chapter 2shodhganga.inflibnet.ac.in/bitstream/10603/16171/8/08_chapter 2.pdf · those are discussed...
TRANSCRIPT
2.0 Material and Methods 2.1Fiy Genetics
2.1.1 Fly techniques
Fly stocks were grown on standard cornmeal + sugar a&ar (Ashbum
maintained at 25°C unless specified otherwise. The wild type strain use<
S and other fly strains used in this work and sources are listed be
information on all the lines are available at the flybase:
http://flybase.bio.indiana.edu/
2.1.2 List of flies used in this study
2.1.2.1 Mutations
ann H4.8 : a lethal mutation of ann
: a null allele, haltere capitellum of heterozygous
flies have a thick bristle.
: a loss of function allele, flies show rudimentary wings
In addition, several deficiency and P-insertion strains were used during the functional
validation of microarray positives. Those are discussed and listed in Chapter 4.
2.1.2.2 Transgenic constructs
2.1.2.2.1 List of Gal4 drivers and brief description of their expression
domains
vg-GAIA (Simmonds et al., 1995) :vestigial boundary enhancer expresses in the
DV boundary of the wing and haltere discs
Dpp-GAIA (Morimura et al., 1995) : decapentaplegic disk enhancer expresses in the
32
AP boundary of wing and haltere discs
N23-GAIA (Shashidhara et al.,1999) :CG32062 enhancer expresses in non-
DV cells of the wing and haltere discs.
omb-GAIA (Calleja et al.,1996) :optomotor blind enhancer, expresses in
wing and haltere disc pouch
ap-GAIA (et al., 1995) :apterous enhancer, expresses in dorsal
Cells of wing and haltere discs
pnr-GAIA (Calleja et al., 1996) :pannier enhancer, expresses in a subset
of notum cells of wing and haltere discs
en-GAlA (Brand and Perrimon,1993) :engrailed enhancer expresses in the
posterior compartment cells
2.1.2.2.2 Flies stocks used as markers during the course of this work.
Quadrant-vg lacz (Kim et al., 1996) :vg-QE expresses exclusively in non-DV cells of
the wing disc and conspicuously absent in the
haltere pouch. It responds to signals from both
AP and DV organizers.
All other lacZ and GFP lines are discussed in the chapter "Identification of targets of
homeotic gene function using DNA Microarrays"
2.1.2.2.3 List of transgenes expressed in various experiments using the UAS-GAL4 system
UAS-mCD8-GFP (Lee and Luo, 1999) :Membrane bound form of GFP
UAS-TCF/~ pan (vander Wedering et al., 1997) :dominant negative TCF/pangolin
UAS-arm 510 (Pai et al., 1997)
UAS-arm 52 (Pai et al., 1997)
:Myc tagged N-terminal deleted
Armadillo, rendering it insensitive to Shaggy mediated degradation.
:Myc tagged wild type Armadillo
UAS- APC/CBD (Bhandari and Shashidhara, 2000) :~-catenin binding domain of human APC (Adenomatous polyposis coli).
UAS-Dsh C (Neumann and Cohen, 1996) :Wild type Dishevelled
UAS-Ubx I a (Castelli-Gair et al., 1994) :Ia isoform of wild type Ubx
UAS-N intra :Intracellular activated form of Notch
(Fortini et al., 1993, de Celis and Bray, 1997)
UAS-Wg (Lawrence et al., 1995) :Wild type Wingless
UAS-Delta (Klein et al., 1997) :Wild type Delta
2.1.2.2.4 List of Transgenic lines generated
UAS- mapmodulin :Complete eDNA (LD13195) of
Mapmodulin was cloned into pUAST
vector (Brand and Perimon, 1993)
UAS- Mapmodulin RNAi :3 primeUTR of the eDNA, partially
overlapping with coding region was
cloned into pUAST Sym w+ vector.
2.1.3 Embryo collection
Egg laying plates were prepared by boiling (30g-sugar, 25g-agar and 17g-yeast) in llt
of water. After it was cooled down to 55 °C, propionic acid (5mlllt), ortho-phosphoric
acid (1ml/lt) and p-methyl benzoate (5ml of 5% solution in one lt) are mixed. The
'lA
medium was poured in petriplates and allowed to set overnight. On solidifying, yeast
paste is added to one comer. The plates are then taped to the top of cut bottles, which
contained flies of desired genotypes. The plates are changed at different time intervals
depending on the purpose of embryo collection. For example, for microinjections,
embryos were collected at 40-60min intervals and for antibody staining overnight
collections were used. The embryos were collected on a l10J.!m mesh sieve, washed
in distilled water, dechorionated in 3% Na-hypochlorite solution and rinsed
thoroughly in water prior to subsequent use.
2.1.4 Collection of third instar larvae
Wandering larvae which have left the surface of the food were identified as late third
instars and were picked up with the help of a brush. They were rinsed thoroughly in
PBS (pH 7.4) prior to dissection or DNA/RNA extraction.
2.1.5 Collection of flies for cuticular preps
Fl flies of all crosses were collected in clean microfuge vials and stored in 70%
ethanol. For detailed examination of the adult cuticle the stored flies were boiled in
10% KOH, dehydrated by passing through grades of alcohol and cleared in clove oil
for at least 24 hours. Various adult structures were then dissected and mounted in
Euparol or Zeiss mounting medium.
2.1.6 Genetic techniques
Balancing mutations, making recombinant chromosomes and combinations of
different mutations and/or markers were according to standard genetic techniques. In
a standard fly cross, males and virgin females were crossed with a ratio of around 1:3
(male: female). Usually five to ten females were used. All crosses described were
done at 25 °C, unless stated otherwise. For crosses set up to induce mitotic clones,
flies were transferred to fresh vials every 24 hours. Larvae at different developmental
stages were given a heat shock at 37°C for 1hour to induce FLP-mediated mitotic
recombinations.
2.1. 7 Histology
Antibodies used as markers in different experiments are listed in the following tables
2.1.7.1 List of primary antibodies
S.No ~arne Source Dilution Comments
~abbit polyclonal a J3- AshokKhar, 1 GAL CCMB 1:1000 anti-P galactosidase
Mouse monoclonal anti-2 14D9 HB* 1:20 Engrailedllnvected
!Mouse monoclonal Steve Cohen, 3 i4D4 EMBL 1:200 anti-Wingless
4_ mouse a-Delta HB* 1:50 anti-Delta
!Rabbit polyclonal a- W. McGinnis, 5 Cnc UCSD,USA 1:400 anti -Cap-n-collar
T. Kornberg, anti -Cubitus 6 trat a-Ci IUCSF, USA 1:400 interruptus
!Rob White, 7 mouse a-UBX Cambridge, UK 1:50 anti-Ultrabithorax
Rabbit polyclonal a-8 Stbm !Tanya Wolff, USA 1:1000 Anti -Strabimus 9 AP a-Dig Roche, Germany 1:2000 anti-Digoxigenin-
Alkaline Phosphatase fconjugated
10 Rabbit a -Vg Sean Carroll, USA 1:50 anti-Vestigial
11 Rat a- Sal R.Barrio, EMBL !:100 Anti-Spalt
12 Rabbit polyclonal a- J. Woodgett, 1:100 Drosophila Armadillo Canada Armadillo
13 Monoclonal N27 A1 HB* 1:100 Anti- Armadillo
14 Phospho-dERK Sigma, USA 1:20 Anti-Phosphorylated dMEK
15 Rabbit polyclonal a- B. Mechler, 1:100 Anti- Zipper ~ip Germany
16 !Rabbit polyclonal a- J.Knoblich, 1:100 Anti -Cometto Com Germany
*HB- Developmental studies hybridoma bank, Iowa, USA
36
2.1. 7.2 Secondary antibodies
All secondary antibodies (conjugated with fluorescent or Alkaline Phosphatase or
Horse Radish Peroxidase tags) were purchased from Dianova, Jackson Laboratories
or Molecular Probes.
List of Secondary and tertiary antibodies
S.No Name Dilution Raised in
1. FITC--anti-rat IgG 1:200 of 1.5 mg/ml goat
2. Alexa594-anti -mouse 1:1000 "
3. Alexa594-anti-rabbit 1:1000 "
f4. Alexa488-anti-mouse 1:1000 "
5. Alexa488-anti-rabbit 1:1000 "
6. Biotin-anti-mouse 1:250 "
9. Avidin-FITC 1:200 "
10. Avidin-Cy3 1:500 "
2.1. 7 .3. Antibody staining of imaginal discs
Wandering third instar larvae were collected in a dissecting dish with PBS (pH7.4).
Larvae were cut into half with the help of a pair of forceps and scissors and the
anterior part, which contains all imaginal discs was turned inside out. The fat body,
gut and salivary glands were removed carefully without damaging the discs. The
clean anterior larval body with the discs attached to it was transferred to a microfuge
tube with PBS on ice. Usually 10 to 20 larvae were dissected. The dissected larvae
were fixed for 20 minutes in PBS (pH7.4) with 4% paraformaldehyde. After fixation
the larvae were rinsed 5-6 times with PBS and blocked for 1 hour in PBTx (PBS +
0.1% TritonX-100 (Merck)+ 0.5% BSA (Sigma)). Incubation with primary antibody
in PBTx was done overnight at 4 °C or 3hrs at room temperature. Afterwards the
37
larvae were washed with PBTx for a period of two hours, changing the wash buffer
every 15-30 minutes. Incubation with the secondary antibody in PBTx was done for 2
hours at room temperature. After this incubation, 4 washes with PBTx of 15 minutes
each were carried out. After the last wash, all PBTx was removed and the larvae were
covered with mounting medium (PBS+ 80% glycerol (anhydrous, Merck). The larval
bodies were stored in mounting medium at 4°C overnight to allow the tissue to be
saturated with the medium. The next day discs were detached from the rest of the
larval body, collected in a drop of mounting medium on a glass slide and covered with
a cover slip.
2.1.7.4. X-GAL staining
Larvae were dissected as described above and fixed for 5-10 minutes in 4%
paraformaldehyde in PBS. Larvae were washed 2 times, 5 minutes each, in PTx (PBS
+ 0.1% TritonX-100) and incubated several hours at 37 °C in X-GAL staining
solution. When the blue colour was strong enough, larvae were washed several times
with PBS, saturated with glycerol mounting medium and discs were mounted as
described above. X-GAL staining solution was prepared ahead of time by adding 25
J.tl of 8% X-GAL in DMSO to 1 ml of PBS with 5mM K3[Feii(CN)6], 5 mM
~[Feill(CN)6] and 0.3% Triton-XlOO. This solution was pre-warmed to 37 °C for at
least 30 minutes.
2.1.7.5. RNA in situ hybridizations
2.1.7.5.1 Probe preparation
Sense and anti-sense RNA probes were generated by in vitro transcription
(MEGAscript in vitro transcription kit for large scale synthesis of RNAs, T7 and T3
kits, Ambion) using instructions provided in the manual. 1.5 J.tl UTP and 2 J.tl DIG-
38
11-UTP (10 nmol/Jll, Boehringer) were added instead of 2 Jll UTP as indicated in the
manual. For all RNA probes (Chapter 4), eDNA's from the DGC collection (1 & 2)
was sequenced with appropriate primer to verify the identity of the clone.
Subsequently, respective clones were linearized with an appropriate restriction
enzyme and used as template for T7 or T3 RNA polymerase reaction to make sense
and antisense RNA probes. After the in vitro transcription reaction and degradation of
remaining DNA by DNAse treatment, the labeled RNA was precipitated with 1110
volumes of 10M Licl and 3 volumes of ethanol and re-suspended in 50 Jll RNase free
water.
2.1.7.5.2. In situ hybridization on imaginal discs
Third instar larvae were dissected in cold PBS and fixed for 20 minutes in PBT (PBS
+ 0.1% Tween-20) with 4% formaldehyde. After fixation it was washed twice for 5
minutes in PBT. The fixed larvae were incubated for 10 min in Xylene: ethanol (1:1)
mix at room temperature and subsequently rinsed in ethanol twice. The ethanol was
then replaced by methanol and incubated at room temperature for 5 min. The larvae
were rehydrated in 1: 1 solution of PBT: methanol for 5 min. PBT: methanol mix was
replaced by PBT alone and allowed to stand at room temperature for 5 min. The
larvae were rinsed 2-3 times in PBT and fixed for 20min as mentioned above.
Subsequently larvae were incubated for 8- 10 min in PBT with- 8.4Jlg/ml proteinase
K (Boehringer). Larvae were then washed twice, 3 minutes each in PBT and fixed
immediately again for 30 minutes in PBT with 4% formaldehyde. After several
washes with PBT, larvae were incubated for 10 minutes in a 1:1 solution of PBT and
hybridization buffer (50% formamide (Merck), 5x SSC, 100 Jlg/ml denatured herring
sperm DNA, 50 Jlg/ml heparin (Sigma) and 0.1% Tween-20 (Merck)). After a pre-
hybridisation period of one hour at 63 °C in hybridisation buffer, a pre-determined
dilution of the probe was added to the same buffer. After hybridizing overnight at 63
°C, larvae were washed in hybridisation buffer and subsequently in a series of
hybridisation buffer and PBT mix starting with a ratio of 4: 1 and ending with 1 :4,
each wash lasting 10-15 minutes at 63 °C. The larvae were then washed 3 times, 10
minutes each, in PBT at room temperature and then incubated with alkaline
phosphatase conjugated anti-digoxigenin antibody (1:2000, Roche). Subsequently
larvae were washed 3 times, 10 minutes each, in PBT and 2 times, 5 minutes each, in
alkaline phosphatase buffer (100 mM NaCl, 50 mM MgClz, 100 mM Tris pH 9.5,
0.1% Tween-20). Larvae were then incubated in 1 m1 alkaline phopsphatase buffer
with 20 J..ll NBT/BCIP (Roche) mix until the blue colour was sufficiently developed.
The reaction was stopped by washing several times with PBT. After the last wash, all
PBT was removed and the larvae were covered with mounting medium (PBS + 80%
anhydrous glycerol) and further processed as described above.
2.1.8 Microscopy
Whole flies/pupae (wild type and GFP marked) were viewed on a Leica fluorescence
stereo-microscope and the photographs were taken using Kodak DC120 digital
camera or ZeissAxioCam.
2.1.8.1 Nomarsky
HRP, AP or lacZ stained discs and processed adult cuticles were viewed under
Nomarsky objectives on Zeiss axioskop. The photographs were taken on Zeiss MC-80
camera or Axiocam. Flourescent labeled discs were viewed at either 20X or 40X
magnification and the images were captured with the help of spectra source/axiocam
digital cameras and analysed with the help of Hpc/axiovision software packages.
Af\
2.1.8.2 Confocal microscopy
All confocal microscopy was carried out on Ultima meridian Confocal Microscope or
Zeiss laser scanning Microcope equipped with respective softwares. Images were
saved as TIFF files and processed with Adobe Photoshop (version 6.0).
2.1.9 Generation of transgenic fly lines
To generate transgenic fly lines DNA is introduced into the germline using
transposable elements, in particular the P-element. The desired DNA sequences are
cloned between the terminal repeats of the P-element and introduced into the fly
embryo by microinjection. Integration into the genome is catalysed by the transposase
in yw;PPK.i~2-3 flies.
2.1.9.1 Preparation of DNA for injection
DNA for injection was prepared by Qiagen column and pellet was resuspended in
injection buffer (5mM KCl, O.lmM phosphate buffer (0.05mM K2HP04, 0.05mM
KH2P04) pH6.8) to a final concentration of 400ng/ Jll and used for injection. The
DNA mix was injected into the poleplasm of 0-lh old embryos (of genotype
yw;PPK.i~2-3) by standard procedures.
2.1.9.2 Selecting the transformants
Apart from the gene or DNA sequence of interest, the P-element based vector
contains a wild type copy of the eye colour gene, white+. Constructs were injected
into yw;PPK.i~2-3 where the eyes appear white. Flies with one or two copies of the
white+ gene carry the pigment to appropriate cell positions therefore the eye appears
red. The flies derived from injected embryos were crossed to w1118 flies and the
progeny of this cross was scored for the presence of the eye colour marker. Red-eyed
41
flies were collected and the stocks were generated after removing the transposase
activity.
2.2 Molecular biology techniques
2.2.1. Standard techniques
Restriction enzymes, T4 ligase and corresponding buffers were purchased from New
England Biolabs. Plasmid DNA preparations, Restriction digestions, ligations,
agarose gel electrophoreses, Southern and Northern blot hybridizations were carried
out using standard techniques (Sambrook et al. 1987) or using conditions provided by
the reagent supplier. Ligation reactions or purified plasmids were used to transform
CaCh competent E. coli DH5a cells using standard procedures for heat shock
transformation (Sambrook et al. 1987). Bacteria were streaked out and grown on
Luria Broth (LB)-agar plates containing ampicillin for selection of transformants.
2.2.2. Preparation of ultra-competent cells
Ultra-competent cells were prepared according to the method described by Inoue et
al, (1990). A single colony of E. coli DH5a (always used, unless otherwise
mentioned) freshly streaked on an LB plate from the glycerol stock was inoculated
into 5m1 of SOB medium and grown at 37 °C overnight. One millilitre of this
overnight culture was used to inoculate lOOml SOB and incubated at 18 °C at 200rpm
till the OD600 reached 0.6 (this took approximately 24hours). The culture was then
chilled on ice and centrifuged at 1500g for 15mins at 4°C to pellet the cells. The cells
were then re-suspended in 32ml of ice cold Buffer 1 (lOmM PIPES pH6.7, 15mM
CaCh, 250mM KCl and 55mM MnCh) and incubated on ice for lOmins. The
centrifugation was repeated and the cells were resuspended in 8ml of ice cold Buffer I
42
containing 7% DMSO. The cell suspension was then distributed into lOOJll aliquots,
flash frozen in liquid nitrogen and stored at -70 °C.
The efficiency of the competent cells was checked by transforming with a known
amount of pBS (KS) plasmid.
2.2.3. Polymerase Chain Reaction (PCR)
PCR amplification was done with Taq polymerase (Perkin Elmer or Bangalore Genei)
using standard procedures. Typically, the following conditions were used for a
50/20Jll reaction: 100-150 ng template DNA or 1/lOth of Reverse transcription
product, lOx PCR reaction buffer (PE), 0.1mM cold dNTPs {or supplemented with
0.2 microlitre of a-[33P]dATP (2000Curie/milli mole)}, 10 picomoles of each primer,
0.6Units of Taq polymerase, H20 to 50 Jll/20Jll.
Temperature setting were as follows:
Denaturation : 30 seconds at 95°C
Annealing
Extension
Cycles
: 10 seconds, temperature depending on primers
: 1-3 minutes at 72°C
: 35 to 40
For real time RT -PCR analysis, ABI Series 5770 machine was used. The reaction was
set up using the 2X Syber mix from ABI itself with the same amount of primers and
template as mentioned before.
All Primers were synthesized in house. Gene-specific Primers used in this work are
listed in table 2.1.
List of oligonucleotides used in this study for PCR amplification and Real time RT
PCR analysis are listed in the following table.
No Oligonucleotid Sequence of the oligonucleotide (5'~ 3') Tm (°C) e
Name
1 CG5171 F ATGGCACCCTAGCTCCCATT 66.6
2 CG5171 R TCCAGTTCCACGGGCATTT 67.6
3 CG13222F CGCTACATCGCCGATGAGA 67.4
4 CG13222 R CTGGGCACCTGCGAAATATT 65.8
5 Tub RTF GGCCAACTGAACGCTGATCT 66.5
6 TubRTR GAAGCCGGGCATGAAGAA 66.2
7 Mapmodulin F GAACTGTCCGACAATCGGATTT 66.0
8 Mapmodulin R GGTTTCCAGATCCTTTATCTTGTTG 64.4
9 MapRNAiLF1 GATGGCGAAAAGGAAGCAG 64.7
10 MapRNAiLR1 TTCCTAAAGGATTTATCATCTTTTTCT 61.2
11 P-tubF TTGTTGGGGATCCATTCGAC 62.9
12 P -tubR ACTACAATGAGGCGTCCGGT 61.8
13 SP6 ATTTAGGTGACACTATAG 41.0
14 T7 GTAATACGACTCACTATAGGGC 53.0
15 T3 AATTAACCCTCACTAAAGGG 48.0
2.2.4. Genomic DNA isolation (Modified from Ashburner, 1989)
About 20-30 flies were snap freezed in liquid N2 and were ground in an eppendorf
with a teflon pestle (Wheaton). 400 J..ll of cold homogenization buffer (10 mM
Tris.HCI pH 7.5; 60 mM NaCl; 10 mM EDTA pH8.0) was added to the powdered
flies and mixed well. Alternately, freshly collected embryos ( -100 mg) or late third
instar larvae ( -40) were homogenized in 400J..ll of the buffer. The contents were
centrifuged at 1000 rpm for one minute to remove debris. To the supernatant,
proteinase K and SDS were added to a final concentration of 100J..lg/ml and 1%,
respectively and incubated at 58 °C for 1-2hrs. The solution was extracted twice with
saturated phenol : chloroform : isoamyl alcohol (25:24:1) in Tris (pH 8.0) and once
with chloroform : isoamyl alcohol (24:1). 8M potassium acetate (pH 5.2) was added
44
to the aqueous phase to a final concentration of 0.3M followed by 2.5volumes of cold
ethanol. The solutions were mixed by gentle swirling and the DNA that appeared as
clump was pulled out either with the help of a pipette tip or a glass hook. The DNA
was rinsed in 70% ethanol, air-dried and resuspended in 100J.tl of TE (pH 8.0).
2.2.5. RNA isolation
RNA was isolated from embryos, larvae, flies or larval discs using Triazol (Gibco
BRL) or Trireagent (Sigma). The sample was homogenized in Triazol using a dounce
homogeniser. The lysate was transferred to eppendorfs and vortexed vigorously for
approximately 2mins and stored at -20°C until isolation. For RNA isolation, the lysate
was thawed at RT and 0.2ml of chloroform was added per ml of Triazol. The mix was
vortexed vigorously, incubated at RT for 15min and spun at 12,000 g for 10min at
4°C. The aqueous phase was separated out into another tube and 0.7ml isopropanol
was added per ml of Triazol used. The solution was mixed thoroughly by inverting
the tube repeatedly, incubated at RT for 15min and spun at 12,000 g for 20mins at
4°C. The pellet was washed in 70% ethanol, dried and dissolved in autoclaved
distilled water. The quality of the RNA was checked by agarose gel electrophoresis of
1J..ll of RNA solution in a 2% -formaldehyde gel. The quality and quantity of the RNA
was estimated by spectrophotometry at 0Dz6o and ODzso.
2.2.6. Reverse transcription
RNA from different samples was treated with RNAse free DNAse (1unit, Promega)
for 30mins at 37°C and the enzyme was inactivated at 95°C for 15mins. The samples
were then checked for DNA contamination by PCR with genomic DNA-specific
primers of f3-tubulin. Samples, which did not yield any product in the PCRs on RNA
templates, were used for reverse transcription (RT) reactions. The RT was done (with
45
approximately 2.5f..lg/200ng of RNA and 100ng of oligo-dT or modified oligo-dT)
with Superscript RT (Invitrogen) at 37 °C or 42 °C according to the manufacturer's
instructions.
2.2.7 Urea-PAGE analysis for differential display PCR
The PCR products were denatured at 85 °C in DNA loading dye (95%formamide,
10mM EDTA, pH 8.0, 0.09% xylene cyanole FF and 0.09% bromophenol blue).
Equal amount of the labeled PCR products was loaded on 6% denaturing (Urea)
polyacrylamide gel and run at 60 Watts power until xylene-cyanol reached the
bottom. The gel was dried under vacuum at 80 °C for 1 hr and exposed to X-Ray film.
2.2.8 Elution and re-amplification of the differential transcripts
The developed autoradiogram was oriented with the gel. The four comers of each
band of interest was marked and cut. The dried gel piece was soaked in 100 )ll of
nuclease free water for 15 mins and subsequently boiled for 15 mins. It was spun and
to the clear supernatant 10 j.Jl of 3M sodium acetate, 5 j.Jl of 10mg/ml of glycogen and
500 j.Jl of 100% ethanol was added. It was left at -70 °C overnight. Later, the DNA
was pelleted by centrifugation at 14,000g for 20 min at 4 °C and washed in 85%
alcohol, dried and dissolved in 10 j.Jl of nuclease free water. 4 j.Jl was used for there
amplification using the same set of primesr used for the Differential Display analysis.
The PCR products were cloned into the PCR cloning vector (pMOS from Amersham
Biosciences) and used as per the requirement.
46
2.2.9 Microarray Analysis
2.2.9.1. Preparation of probe DNA
Incyte Genomics (Palo Alto, USA) has designed primers against all annotated genes
as per the Drosophila genome sequence release 1.0. A recent report describes the
design and synthesis of these primers (Johnston et al., 2004). We used these primers
to amplify a representative transcriptional fragment for each gene. Drosophila
genomic DNA was used as the template for PCR amplification. For PCR, 150ng of
genomic DNA was used along with 2mM dNTPs mix and 50pmoles of the gene
specific primer. The PCR condition included initial denaturation at 94 °C for lOmin
followed by 35 cycles of 94 °C- 1min (denaturation), 58 °C- 1min (annealing) and 72
°C- 2min (extension). The PCR products were checked on 1% agarose gels and were
purified on Montage multiwell plates (Millipore, USA). After re-checking the eluted
products by agarose gel electrophoresis, they were concentrated on a speed-vac and
re-suspended in printing buffer (0.04 M tris pH 6.5, 0.1M KCl, 50% DMSO). The
average concentration of the DNA used for spotting was -400 picomoles in 20 J.d.
DNA was spotted on Type V glass slides (Amersham Biosciences, USA) using the
Molecular Dynamics Gen ill spotter (Amersham Biosciences, USA). All samples
were spotted in duplicate. Thus, each array carried only 4608 independent samples,
although it carries 9216 spots. In addition to Drosophila samples, each array
contained 384 spots that served as positive controls, negative controls, dynamic range
controls and ratio controls (Amersham Lucidea ScoreCard, Amersham Biosciences,
USA). Drosophila DNA samples also included several negative controls, particularly
intergenic regions. After each spotting session, one array was stained with SYBR-
47
Green (Sigma, USA). Only spotting sessions showing good staining in > 90% of the
spots were used in experiments.
2.2.9.2 Target RNA preparation
Small batches of late 3rd instar larvae were dissected under a stereomicroscope in cold
phosphate buffered saline (PBS) pH 7.4 (Sigma, USA). Wing and haltere imaginal
discs were isolated and transferred immediately to Triazol (Invitrogen, USA).
Extreme care was taken not to contaminate the samples with other tissues. RNA was
isolated from pooled discs ( -2000 for haltere discs and- 800 for wing discs). 5 ~g of
total RNA for each sample was subjected to RNA amplification (Eberwine method;
Gelder et al, 1990) using Ambion's amplification kit (Message Amp Trn aRNA kit) as
per the suppliers manual. The size distribution of amplified antisense RNA (aRNA)
was between 240-1000 bases.
2.2.9.3 Target labeling and hybridization
3 ~g of amplified aRNA was used for reverse transcription (SuperScript II;
Invitrogen, USA) with 1 ~g random hexamer to produce Cy3 or Cy5 labeled targets.
Spike RNA against the Scorecard (Amersham Biosciences, USA) samples was
labeled along with RNA of experimental samples. The specific activity was
determined spectrophotometrically (550nm & 650nm) and equimolar amounts of Cy3
and Cy5-labeled targets were added to pre-spotted fly chips for two-color
hybridization. Dye reversal experiments were carried out for each batch of amplified
aRNA. Hybridization and post-hybridization processing was according to Hegde et al.
(2000).
48
2.2.9.4 Data acquisition and analysis
Hybridized slides were scanned using the Molecular Dynamics Gen III scanner.
Image analysis was done using Array Vision software of Amersham Biosciences
(USA). Following are the important features of our microarray data analysis, (i) Only
those experiments, in which Lucidea ScoreCard samples conformed to the following
criteria were selected for further analyses. Positive controls had to show
hybridization. The dynamic range controls and Cy3/Cy5 ratio for the Scorecard
samples had to be in the linear range. (ii) In majority of the experiments, the data was
biased towards Cy3 (Table 4.2.1 A), which could be due to lower labeling efficiency
of Cy5 than with Cy3. This bias was removed by subjecting the data to normalization
as per the Lucidea Microarray Scorecard Normalization method (Amersham
Biosciences, USA; Table 4.2; Appendix I). It uses exponential normalization method,
in which all the data, not just control spots, is used to calculate normalized Cy3/Cy5
ratio. (iii) Large number of negative controls (120 spots per array) was used to
estimate background signal levels. The data was filtered to eliminate any low
intensity spots (< 3 standard deviations above the background signal; Table 4.2.1B).
(iv) Lucidea ScoreCard also provided a better estimate of statistical significance of
normalized log ratio (NLR). This also ensures selection of only those genes that show
consistent behaviour between duplicate spots in a given array. (v) Dye-reversal
experiments were done for all sample pairs. Only those genes which showed
differential expression in both forward and reverse experiments were selected as
positives.
49