chapter 11: the control of gene expression

Chapter 11: The Control of Chapter 11: The Control of Gene ExpressionGene Expression

Life 1402: Principles of BiologyLife 1402: Principles of Biology

1. Cellular Differentiation during 1. Cellular Differentiation during embryonic developmentembryonic development

a. a a. a zygote is the first cell of an organism with a is the first cell of an organism with a full compliment of DNAfull compliment of DNA

23232346


b. the zygote undergoes b. the zygote undergoes mitosis giving rise to giving rise to genetically identical daughter cells daughter cells


c. with each mitotic division during c. with each mitotic division during development, the daughter cells inherit development, the daughter cells inherit identical copies of DNA; therefore, every identical copies of DNA; therefore, every diploid cell in an organism is genetically diploid cell in an organism is genetically identical unless mutations occur unless mutations occur


d. cellular d. cellular differentiation is the process by is the process by which genes are which genes are turned on and offturned on and off, not , not changed, during embryonic developmentchanged, during embryonic development


e. cellular differentiation results in different e. cellular differentiation results in different tissue types in a single organism in a single organism

Turning Genes On and OffTurning Genes On and Off

http://www.youtube.com/watch?v=dSiSHRwR49k

http://www.youtube.com/watch?v=CkR53X8vksY

3. The 3. The laclac operon operon

a. Collection of a. Collection of genes that regulate protein that regulate protein synthesis depending upon the cellsynthesis depending upon the cell’’s needss needs

b. Described as found in E.coli b. Described as found in E.coli

3. The 3. The laclac operon operon

c. Operon is turned off in the c. Operon is turned off in the absence of lactose

d. Operon is turned on in the presence of lactose

4. Cloning4. Cloning


a. a. A clone is a cell or organism that is genetically identical; e.g., identical twins which result from separation of an embryo before differentiation occurs

b. Variable success has been realized in attempts to clone organisms, even mammals

c. Both ethical and physical barriers exist when cloning of humans is considered


d. d. Basic process of cloning 1. nucleus is removed from an egg2. nucleus is removed from an adult somatic cell and

injected into the egg which had its nucleus removed3. the resulting cell is then grown in culture to produce a

blastocyst; i.e., an early embryo consisting of a ball of app. 200 cells

4. the blastocyst can then be used to produce an entire organism (reproductive cloning) or used to provide embryonic stem cells which can be grown in culture (therapeutic use)

5. Nuclear transplantation5. Nuclear transplantation

a. the process of cloning described above a. the process of cloning described above results from nuclear transplantation; i.e., a results from nuclear transplantation; i.e., a nucleus from a nucleus from a differentiated adult cell is adult cell is transplanted into a non-differentiated transplanted into a non-differentiated egg cellcell

b. nuclear transplantation experiments have b. nuclear transplantation experiments have resulted in clones of plants and animalsresulted in clones of plants and animals


c. the resulting clones are genetically identical to c. the resulting clones are genetically identical to the donor parent regardless of the adult cell type the donor parent regardless of the adult cell type used as a donorused as a donor

d. differentiated adult cells must all have the same d. differentiated adult cells must all have the same DNA if clones result from nuclear transplantation DNA if clones result from nuclear transplantation regardless of the donor cell typeregardless of the donor cell type


e. if the e. if the genome were different among different were different among different adult cell types, clones from these different adult cell types, clones from these different cells would not be the samecells would not be the same

6. Application of reproductive cloning6. Application of reproductive cloning

a. Dolly is a a. Dolly is a sheep that was cloned from an adult cell that was cloned from an adult cell b. Since Dolly, reproductive cloning has been used to b. Since Dolly, reproductive cloning has been used to

establish clones for scientific, medical, and establish clones for scientific, medical, and agricultural usesagricultural uses


c. Scientists have cloned pigs with a c. Scientists have cloned pigs with a gene "knocked out" that codes for a gene "knocked out" that codes for a protein making their hearts activate protein making their hearts activate our our immune system --- What's the system --- What's the application?application?


d. Scientists have cloned farm animals with specific d. Scientists have cloned farm animals with specific sets of desirable traitssets of desirable traits

e. Scientists are cloning mammals that are e. Scientists are cloning mammals that are genetically engineered to synthesis valuable to synthesis valuable drugsdrugs

Got Clones?Got Clones?

7. Stem cells7. Stem cells

a. stem cells are cells that have not yet a. stem cells are cells that have not yet differentiated

b. in the appropriate conditions, stem cells can b. in the appropriate conditions, stem cells can be stimulated to differentiate into specific be stimulated to differentiate into specific cell types; e.g., nerve cells, muscles cells, cell types; e.g., nerve cells, muscles cells, etc. thus providing a source of tissue for etc. thus providing a source of tissue for therapeutic use therapeutic use

Stem CellsStem Cells

http://video.pbs.org/video/1506726820/http://video.pbs.org/video/1511335379/


c. growth factors can turn on and turn off c. growth factors can turn on and turn off particular genes and thus determine the particular genes and thus determine the fate of a particular cellof a particular cell

d. embryonic stem cells are taken from early d. embryonic stem cells are taken from early embryos and have theembryos and have the potential to to differentiate into any cell typedifferentiate into any cell type


e. e. adults have stem cells; e.g., bone marrow cells differentiate into different blood cell types and epidermal germ cells differentiate into different skin cell types

f. although adult stem cells are typically more difficult to work with, they provide a potential source of stem cells without destroying embryos

8. Cancer8. Cancer

a. a. cancer can be caused by mutations in genes that control cell growthb. genes that cause cancer are called oncogenes, these are usually

mutated genes that produce growth factor to stimulate cell division

8. Cancer8. Cancer

c. c. genes that may become cancer causing are proto-oncogenes

d. tumor suppressor genes inhibit cell growth, mutations of these genes can also cause cancer

8. Cancer8. Cancer

e. e. carcinogen – “cancer generator” factors in the environment that can cause cancer

CHAPTER 12CHAPTER 12DNA Technology and DNA Technology and the Human Genomethe Human Genome

1. Cloning of genes through 1. Cloning of genes through genetic engineeringgenetic engineering

a. genetic engineering = direct manipulation of genes for practical purposes

b. gene cloning = making identical copies of genes (fig 12.1)


cc. recombinant DNA = joining of two different sequences of DNA

d. plasmid = small, circular DNA molecule small, circular DNA molecule separate from the larger bacterial DNAseparate from the larger bacterial DNA


e.e. vector = virus or cell that transfers DNA to = virus or cell that transfers DNA to another cell another cell

2. Restriction 2. Restriction enzymes (fig 12.2)enzymes (fig 12.2)

a. enzyme = a substance, usually a protein, that catalyzes (facilitates) a reaction

b. restriction enzyme = an enzyme that recognizes a specific sequence of DNA and digests (cuts) the DNA at that recognition site

2. Restriction enzymes2. Restriction enzymes

c.c. the resultant pieces of DNA after the resultant pieces of DNA after digestiondigestion with a restriction fragment are with a restriction fragment are termed termed restriction fragments (if a linear (if a linear strand of DNA has two recognition sites, strand of DNA has two recognition sites, digestion will produce three restriction digestion will produce three restriction fragments) fragments)

GAATTC

GAATTC

G

AATTC G

AATTC


d.d. the cut ends of DNA are the cut ends of DNA are ““sticky””; i.e., ; i.e., they will join together (anneal) with other they will join together (anneal) with other ““stickysticky”” ends cut with the ends cut with the same restriction restriction enzyme enzyme

TGAGCTAGCATCGATCGATAA ATCGATCGATGCTAGCACA TGAGCTAGCATCGAATCGATCA

TGATCGTATCGATGCTAGCACATT

CGATCA ATCGTT TGAGCTAGCATCGAA CGATGCTAGCACATT TGAGCTAGCATCGATTCGATAA

ATCGAATCGATGCTAGCACA


d.d. the cut ends of DNA are the cut ends of DNA are ““sticky””; i.e., ; i.e., they will join together (anneal) with other they will join together (anneal) with other ““stickysticky”” ends cut with the ends cut with the same restriction restriction enzyme enzyme

TGAGCTAGCATCGATTCGATAA

ATCGAATCGATGCTAGCACA TGAGCTAGCATCGATTCGATCA

TGATCGAATCGATGCTAGCACATT

TGAGCTAGCATCGAAA TCGATGCTAGCACATT


e.e. this is how the human insulin gene is this is how the human insulin gene is removed from human DNA and removed from human DNA and spliced into into the bacterial DNA the bacterial DNA


f. restriction enzymes are also used in forensic f. restriction enzymes are also used in forensic science to establish a science to establish a DNA fingerprint = a set of = a set of restriction fragments unique to an individual restriction fragments unique to an individual

2. Restriction enzymes (fig 2. Restriction enzymes (fig 12.2)12.2)

g.g. Overview of the technology behind Overview of the technology behind gene cloning using bacterial plasmids (fig gene cloning using bacterial plasmids (fig 12.3)12.3)

Bacterium

Bacterialchromosome

Plasmid

Figure 12.3

Plasmidisolated

1Bacterium

Bacterialchromosome

Plasmid

2DNAisolated

Cell containing geneof interest

DNAGene ofinterest

3 Gene inserted into plasmid

Recombinant DNA(plasmid)

4

• 1. gene of interest; e.g., human insulin gene, is removed from host DNA and inserted into bacterial plasmid DNA thus making recombinant DNA

Figure 12.3

Plasmidisolated

1Bacterium

Bacterialchromosome

Plasmid

2DNAisolated


DNAGene ofinterest



4 Plasmid put intobacterial cell

Recombinantbacterium

– 2. recombinant plasmid reinserted into bacterium thus producing a recombinant bacterium

Plasmidisolated

1Bacterium

Bacterialchromosome

Plasmid

2DNAisolated


DNAGene ofinterest





5

Clones of cell

Cell multiplies withgene of interest

3. as recombinant bacterium reproduces, gene of interest is cloned; i.e., the bacterium replicates the gene of interest along with its own DNA prior to each mitotic division

Plasmidisolated

1Bacterium

Bacterialchromosome

Plasmid

2DNAisolated

DNAGene ofinterest





5

Clones of cell

Cell multiplies withgene of interest


Copies of gene Copies of protein

Gene for pestresistanceinserted intoplants

Gene used to alter bacteriafor cleaning up toxic waste

Protein used to dissolve bloodclots in heart attack therapy

Protein used to make snow format highertemperature

4. bacteria now make 4. bacteria now make human insulin for practical purposes for practical purposes

3. Forensics and DNA technology: 3. Forensics and DNA technology:

a. Back ground a. Back ground 1.1. everyone has a unique sequence of everyone has a unique sequence of

DNA (genome); although we are all human, DNA (genome); although we are all human, our nucleotide sequences vary considerablyour nucleotide sequences vary considerably

3. Forensics and DNA 3. Forensics and DNA technologytechnology: :

2.2. since each personsince each person’’s genome differs, a given s genome differs, a given restriction enzyme will digest each genome restriction enzyme will digest each genome differently and produce restriction fragments of differently and produce restriction fragments of different sizes and number (the odds of two people different sizes and number (the odds of two people having the same having the same DNA fingerprintDNA fingerprint are slim and next are slim and next to none, one in a billion!) to none, one in a billion!)


b. Crime scene analysisb. Crime scene analysis

1.1. a suspecta suspect’’s DNA can be compared to s DNA can be compared to crime scene DNA to determine if the suspect crime scene DNA to determine if the suspect was present (DNA fingerprinting at work)was present (DNA fingerprinting at work)


2. 2. some DNA sample; e.g., blood, semen, or hair, some DNA sample; e.g., blood, semen, or hair, that is found at some crime scene is compared that is found at some crime scene is compared with a DNA sample from a suspect by with a DNA sample from a suspect by digestion with the digestion with the samesame restriction enzymes restriction enzymes

33. . digested DNA (restriction fragments) are digested DNA (restriction fragments) are ““runrun”” on an on an electrophoresis electrophoresis gelgel (fig 12.12) which separates the fragments based on size and (fig 12.12) which separates the fragments based on size and charge; i.e., the smaller fragments travel further in the gel and charge; i.e., the smaller fragments travel further in the gel and opposite charges attract opposite charges attract

A B 10 kb

8 kb2 kb

A

7 kb3 kb

B

5 kb3 kb2 kb

A+B

CK A B A+B M

Restriction enzymes


4. DNA fingerprints of the suspect and crime 4. DNA fingerprints of the suspect and crime scene sample are compared, and, if found scene sample are compared, and, if found identical, a match is made identical, a match is made

Defendant’sblood

Blood fromdefendant’sclothes

Victim’sblood

BioClueBioClue

Mr. Bodie is dead!Mr. Bodie is dead!

He was found murdered in the library of He was found murdered in the library of the Bodie mansion. the Bodie mansion.

Murder Weapon?Murder Weapon?

Near his body you find a candlestick and a Near his body you find a candlestick and a lead pipe, both test positive for blood lead pipe, both test positive for blood using phenolphthalein. You collect a using phenolphthalein. You collect a sample from the candlestick and label it sample from the candlestick and label it sample #1 and a sample from the pipe sample #1 and a sample from the pipe labeled #2labeled #2

#1 #2

There were signs of a struggle and a There were signs of a struggle and a suspicious trail of blood drops leading suspicious trail of blood drops leading away from the scene.away from the scene. A sample of the A sample of the blood drops, and Mr. Bodieblood drops, and Mr. Bodie’’s blood, have s blood, have already undergone analysis and you are already undergone analysis and you are awaiting the results.awaiting the results.

SuspectsSuspects

Four people beside you were in the Four people beside you were in the mansion at the time of the murder, Misses mansion at the time of the murder, Misses Pheasant, Professor Grape, Miss Violet Pheasant, Professor Grape, Miss Violet and Colonel Ketchupand Colonel Ketchup

Mrs Pheasant Miss Violet

Prof. Grape Col Ketchup

#3#3

#4#4 #5#5

#6#6

DNADNA Analyze the DNA samples collected using Analyze the DNA samples collected using

the restriction enzymes the restriction enzymes CTCT and and AT AT with with the probe the probe GCGGCG..

GCAGCATCGATCGTAGCATGCTAGCTAGCTAGCTGACTGACTGGCAGCATCGATCGTAGCATGCTAGCTAGCTAGCTGACTGACTGCGCCGCATCGATATCGATGCATGCTAGCTAGCTAGCTAGTCGACTGAGGCATGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTATACGCTATAGCGGCGATACGCATAATACGCATAGCAGATGCAGCAGATGCAGCGGCGGATCGAGCTAGCATCGAGATCGAGCTAGCATCGAGCGGCGGCGGCGCGGATACGGATAGCGGCGATCGAGCATCGAGC

GCAGCATCGATCGTAGCATGCTAGCTAGCTAGCTGACTGACTGCGCATCGATGCAGCATCGATCGTAGCATGCTAGCTAGCTAGCTGACTGACTGCGCATCGATGCATGCTAGCTAGCTAGCTAGTCGACTGAGGCGCGCTATAGCGATACGCATAGCATGCTAGCTAGCTAGCTAGTCGACTGAGGCGCGCTATAGCGATACGCATAGCAGATGCAGCGGATCGAGCTAGCATCGAGCGGCGCGGATAGCGATCGAGCGCAGATGCAGCGGATCGAGCTAGCATCGAGCGGCGCGGATAGCGATCGAGC

• Highlight all of the GCG GCG sequences with the probe.

DNADNA Now, find all of the sequences where the Now, find all of the sequences where the

restriction enzyme restriction enzyme AT AT will cut the will cut the fragment.fragment.


GCAGCGCAGCAT|AT|CGCGAT|AT|CGTAGCCGTAGCAT|AT|GCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCAT|AT|CGCGAT|AT|GCGCAT|AT|GCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTAT|AT|AAGCGGCGAT|AT|ACGCACGCAT|AT|AGCAGAGCAGAT|AT|GCAGCAGCGGCGGGAT|AT|CGAGCTAGCCGAGCTAGCAT|AT|CGACGAGCGGCGGCGGCGCGGCGGAT|AT|AAGCGGCGAT|AT|CGAGCCGAGC

DNADNAThis leaves the following fragments.This leaves the following fragments.The ones that are not marked with the The ones that are not marked with the

probe will not appear in the gel.probe will not appear in the gel. GCAGCGCAGCATATCGCGATATCGTAGCCGTAGCATATGCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCATATCGCGATATGCGCATATGCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTATATAAGCGGCGATATACGCACGCATATAGCAGAGCAGATATGCAGCAGCGGCGGGATATCGAGCTAGCCGAGCTAGCATATCGACGAGCGGCGGCGGCGCGGCGGATATAAGCGGCGATATCGAGCdCGAGCd

GCAGCATCGATCGTAGCATGCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCATATCGATGCATGCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTATATAAGCGGCGATATACGCATAGCAGATGCAGCAGCGGCGGGATATCGAGCTAGCATCGACGAGCGGCGGCGGCGCGGCGGATATAAGCGGCGATATCGAGCd

DNADNA Count the bases in each of the marked Count the bases in each of the marked

fragmentsfragments

GCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCATATGCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTATATAAGCGGCGATATGCAGCAGCGGCGGGATATCGACGAGCGGCGGCGGCGCGGCGGATATAAGCGGCGATAT

GCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCAT -AT - 2929GCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTAT-AT-3535AAGCGGCGAT-AT-66GCAGCAGCGGCGGGAT-AT-99CGACGAGCGGCGGCGGCGCGGCGGAT-AT-1414AAGCGGCGAT-AT-66

DNADNA

GCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCAT AT - - 2929GCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTAT-AT-3535AAGCGGCGAT-AT-66GCAGCAGCGGCGGGAT-AT-99CGACGAGCGGCGGCGGCGCGGCGGAT-AT-1414AAGCGGCGAT-AT-66

If fragment has an odd number of bases, round up to the next even number.

GCTAGCTAGCTAGCTGACTGACTGGCTAGCTAGCTAGCTGACTGACTGCGCCGCAT AT - - 3030GCTAGCTAGCTAGCTAGTCGACTGAGGCTAGCTAGCTAGCTAGTCGACTGAGGCGGCGCGCTCGCTAT-AT-3636AAGCGGCGAT-AT-66GCAGCAGCGGCGGGAT-AT-1010CGACGAGCGGCGGCGGCGCGGCGGAT-AT-1414AAGCGGCGAT-AT-66

DNADNA Now, find all of the sequences where the Now, find all of the sequences where the

restriction enzyme restriction enzyme CT CT will cut the will cut the fragment.fragment.


GCAGCATCGATCGTAGCATGGCAGCATCGATCGTAGCATGCTCTAGAGCTCTAGAGCTCTAGAGCTCTGAGACTCTGAGACTCTGGCGCCGCATCGATATCGATGCATGGCATGCTCTAGAGCTCTAGAGCTCTAGAGCTCTAGTCGAAGTCGACTCTGAGGAGGCGGCGCGCGCTCTATAATAGCGGCGATACGCATAATACGCATAGCAGATGCAGCAGATGCAGCGGCGGATCGAGGATCGAGCTCTAGCATCGAAGCATCGAGCGGCGGCGGCGCGGATACGGATAGCGGCGATCGAGCATCGAGC

GCAGCATCGATCGTAGCATGGCAGCATCGATCGTAGCATGCTCT

AGAGCTCT

AGAGCTCT

AGAGCTCT

GAGACTCT

GAGACTCT

GGCGCCGCATCGATGCATGATCGATGCATGCTCT

AGAGCTCT

AGAGCTCT

AGAGCTCT

AGTCGAAGTCGACTCT

GAGGAGGCGGCGCGCGCTCT

ATAATAGCGGCGATACGCATAGCAGATGCAATACGCATAGCAGATGCAGCGGCGGATCGAGGATCGAGCTCT

AGCATCGAAGCATCGAGCGGCGGCGGCGCGGATACGGATAGCGGCGATCGAGCATCGAGC

GCAGCATCGATCGTAGCATGCT

AGCT

AGCT

AGCT

GACT

GACT


AGCT

AGCT

AGCT

AGTCGACT








GGCGCCGCATCGATGCATGATCGATGCATGCT - 17CT - 17

GAGGAGGCGGCGCGCGCT - 10CT - 10

ATAATAGCGGCGATACGCATAGCAGATGCAATACGCATAGCAGATGCAGCGGCGGATCGAGGATCGAGCT -36CT -36

AGCATCGAAGCATCGAGCGGCGGCGGCGCGGATACGGATAGCGGCGATCGAGC -30ATCGAGC -30


GAGGAGGCGGCGCGCGCT -10CT -10


AGCATCGAAGCATCGAGCGGCGGCGGCGCGGATACGGATAGCGGCGATCGAGC - 30ATCGAGC - 30





DNADNAIf fragment has an odd number of bases, round up to the next even number.





4. PCR4. PCR

Polymerase Chain Reaction is a series of Polymerase Chain Reaction is a series of chemical reactions that copy small DNA chemical reactions that copy small DNA samples so that there is enough material to samples so that there is enough material to be analyzed be analyzed

4. PCR4. PCR

a. Denaturation – heating the DNA to 94 C for 1 a. Denaturation – heating the DNA to 94 C for 1 minute separates the 2 strandsminute separates the 2 strands

4. PCR4. PCR

b. Annealing – DNA is cooled to 54 C and b. Annealing – DNA is cooled to 54 C and primers are added that select the strand to be primers are added that select the strand to be replicatedreplicated

4. PCR4. PCR

c. Extension – DNA is heated to 72 C the c. Extension – DNA is heated to 72 C the polymerase replicates the strandpolymerase replicates the strand

4. PCR4. PCR

d. This process is repeated d. This process is repeated and the sample grows and the sample grows exponentially, doubling exponentially, doubling every cycleevery cycle

Human Genome ProjectHuman Genome ProjectSequencing the Genetic code of a humanSequencing the Genetic code of a humanCompleted in 2003Completed in 2003 Humans ~ 31,000 genesHumans ~ 31,000 genes

Rapid SequencingRapid Sequencing


““Shotgun sequencingShotgun sequencing””Sequencing many genes at the same timeSequencing many genes at the same timeComputers look for overlapping strands Computers look for overlapping strands

and put them in orderand put them in order

CTGTAGCTGATGTCGTAGCTGA

ATACGTAGGCATGCTGTGTAGCTGATGCTGATCGATGCTGA


““Shotgun sequencingShotgun sequencing””Sequencing many genes at the same timeSequencing many genes at the same timeComputers look for overlapping strands Computers look for overlapping strands

and put them in orderand put them in order

ATACGTAGGCATGCTGTAGCTGATGTCGTAGCTGATGCTGATCGATGCTGA

chapter 11: the control of gene expression

Documents

differentiated adult

resulting cell

adult somatic cell

different adult cell

diploid cell

adult cells

different cells

donor cell type5