chapter 14 huntington’s disease imprinting and genetic anticipation
DESCRIPTION
Initial Symptoms Irritability Irritability Clumsiness Clumsiness Depression Depression Forgetfulness Forgetfulness Mood and personality changes Mood and personality changes Uncontrollable movements Uncontrollable movements Hard to swallow Hard to swallowTRANSCRIPT
Chapter 14 Chapter 14 Huntington’s Disease Huntington’s Disease
Imprinting and Genetic Imprinting and Genetic AnticipationAnticipation
History of Huntington’s DiseaseHistory of Huntington’s Disease 1630, 3 men escaped to 1630, 3 men escaped to
AmericaAmerica Wilke, Nichols, and Jeffers Wilke, Nichols, and Jeffers Families had been Families had been
persecuted for witchcraftpersecuted for witchcraft
One man settled in the One man settled in the Hampton’s(NY)Hampton’s(NY) Offspring were notorious Offspring were notorious
for a strange and for a strange and frightening diseasefrightening disease
Initial SymptomsInitial Symptoms IrritabilityIrritabilityClumsinessClumsinessDepressionDepressionForgetfulnessForgetfulnessMood and personality changesMood and personality changesUncontrollable movementsUncontrollable movementsHard to swallowHard to swallow
George HuntingtonGeorge Huntington
Huntington’s had 3 Huntington’s had 3 generations of doctorsgenerations of doctors
Youngest was George Youngest was George Huntington JrHuntington Jr
Made rounds via Made rounds via horseback with fatherhorseback with father
1872, George Huntington 1872, George Huntington Jr wrote a paper “Jr wrote a paper “ On On Chorea”Chorea”
ChoreaChorea ChoreaChorea means to dancemeans to dance ““dancing disorder”dancing disorder”
Uncontrollable jerking and Uncontrollable jerking and movingmoving
People were thought to be People were thought to be possessed by devilspossessed by devils
One of the “witches” executed One of the “witches” executed in Salem, MA had in Salem, MA had Huntington’s diseaseHuntington’s disease
Ex. Wilke’s ChildrenEx. Wilke’s Children One of the 3 original British One of the 3 original British
men who fled to Americamen who fled to America Professional carpenter w/ 7 Professional carpenter w/ 7
childrenchildren Son marries Elizabeth Warne Son marries Elizabeth Warne
who returns to England, tried who returns to England, tried as a witch as a witch child with strange convulsions) child with strange convulsions) Elizabeth's child is tried as the Elizabeth's child is tried as the
"Groton Witch" "Groton Witch"
http://www.medinfo.ufl.edu/other/histmed/okun/slide27.html
Huntington’s DiseaseHuntington’s DiseaseCaused by a dominant geneCaused by a dominant gene
Diagnosed 35-60 years oldDiagnosed 35-60 years oldAverage age of onset=40 yearsAverage age of onset=40 years
ProgressiveProgressiveContinually getting worseContinually getting worse
No remissionNo remissionNo breaks or getting betterNo breaks or getting better
ALWAYS fatalALWAYS fatalUsually only 20 more years after diagnosisUsually only 20 more years after diagnosis
Interesting WeirdnessInteresting Weirdness Maternal AlleleMaternal Allele
If you inherit huntingtons If you inherit huntingtons allele from momallele from mom
Normal onset(35-50 years)Normal onset(35-50 years) Paternal Allele:Paternal Allele:
If you inherit huntingtons If you inherit huntingtons allele from dadallele from dad
You show symptoms at You show symptoms at earlier ageearlier age
Thanks a lot dad!!!Thanks a lot dad!!!
MOMMOMH hH h
DAD hDAD h Hh hhHh hh hh Hh hhHh hh normal onsetnormal onset
MOMMOMh hh h
DAD HDAD H Hh HhHh Hh hh hh hhhh hh show symptoms earliershow symptoms earlier
Genomic ImprintingGenomic Imprinting In some diseases, it matters which parent In some diseases, it matters which parent
gave you the gene!!!gave you the gene!!!A mysterious phenomenaA mysterious phenomena
We still don’t fully understand itWe still don’t fully understand it
Genomic ImprintingGenomic ImprintingAt least 100 genes are imprintedAt least 100 genes are imprintedYou must re-imprint genes from you You must re-imprint genes from you
parents before you pass them on to your parents before you pass them on to your childrenchildren
Another weird thing about Another weird thing about Huntington’s DiseaseHuntington’s Disease
Example of anticipationExample of anticipationSymptoms start showing up earlier in Symptoms start showing up earlier in
familiesfamiliesGenetic anticipationGenetic anticipation
Genetic Anticipation in Huntington’s Genetic Anticipation in Huntington’s DiseaseDisease
DNA has regions of repeating sequencesDNA has regions of repeating sequencesTrinucleotide repeatsTrinucleotide repeats
Makes gene more and more unstableMakes gene more and more unstableEx. Ex. CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG or or TCGTCGTCGTCGTCGTCGTCGTCGTCGTCTTCGTCGTCGTCGTCGTCGTCGTCGTCGTCT
CAG repeats CAG repeats Huntington’s is caused by tooHuntington’s is caused by too much repeatsmuch repeats End of chromosome 4End of chromosome 4
CAG repeatsCAG repeats Normal gene has 11-34 copies of CAGNormal gene has 11-34 copies of CAG Mutation increases it to more than 37Mutation increases it to more than 37 In HD, Passing on chromosome 4 In HD, Passing on chromosome 4
Increases # of repeatsIncreases # of repeatsSymptoms start showing earlierSymptoms start showing earlier