-time fluorometer (Genie® II from Optigene, U.K.) to determine the optimal
temperature with the shortest amplification time and highest fluorescence reading. All LAMP
assays were subsequently run at 63oC for 35 min followed by a heating and cooling step to 98
oC to 80
oC (0.05
oC/sec) to allow re-annealing of amplified DNA and display of the annealing
curve. The Genie II displays amplification signals in real time and at the end of the run
displays the time to positivity which is expressed in terms of plots of fluorescence signals
(real time curves) and Tm for each specimen. The analysis of each sample was performed in a
set of four tubes, with serotype specific primer mixture. The Tm for DENV-1 was 82.42 o
C,
DENV-2 was 84.67 oC, DENV-3 was 86.17
o C and DENV-4 was 88.12
oC.
Positive and negative controls were included in each run, and all precautions to prevent cross-
contamination were observed. Amplification of DNA leads to an increase in fluorescence
emitted from a DNA intercalating dye. This increase was monitored in real time using the
Genie® II fluorometer.
3.5.9.3 Detection methods for RT LAMP results
3.5.9.3a Agarose gel analysis
Following incubation at 63°C for 35 min, a 10 µl of aliquot of the RT-LAMP assay products
was electrophoresed on 3% NuSieve 3:1agarose gel (Biowhittaker Molecular Applications,
Rockland, Maine) in Trisboratebuffer, followed by staining with ethidium bromide and
visualization on a UV transilluminator at 302 nm.
3.5.9.3b Visual Detection
In order to facilitate the field application of the RT-LAMP assay, monitoring of amplification
was done visually with an unaided eye. Following amplification in Genie® II flourometer 1
µl of SYBR Green I intercalating dye was added to the reaction tube. The RT-LAMP
amplification was visually monitored for colour change. Positive reaction turned the reaction
mix green and fluoresces under the white light and UV irradiation, respectively. The reaction
mix remained orange and non-fluorescent in the absence of amplification. This change of
color is permanent and thus can be kept for record purposes.
![Page 27: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/27.jpg)
115
3.5.9.4 Comparison of RT-LAMP with RT-PCR and CDC 1-4 RT-PCR
3.5.9.5 RT-PCR assay with F3, B3 Primers
In order to compare the sensitivity and specificity of the RT-LAMP assay, one-step RT-PCR
was performed by employing the two outer primer pairs (50 pmol of F3 and B3) targeting the
NS1 gene of each serotype. Amplification of RNA was carried out in 50 µl reaction volume
with PCR mix containing PrimeScriptTM
1 step Enzyme Mix and its buffer along with
respective sense (F3) and antisense (B3) primer in a thermal cycler (Applied Biosystems,
USA). The thermal profile of the RT-PCR reaction was reverse transcription at 50°C for 30
min, initial denaturation at 950C for 2 min, followed by 35 cycles of denaturation at 95
0C for
1 min, annealing at 600C for 1 min, extension at 72
0C for 2 min and final extension at 72
0C
for 10 min (Neeraja et al., 2013).
3.5.9.6 CDC DENV 1-4 Real-Time RT-PCR Assay
A Real-time RT-PCR assay from CDC was used as a standard test for DENV serotype
specific identification in ABI7500 quantitative PCR system (ABI, USA). The assay is based
on Taqman chemistry including a panel of oligonucleotide primersand dual labeled
hydrolysis probe sets (D1, D2, D3, D4) employing Invitrogen SuperScriptTMIII Platinum®
one step quantitative kit. The amplification was carried out in a 25 µl reaction volume.
Instruction and standard thermal profile forsample screening was as follows, reverse
transcription 50°C for 30 min, initial denaturation and enzyme inactivation 95°C for 2 min,
45 cycles of extension at 95°C for 15 sec and 60°C for 1min of denaturation and annealing
extension respectively (Chien LJ et al., 2006). Briefly, the reagents include 2X buffer
(Invitrogen One-step RT-PCR kit, USA) 12.5µl, enzyme mix 0.5µl, D1/D3 both forward and
reverse primers 0.5µl (5nM), D2/D4 both forward and reverse primers 0.25 µl (5nM) and D1-
D4 probe 0.45 µl (1nM) each and DEPC treated water added up to a total volume of 25 µl.
Finally, 5 µl of viral RNA elute extracted from different samples was added for Real-time
RT-PCR assay.
![Page 28: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/28.jpg)
116
3.5.9.7 Performance parameters of DENV RT-LAMP
3.5.9.7a Sensitivity of serotype-specific dengue virus-specific RT-LAMP assay
The sensitivity of the NS1 serotype specific RT-LAMP assay was determined through serial
dilutions of in vitro transcribed DENV from each serotype reference strain [DENV-1, RR107
(KF289072), DENV-2, GWL18 (AY324614), DENV-3, ND143 (FJ644564), DENV-4,
ND73 (HM237348)] with known copy number.
3.5.9.7b Specificity of RT-LAMP assay
The specificity of the primers for detecting DENV serotypes was validated by testing 10
samples that were positive for other Flaviviruses viruses including JE, WNV, HCV and
CHIKV. In addition, the authenticities of the amplified products were also established by
nucleotide sequencing of amplified products with outer (F3) and inner (B3) primers (Parida et
al., 2007).
3.5.9.7c Nucleotide Sequencing and Phylogenetic Analysis
Nucleotide sequencing of the NS1 gene of randomly selected Dengue viruses from the
clinical samples, which included one DENV-2 (VL998) and two DENV-3 (VL524, VL2086),
was carried out by employing the Big Dye Terminator Cycle Sequencing Ready Reaction kit
with an ABI 3100 sequencer (Applied Biosystems, USA) for identifying the genotype of the
DENV serotype by following the standard protocol (Dash et al., 2004) The sequences were
initially subjected to BLAST to find the closest sequence identity. Further, phylogenetic
analyses which were based on the NS1 gene junction of DENV-2 and DENV-3 were carried
out by including a large number of geographically diverse DENV gene sequences, by using
the Neighbour-Joining (NJ) method of the MEGA3 software version 3.1 (Kumar et al., 2004).
The sequences were submitted to GenBank under the accession numbers KC571834 for
DENV2 and KJ584531, KF301600 for DENV3.
3.5.9.7d Inter run assay
Inter assay variability for reproducibility was assessed by testing 1 sample of each serotype in
5 separate LAMP runs and recording time and Tm for each serotype.
![Page 29: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/29.jpg)
117
3.5.9.7e Intra run assay
The intra assay variability for repeatability was assessed by simultaneously testing 4 samples
of each serotype which included 2 strong positive and 2 weak positive of each serotype.
3.6 Clinical Samples for Main study
3217 acute phase and early convalescent samples based on reporting time of patients were
collected from patients with a history of sudden onset of fever, and the presence of two or
more of the symptoms viz. headache, eye pain, nausea, vomiting, rash, myalgia, and
abdominal pain suggestive of dengue like infection. Acute-phase serum and plasma samples
were obtained from the patients either admitted to the hospital and from those who were
referred by treating clinician to the Nizam’s Institute of Medical sciences which is a tertiary
care hospital and Sir Ronald Ross Institute of Tropical Medicine, Hyderabad, India for
diagnosis from different area in and around Hyderabad during the study period i.e. between
July 2011 to December 2013. There was no sampling bias or any attempt to specifically
recruit patients. The Dengue/DHF/DSS case proformas prepared as per the WHO protocol
(WHO, 2009) were filled by the treating clinicians. Acute phase samples were collected from
patients reported 1-5 days of fever and early convalescent phase serum from patients who
came after 5 days of fever. 50 samples were collected from healthy controls.
Two sets of whole-blood specimens were collected from all 3217 patients. One set with
EDTA vacutainer tubes (BD Biosciences) was used for molecular assays; whereas the other
set collected in SST vacutainer tubes (BD Biosciences) underwent serological assays. All the
3217 serum samples were separated and screened for Dengue specific NS1 Ag by rapid and
ELISA method, Dengue specific IgG and IgM antibodies by ELISA on the same day. Plasma
samples were aliquoted in sterile vials and stored at -800C at the Department of
Microbiology, Nizam’s Institute of Medical Sciences until testing.
Confirmation of DENV infection was done based on the WHO criteria (history of fever with
two or more of the following manifestations; headache, retro-orbital pain, myalgia, arthralgia,
maculo-papular rash, hemorrhagic manifestation and Leucopenia) and laboratory diagnosis of
dengue was established by demonstration of NS1 Ag, Dengue IgG or IgM ELISA, RT-PCR
and CDC RT-PCR for the presence of DENV RNA.
![Page 30: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/30.jpg)
118
The samples were processed for DENV RNA using the in house developed NS1 Serotype
specific RT-PCR and RT-LAMP procedures standardized in the pilot study as per the testing
algorithm (Figure 3.1).
3.6.1 Serological assays
All the 3217 serum samples were separated and screened for Dengue specific NS1 Ag by
rapid and ELISA method, Dengue specific IgG and IgM antibodies on the same day as per
the standardized protocol from Pilot study.
3.6.2 Molecular assays
600/3217 samples were confirmed as DENV infection by detection of NS1 Ag, dengue IgM
antibodies, dengue IgG antibodies, conventional NS1 serotype specific RT-PCR assay, CDC
real-time RT-PCR assay and NS1 serotype specific RT-LAMP assay either alone or in
combinations.
Molecular assays were done on 600 seropositive plasma samples collected between day 1-10
post onset of fever and 50 samples from healthy donors as per the procedures standardized in
pilot study.
3.6.2.1 RNA Extraction (Qiagen, Germany)
RNA was extracted from all 650/3217 samples as per the standardized procedure in the Pilot
study.
3.6.2.2 Primers
The primers for NS1 serotype specific RT-PCR assay and NS1 serotype specific RT-LAMP
assay which were standardized in the pilot study were used for the main study.
![Page 31: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/31.jpg)
119
3.6.2.3 NS1 Serotype specific RT-PCR assay
RNA was extracted from all 650 samples and subjected to NS1 serotype specific RT-PCR
assay with following cycling conditions standardized in pilot study. Amplification of RNA
was carried out in 50 µl reaction volume with PCR mix containing PrimeScriptTM 1 step
Enzyme Mix and its buffer along with respective forward and reverse primer of each serotype
in a thermal cycler (Applied Biosystems, USA). The thermal profile of the RT-PCR reaction
was reverse transcription at 50°C for 30 min, initial denaturation at 95°C for 2 min, followed
by 35 cycles of denaturation at 95°C for 1 min, annealing at 60°C for 1 min, at 72°C for 2
min and final extension at 72°C for 10 min. The PCR products were gel purified from 2%
composite agarose gel (NuSieve 3:1; FMC BioProducts, Rockland, Maine).
3.6.2.4 NS1 Serotype specific RT-LAMP assay
RT-LAMP reaction Genie®II real-time flourometer was performed as per the protocol
standardized in the Pilot study.
3.6.2.5 Template
The RNA extracts from all the 650 Plasma samples of the main study group were used as
templates for the NS1 Serotype specific RT-LAMP assay.
RT-LAMP reaction was performed in the real-time flourometer (Genie® II from Optigene,
U.K.) in which each run was carried at 63oC for 35 min followed by a heating and cooling
step to 98oC to 80
oC (0.05
oC/sec) to allow re-annealing of amplified DNA and display of the
annealing curve. The analysis of each sample was performed in a set of four tubes, with
serotype specific primer mixture.
3.6.2.6 NS1 serotype specific RT-LAMP assay in Loopamp real time turbidimeter
50 randomly selected samples positive by RT-LAMP assay in Genie® II real-time
flourometer were also tested in Loopamp Turbidimeter with RNA Amplification Kit; (Eiken
chemical company, Japan). The RT-LAMP reaction was carried out in a 25 µl reaction
mixture with the following reagents (final concentration): 20 mM Tris-HCl (pH 8.8), 10 mM
![Page 32: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/32.jpg)
120
KCl, 10 mM (NH4)2SO4, 0.1% Tween 20, 0.8 M betaine, 8 mM MgSO4, 1.4 mM dNTP each,
enzyme mix containing 8U of Bst DNA polymerase and 50 U of AMV reverse transcriptase
each (Eiken Chemical Co.). The amount of primers needed for one reaction was: 40 pmol FIP
and BIP, 20 pmol LF and LB, 5 pmol F3 and B3 each for each serotype. Finally, an
appropriate amount of template RNA was added to the reaction tube. The reaction was
carried out at 63°C for 45 minutes and inactivated at 80°C for 2 minutes. The analysis of each
sample was performed in a set of four tubes, each of which had the primer mixture for a
particular serotype. Positive and negative controls were included in each run, and all
precautions to prevent cross-contamination were observed. The real-time monitoring of
amplification of the dengue virus template by the RT-LAMP assay was observed through
spectrophotometric analysis by recording the optical density at 400 nm every 6 sec with the
help of the Loopamp real-time turbidimeter (LA-200; Teramecs, Japan).
3.6.2.7 CDC DENV 1-4 Real-Time RT-PCR Assay
CDC DENV 1-4 Real-Time RT-PCR Assay was performed on all 650 samples of main study
to once again compare NS1 Serotype specific RT-PCR and RT-LAMP assay with CDC
DENV 1-4 Real-Time RT-PCR assay.
3.7 To document Unusual and rare manifestations of Dengue in patients suffering
with Dengue fever/Dengue hemorrhagic fever/Dengue shock syndrome
The study included 175 hospitalized patients admitted with dengue like illness from July
2011 to June 2013. The study was conducted following an approval by the Institutional
Ethics Committee of Nizam’s Institute of Medical Sciences (EC/NIMS/1336/2012).Written
informed consent was obtained from each of 175 hospitalized patients. Acute-phase serum
and plasma samples were obtained during days 1–15 after the onset of symptoms, for
serology and molecular assays, respectively. The Dengue/DHF/DSS case proformas,
prepared as per the WHO protocol (WHO: 2009), were filled in by the treating clinicians.
Hospitalized patients were diagnosed with DENV infection based on the WHO criteria
(history of fever with two or more of the following manifestations: headache, retro-orbital
pain, myalgia, arthralgia, maculo-papular rash, hemorrhagic manifestation and Leucopenia)
and laboratory diagnosis of dengue was established by demonstration of Dengue specific NS1
![Page 33: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/33.jpg)
121
Ag, Dengue IgG or IgM ELISA and or both, Reverse Transcription PCR (Lanciotti et al.,
1992) and CDC Real Time PCR for DENV RNA.
These patients were prospectively followed from July 2011 to June 2013. A detailed history
as well as a general and systemic clinical examination was noted. The daily profiles of the
hematological and biochemical investigations were followed and recorded. Platelet count was
done for all the patients from the day of admission sequentially till discharge. A platelet count
<100,000 cells/mm3 was considered as thrombocytopenia. Bleeding manifestations were
recorded either by presence of petechiae, epistaxis, gum bleeding, hematemesis, melena, or
positive tourniquet test. Signs of plasma leakage were assessed by chest radiograph and
abdominal ultrasonography. Hypotension or circulatory failure was recorded by the presence
of cold clammy skin and restlessness, tachycardia and weak pulse with pulse pressure <20
mmHg. The Clinical diagnosis of dengue encephalitis was done by symptoms like neck
stiffness, altered sensorium, behavioral disorders. Specific investigations were performed
sequentially in patients who presented with neurological involvement (cerebrospinal fluid
analysis, neuroimaging, electro-diagnostic studies). Hepatic failure was reported by screening
for viral hepatitis markers, liver function tests with AST/ALT values 10 times higher than
normal value (8-40U). Peripheral smear and QBC for Plasmodium falciparum, Widal test for
typhoid fever and ELISA for leptospirosis was also performed. Cases of scrub typhus were
selected based on a positive one step Scrub Typhus antibody test (SD Bioloine
Tsutsugamushi a solid phase immunochromatographic assay for rapid qualitative detection of
IgG, IgM, IgA antibodies to Orientia tsutsugamushi in human serum or plasma), a positive
Weil-Felix test (WFT), the presence of an eschar or a combination of the three in a patient
with an acute febrile illness (Viswanathan et al., 2013). Radiological examination included
X-ray, electrocardiogram (ECG), ultrasonography, CTscan, echocardiography, uppergastro-
intestinal endoscopy (UGIE) and these tests were performed sequentially from day of
admission till discharge.
Patients were categorized with primary and secondary infections based on the levels of
dengue specific anti-IgG and -IgM antibodies. A primary infection is indicated when the IgM
to IgG index value ratio is 1.78 and secondary infection is indicated when the IgM to IgG
ratio is less than 1.78 (Porter et al., 1999). Taking these criteria into account, patients have
been categorized as suffering from primary/secondary infections (Neeraja et al., 2006). The
management and therapy administered and the outcome were also noted.
![Page 34: Chapter-3 - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/41566/9/09_chapter_3.pdf · Viruses 91 3.5 Pilot Study ... Determining the performance characteristics of the RT LAMP](https://reader036.vdocuments.us/reader036/viewer/2022071216/60472e880561997af4228524/html5/thumbnails/34.jpg)
122
3.8 Statistical analysis
Diagnostic accuracy indices of sensitivity, specificity, positive predictive value (PPV),
negative predictive value (NPV), chi-square, and Cohen's kappa values were calculated using
SPSS for Windows software (version 13.0; SPSS, Chicago, IL). The sensitivity, specificity,
PPV, and NPV for the assays were calculated as follows: sensitivity = (true positive)/(true
positive+false negative); specificity = (true negative)/(true negative+false positive); PPV=
(true positive)/(true positive+false positive); NPV = (true negative)/(false negative+true
negative). The 95% confidence intervals (CIs) were calculated as estimates of the
effectiveness of assays using ±2×standard error of proportion (formula: √[p(1 – p)/n]).
Diagnostic odds ratio (DOR) is the quotient between positive likelihood ratio (LR+) and the
negative likelihood ratio (LR−). LR+ and LR− were calculated using the following formulas:
[sensitivity/(1−specificity)] and [(1−sensitivity)/specificity], respectively. Fisher’s exact test
(two tailed) was performed to calculate p value, and p value <0.0001 was used to suggest
significant results.
Analysis of variance (ANOVA) has been used to find the significance of study parameters
between three or more groups of patients, student t test (two tailed, independent) has been
used to find the significance of study parameters on continuous scale between two groups
inter group analysis) on metric parameters. Fisher’s exact test (two tailed) was performed to
calculate p value, and p value <0.0001 was used to suggest significant results. The diagnostic
performance of RT-LAMP assay and CDC real time PCR assay as compared to NS1 Ag and
NS1 RT-PCR assay was calculated using Med Calc easy to use statistical software
(http://www.medcalc.org/calc/diagnostic_test.php).