chapter 1: introduction and literature...
TRANSCRIPT
![Page 1: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/1.jpg)
THE UNIVERSITY OF THE SOUTH PACIFIC LIBRARY
Author Statement of Accessibility- Part 2- Permission for Internet Access
IUameofCandidate : REFMA 1 51Q6,H
Degree : MASTER OF SLIE~,CE
DepartmenVSchool : PI v I ~ I O ~ OF BIOLOGICAL S L 16 d.ICO, FALU 1.T-j OF SCI ENG ~ T G L H N O C O ~ \ (
Institution/University : U I V EP3 I J J D f i H E SO U Tli PAC. l F C
Thesis Title : PRNALEIJLE 07 PATI-IO~ENIL McTFPA IE) ?%Id SoLb AT Y/t PIOUS , . / , , , , . A r - v u I L E l 3 I W b Y V A ,
Date of completion of . L 1- - - A -
requirements for award : P I U ~ t~ &LK, 2 u u t - 1
1. I authorise the University to make this thesis available on the Internet for access by USP authorised users.
/
L. I ~ U L I IVI 13c LI IC VI IIVCI 3 1 ~ y LV 111akc LI 1 1 3 LI 1 ~ 3 1 3 a v a ~ ~ a u ~ c VI I LI IC 11 ILCI I ICL UI IUCI
the International digital theses project
Signed: v
Date: ~ 9 ' ' IJo~tm~t'n; 2007 -
Contact Address Permanent Address
![Page 2: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/2.jpg)
PREVALENCE OF PATHOGENIC BACTERIA IN
FISH SOLD AT VARIOUS OUTLETS IN SUVA, FIJI
A thesis presented to the University of the South Pacific
as a partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
by
Reema Reshmi Singh
Division of Biological Sciences
School of Biological, Chemical and Environmental Sciences
Faculty of Science and Technology
University of the South Pacific
Fiji Islands
![Page 3: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/3.jpg)
This thesis is dedicated with kind gratitude to my husband, Ravin Lal
for his love, care, support and providing encouragement and motivation
throughout this research
&
to my dad, Mr. Pardeep Singh & mum, Mrs. Anita Singh for their love, support and blessings
2
![Page 4: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/4.jpg)
AUTHOR’S DECLARATION I hereby declare that this thesis is a report of research work carried out by me
and has not been submitted in any form for another degree or diploma at any other
University to the best of my knowledge. Information obtained from the published work of
others and assistance received has been acknowledged elsewhere.
Candidate: Reema Reshmi Singh
Supervisor: Dr. Dhana Rao
Date Submitted: 27th July, 2007
3
![Page 5: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/5.jpg)
ACKNOWLEDGEMENT
I would like to express my appreciation to the Faculty Research Committee of the
Faculty of Science and Technology, USP, for funding the current research and for
approval of my study for Masters degree research.
I would like to express my sincere gratitude and heartfelt thanks to my principal
supervisor, Dr. Dhana Rao, Lecturer in Microbiology, Faculty of Science and
Technology, USP, for her assistance, constant support, guidance and encouragement
during the due course of this research.
I would like to extend my appreciation to my co-supervisor, Professor William
Aalbersberg, Director of the Institute of Applied Sciences, USP, for his helpful support
and guidance during this research.
My appreciation is also extended to Professor Peter Lockhart, Principal and
Associate Investigator and Trish McLenachan, Laboratory Manager at the Allan Wilson
Center for Molecular Ecology and Evolution at Massey University in Palmerston North,
New Zealand for helping me with the Polymerase Chain Reaction (PCR) analysis and
molecular sequencing of the DNA products.
I also wish to thank Dr. Abdulla Mohammad Hatha, former Lecturer in
Microbiology, USP, and my supervisor in post-graduate studies for teaching me the
techniques in the isolation of Vibrio species from fish.
4
![Page 6: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/6.jpg)
My appreciation and heartfelt thanks is also extended to Professor Linton
Winder, Associate Dean in Research and Consultancy, USP, for assisting me with
statistical analysis.
I wish to thank Ms. Reena Sagar, Accounts Clerk and Sesenieli Gukivuli, Senior
Technician at Institute of Applied Sciences for ordering the chemicals, solvents and
media for my research.
I would like to thank Mr. Klaus Feussner, Assistant Project Manager at the
Marine Natural Products Unit of the Institute of Applied Sciences for his assistance in
DNA extraction procedures and assisting me in obtaining permits for sending the DNA
extracts to New Zealand.
I would like to extend my appreciation to Ms. Anjila Nand of the Microbiology Unit
and Mr. Philip Gabriel of the Food Unit at the Institute of Applied Sciences, USP for
assisting me in various ways.
I also wish to thank Mr. Dinesh Kumar, Senior Technician, Ms. Babita Narayan,
Mr. Shiva and Ms. Parneeta, Technicians at the Division of Biology, for their assistance
in outlining the various techniques in DNA extraction and also providing equipment and
materials for sample collection.
I would finally like to extend my sincere appreciation and gratitude to my parents
for their endless encouragement, motivation, support and blessings provided to me
during this research.
5
![Page 7: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/7.jpg)
ABSTRACT
In Fiji, fish are harvested for subsistence consumption within the domestic
household and also for small-scale retail sales. Microbial contaminants in fish are
suspected to be high but the incidences in fish sold at various commercial outlets in Fiji
are unknown.
The present study investigated the presence of Escherichia coli, Vibrio
parahaemolyticus and Vibrio cholerae in fish samples sold at various outlets in Suva.
These outlets included roadside stalls (Vatuwaqa Bridge, Bailey Bridge and Raiwaqa
roadside), local markets (Suva, Lami and Laqere Market) and fish shops (Fresh ’et,
Food Processors and Cakaudrove Fish). Standard microbial analysis techniques were
adopted for detecting E. coli in the gills, gut and on the skin surface of fish samples
obtained from these outlets. The presence of V. parahaemolyticus and V. cholerae was
identified by biochemical tests (Oxidase, Salt tolerance [0, 6, 8% NaCl] and
Carbohydrate fermentation [Lactose and Sucrose]) and were further confirmed by
molecular identification.
Results indicated that there was no significant difference in the occurrence of E.
coli within the different regions of fish and between the different sources (P<0.05),
although the data indicated that microbial contamination caused by E. coli in fish was
high. There was a significant difference in the occurrence of V. parahaemolyticus in fish
obtained from different outlets (P>0.05) and significant difference of contamination by
this pathogen were found within the regions. The roadside stalls showed a high
occurrence of V. parahaemolyticus compared to the local markets and fish shops
suggesting that fish exposed to ambient temperatures could be the reason for high
6
![Page 8: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/8.jpg)
occurrence of V. parahaemolyticus. Incidence of E. coli and V. parahaemolyticus were
also detected in fish sold in fish shops, as it was observed that proper removal of gut
and gills was not practiced. V. cholerae was not detected in any of the fish samples
analyzed from all the outlets.
Inadequate fish storage facilities, limited use of ice to keep the fish cool and
improper, unhygienic handling of fish could be considered as some of the factors
contributing to the occurrence of these pathogens. Creating more awareness among the
fisher folk and fish vendors regarding the proper and hygienic handling of fish, proper
storage facilities for fish and the use of good quality ice could help rectify and improve
the situation.
7
![Page 9: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/9.jpg)
TABLE OF CONTENTS Dedication………………………………………………………………………………………..2 Author’s Declaration…………………………………………………………...……..............3 Acknowledgements…………………………………………………………………..….........4 Abstract………………………………………………………………………….……..............6 Table of Contents……………………………………………………………….……….........8 List of Figures……………………………………………………………………….…….…..10 List of tables………………………………………………………………………….………..12 CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW…………..……..13 1.1. Microbial contamination……………………………………………………..…….......13
1.2. Common routes of entry of microorganisms………………………………...……15
1.3. Nutritional Benefits of fish………………………………………………………..……15
1.4. Fish as carriers of foodborne diseases………………………………………..…….16
1.5. Microbial contamination in fish gills, gut and skin…………………………..……16
1.6. Factors affecting microbial growth in fish……………………………………..…...19
1.7. Vibrio contamination in fish………………..………………………………………….20
1.8. Common Vibrio species of concern…………………………………………….…....21
1.9. Vibrio cholerae……………………………………………………………………….…..22
1.10. Vibrio parahaemolyticus…………………………………………….………………..23
1.11. Escherichia coli……………………………………………………………….………..25
1. 12. Sources of V. cholerae, V. parahaemolyticus and E. coli in fish……….……26
1.13. Fish sales in the local economy……………………………………………………..29
1.14. Common outlets for procuring fish……………………………………………..…..30
1.15. Aims and Objectives…………………………………………………………………..32
8
![Page 10: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/10.jpg)
CHAPTER 2: METHODOLOGY…………………………………………………….33
2.1. Description of study area……………………………………………………………....33
2.2. Collection and transportation of samples…………………………………………..35
2.3. Preparation for analysis……………………………………….……………………….37
2.4. Quality control……………………………………………………..……………………..37
2.5. Bacteriological Analysis………………………………………………………………..38
2.6. Identification- Biochemical tests…………………………………………………..….40 2.7. Confirmation tests……………...…………………………………………….…………42
2.8. Qualitative testing for Escherichia coli………………………………………………45
2.9. Confirmation tests………………………………………………………………………46
2.10. Statistical analysis……………………………………………………………………..49
CHAPTER 3: RESULTS…………………………………………………………………...50
3.1. Biochemical tests for identification of Vibrio cholerae…………..……………….50
3.2. Biochemical tests for Vibrio parahaemolyticus……………………..……………..50
3.3. Escherichia coli…………………………………………………………………………..54
3.4. Vibrio parahaemolyticus………………………………………………………………..54
3.5. E. coli at different regions…………………………………………………………...…58
3.6. Vibrio parahaemolyticus at different regions………………………………………58
CHAPTER 4: DISCUSSION……………………………………………………….…59
4.1. Escherichia coli………………………………………….……………………………….59
4.2. V. parahaemolyticus…………………………………………………………………….60
4.3. Occurrence of V. parahaemolyticus at different regions…………………………61
4.4. Vibrio cholerae……………………………….……………………………………….….62
CHAPTER 5: CONCLUSION AND RECOMMENDATIONS……………………….64
9
![Page 11: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/11.jpg)
5.1. Future work………………………………..………………………………………….…..65
REFERENCES………………………………………………………………………………..66
LIST OF FIGURES
Figure 1: Map showing the sampling sites within and around Suva…………………..…34
Figure 2: White-lined Rock cod (Anyperodon leucogrammicus, Local name: Kawakawa)………………..…..36 Figure 3: Bicolour Parrot fish
(Cestoscarus bicolour, Local name: Ulavi)…………………………………....…36
Figure 4: Spinefoot Rabbit fish (Siganus vermiculatus, Local name: Nuqa)………………………………..…....36 Figure 5: Photographs showing swabbing of different regions of the fish
(a) gill area, (b) skin surface, (c) gut area……………………………………….38
Figure 6: Pictures showing typical colonies of (a) V. cholerae-like colonies and
(b) V. parahaemolyticus-like colonies on TCBS agar………………………….39
Figure 7: Picture showing growth on TSA (2% NaCl)….................................................40 Figure 8: Pictures showing preliminary biochemical tests of:
(a) Vibrio parahaemolyticus, (b) Vibrio cholerae,
10
![Page 12: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/12.jpg)
(c) A positive oxidase test………..…………………………..……….…………...41
Figure 9: Picture showing growth of typical colonies (green metallic sheen)
of E.coli on EMBA agar………………………………………………………..…46
Figure 10: Pictures showing IMVic results for confirmation of E.coli..............................48 Figure 11: Graph showing occurrence of pathogens in fish (positive at one
of the three regions in fish) obtained from various sources……………...…..54 Figure 12: Graph showing occurrence of pathogens at different regions of fish bought from roadside stalls…………………………….………………..55
Figure 13: Graph showing occurrence of pathogens at different regions of fish bought from fish shops…………………….…………………………….55 Figure 14: Graph showing occurrence of pathogens at different regions of fish bought from local markets……………….………………………………56
Figure 15: Graph showing percentage incidence of pathogens at different regions from fish shops………………………………………………………..………….56 Figure 16: Graph showing percentage incidence of pathogens at different regions from local markets……….……………………………………………………….57 Figure 17: Graph showing percentage incidence of pathogens at different regions from roadside stalls………………………….…………………………………...58
11
![Page 13: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/13.jpg)
LIST OF TABLES
Table 1: Molecular confirmation V. parahaemolyticus cultures………………..………....51 Table 2: Percentage incidence of pathogens at different body regions of fish collected from various sources……………………..….……...…53
APPENDICES……………………………………………………………………..…86
Appendix 1: Biochemical tests for identification of Vibrio cholerae…………………..…..87 Appendix 2: Biochemical tests for identification of Vibrio parahaemolyticus...................99
12
![Page 14: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/14.jpg)
CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW
People consumed seafood long before they started cultivating plants or
domesticating animals for food. Excavation of Stone Age sites have uncovered fish nets,
spears and fishing hooks made from upper beaks of birds. At present there are over
20,000 known species of edible fish, shellfish and sea mammals (Brown, In press) but
seafood has a long association with the transmission of diseases. Regulations governing
food hygiene can be found in numerous early sources such as the Old Testament, and
the writings of Confucius, in Hinduism and in Islam. Such early writers had at best only a
vague conception of the true causes of foodborne illnesses and many of their
prescriptions probably had a slight effect on their incidences. Even today, despite our
increased knowledge, foodborne diseases are perhaps the most widespread health
problem and an important cause of reduced economic production. The available
evidence clearly indicates that microbial contaminants are one of the major causes of
foodborne illnesses (Adams and Moss, 2000).
1.1. Microbial contamination
Microbial contamination is caused by microorganisms known as bacteria (Adams
and Moss, 2000). Bacteria are found almost everywhere in the environment including
soil, water, plants, animals and humans (Baird-Parker, 2000). The main carriers of
bacteria are the foods that we consume which are rarely sterile (Adams and Moss,
2000). Food carries microbial associations whose composition depends on the
organisms’ access to food, their ability to grow and the interaction in the foods as time
progresses (Adams and Moss, 2000). Moreover, the exact origin of bacterial
contamination in food depends on the natural microflora of the raw material and those
13
![Page 15: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/15.jpg)
organisms introduced in the course of harvesting, slaughter, processing, storage
conditions and the distribution of food (Adams and Moss, 2000). Microbial contamination
cause infections that are responsible for various food borne illnesses and diseases
(Collins et al., 1989). In uncontrolled conditions, these infections could cause major
foodborne disease outbreaks in a community or population. Espejo-Hermes (1998) has
identified that infections caused by these microbes are more pronounced in developing
countries, where there are improper practices in handling, storage, processing and
distribution of food and food products.
1.1.1. Microbial contamination in the seafood industry
Seafood is a highly perishable food commodity and one of the major causes of
fish spoilage is by microbial contamination (Sumner and Ross, 2002). There are two
groups of bacteria that are of public health importance in the seafood industry. These
are: (1) Those initially present in the seafood or (2) those that are introduced in the
seafood by improper handling and storage conditions (Ripabelli et al., 2004; Scoglio et
al., 2000; www.cfskan.fda.gov).
Previous researchers have indicated that microbial contaminations in seafood
are mostly due to improper storage and handling practises (Reilly and Kaferstein, 1997;
Feldhusen, 2000; Ripabelli et al., 2004; Scoglio et al., 2000; Ananthalakshmy et al.,
1990). Their study have found that microorganisms such as Vibrio parahaemolyticus,
Vibrio cholerae, Vibrio vulnificus, Aeromonas hydrophyla, Clostridium botulium, Listeria
monocytogenes, Enterobacteriaceae such as Salmonella, Shigella and Escherichia coli
are common contaminants in fish. Other species of Vibrios such as Vibrio alginolyticus
and Vibrio fluvalis are also introduced in seafood due to improper handling and storage
14
![Page 16: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/16.jpg)
techniques (Zlotkin et al., 1998; Lipp and Rose, 1997; Chattopadhyay, 2000; Ripabelli et
al., 2004; Bhaskar and Sachindra, 2006). The improper practices during handling,
storage and processing of seafood cause pathogens to multiply exponentially under
favourable conditions resulting in seafood infections (Lipp and Rose, 1997; Zlotkin et al.,
1998; Chattopadhyay, 2000; Notermans and Hoornstra 2000; Arijo et al., 2005; Al-Harbi
and Uddin, 2005). These microbial agents in seafood may result in a serious threat to
the seafood industry with a high risk of causing illness and disease.
1.2. Common routes of entry of microorganisms
Contamination of seafood by these pathogens is also a contributing factor
towards human morbidity (Ripabelli et al., 2004). These bacteria gain access to the
human body by direct contact with infected fish during improper handling, or being in
contact with other constituents of the fish environment (Alinovi et al., 1993; Acha and
Szyfres, 2003). Individuals can be infected by fish bites and fish fins which contribute to
microbial contaminants gaining entry (Darie et al., 1993; Said et al., 1998; Seiberras et
al., 2000; Novotny et al., 2004).
1.3. Nutritional Benefits of fish
In the last two decades there has been an increased awareness of the nutritional
and health benefits of fish consumption (Din et al., 2004). Fish and other seafood are
excellent sources of proteins, vitamins, minerals and most of them are low in fat. Fish
also provides a very good balance of nutrients, rich in Vitamin A and B complex and
minerals (Robert and Stadler, 2000 - Internet). Proteins from seafood are of high quality
15
![Page 17: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/17.jpg)
and are easily digested, also Vitamin A helps to protect the body from disease, and is
important for proper growth, healthy eyes and skin (Chamberlain and Titili, 2001).
The low fat content of fish and the presence of polyunsaturated fatty acids in
some red meat of fishes are known to reduce the risks of coronary heart disease and
this has increased the dietary and health significance of seafood consumption (Robert
and Stadler, 2000 -Internet; Din et al., 2004). Fish and fishery products therefore
constitute an important food component for a large section of the world population,
especially in developing countries, where fish forms a cheap source of protein (Robert
and Stadler, 2000 - Internet).
1.4. Fish as carriers of foodborne diseases
Fish are also known to be responsible for a significant percentage of foodborne
diseases worldwide (Connell, 1995; Croci and Suffredini, 2003). It has been reported
that in the United States, 10-19% of foodborne illnesses involved consumption of fish
and seafood, whereas in Japan 70% of foodborne illnesses have been attributed to
consumption of raw fish (FAO/ WHO, 2001-Internet). The true incidence of seafood-
borne diseases worldwide is still unknown, as there is no surveillance system in the
developing countries (Karunasagar et al., 2005). With the given data, the importance of
seafood as a vehicle for human illnesses has been highlighted.
1.5. Microbial contamination in fish gills, gut and skin
The gills, skin surface and gut of fish provide the first point of contact in microbial
contamination (Chamberlain and Titili, 2001; Nickelson et al., 2001). Millions of bacteria
are found on the skin surface, on the gills and in the gut of living fish (Huss and Gram,
16
![Page 18: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/18.jpg)
2004). It is suggested that microbial contaminants found in these three regions are
usually present in the fish at the time of capture (Huss, 1994). The gills, gut and the skin
regions of a dead fish are dominated by pathogens such as E. coli, Vibrio species,
Listeria species and Staphylococcus aureus (El- Shafai et al., 2004; Cho et al., 2004;
Thompson et al., 2004).
Adams and Moss (2000) revealed that microbial contamination in fish is mostly
caused by bacteria that have the ability to proliferate in sub-environments provided by
the skin surfaces, gills and alimentary canals. They found that Gram-negative bacteria
such as Pseudomonas, Shewanella, Psychrobacter, Vibrios, Flavobacterium and
Cytophaga were mostly present in the gills, gut and skin surface of the fish.
1.5.1. Fish gills
Fish gills are used for respiration, however they also provide an easy access to
bacteria and harbour a variety of microorganisms (Robert and Stadler, 2000- Internet).
The gills consist of threadlike structures called filaments (Jobling, 1995). Each filament
contains a network of capillaries that allow a large surface area for exchange of gases
(Jobling, 1995). Fish respire by pulling oxygen rich waters through their mouths and
pumping it over the gill filaments. Various microorganisms enter along with water.
Furthermore, when these microbes are provided with favourable conditions for growth,
they get established on the gills.
1.5.2. Fish skin surface
The skin surface is a good source of microbial contamination for investigation
since it is in direct contact with the environment. The flesh of the fish is an excellent
17
![Page 19: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/19.jpg)
substrate for growth of a wide range of microorganisms (FOSRI, 1997 - Internet).
However, studies have indicated that the subsurface of live fish is bacteriologically
sterile, as the immune system prevents bacteria from growing in the flesh. Bacteria gain
entry only when the fish dies and proliferate freely (Nickelson et al., 2001; Huss and
Gram, 2004). Recent findings have also demonstrated that a high incidence of bacterial
microflora dominated by Vibrios was detected on fish skin (Snoussi et al., 2006; Montes
et al., 2006). Furthermore, Adams and Moss (2000) have reported that the numbers of
microorganisms on fish skin ranged from 102-107 colony forming units (c.f.u.)/cm²
suggesting that skin surfaces carry a substantial number of bacteria.
1.5.3. Fish gut
Food is usually present in the gut of the fish when caught and it may carry
microbial contaminants. Also powerful digestive enzymes of the digestive tract
occasionally leak and penetrate the flesh of the dead fish. The leaked enzymes
contribute to the breakdown of protein in the flesh and favours microbial growth resulting
in the deterioration of fish stocks. Huss and Gram (2004) have shown that these
digestive enzymes have the ability to penetrate the flesh of frozen fish. This further
proves that bacteria are able to establish themselves on the outer and inner surface of
the live fish (skin and the gills) and have the ability to gain entry again into the inner
parts of the fish such as in the gut. The occurrence of bacteria on fish gills and the gut
ranges from 103-109 c.f.u./g, suggesting that even though internal organs of freshly
caught fish are usually free from contaminants, all fish could be carrying some levels of
bacteria (Adams and Moss, 2000).
Microorganisms such as Bacillus, Micrococcus and Corynebacterium,
Psychrobacter, Moraxella, Pseudomonas, Actinobacter, Shewanella, Flavobacterium,
18
![Page 20: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/20.jpg)
Cytophaga and Vibrios usually dominate the gills, gut and the skin surface of fish and
the incidence of these microbial agents in fish are vastly affected by the geographical
location (temperate and cold waters) (Hoi et al., 1998; Gram and Huss, 2000; Wang and
Leung, 2000; Yano et al., 2004).
1.6. Factors affecting microbial growth in fish
1.6.1. Geographical location (origin and quantity)
The number and variety of microorganisms in fish are determined by the food
origin, quantity and quality (Nickelson et al., 2001). It is anticipated that fish which
consume more food (heavy feeders) have a higher level of bacteria as compared to non-
heavy feeders. The geographical location of the catch, the season, method of harvest,
handling and storage are some of the factors contributing to fish deterioration (Nickelson
et al., 2001; Novotny et al., 2004).
1.6.2. Improper handling
Fish can be further contaminated by handling onboard, at the docks and at
markets after landing, particularly where they are exposed for sale and are subjected to
contamination with human pathogens by birds and flies (Adams and Moss, 2000).
Studies carried out by Harwood et al. (2004) have demonstrated that microbial
contamination in fish was mainly caused by lack of sanitary procedures in handling fish
during transit from the sea to the market and also during the sale of fish. In addition,
findings have also demonstrated that the initial microflora on the surface of fish is directly
related to the water environment, while the microflora in the gastrointestinal tract
corresponds to the type of food and condition of the fish (FOSRI, 1997- Internet).
19
![Page 21: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/21.jpg)
1.6.3. Improper storage conditions
After capture, fish are commonly stored in ice or refrigerated sea water before
they are transported to land (Adams and Moss, 2000). Hence, it is important that a clean
cooling agent is used, as re-use of ice and other cooling agents will lead to a rapid build-
up of microorganisms and accelerated spoilage of the stored fish (Adams and Moss,
2000).
1.6.4. Time and temperature
Other factors responsible for elevated bacterial contamination in fish include
temperature and time. Temperature and time control are two important factors that need
to be considered when fish are stored and handled as they are responsible for
multiplication of microorganisms (Whipple and Rohovec, 1994). The true storage
temperature is not only the final market box temperature, but the temperature history of
the product (Huss et al., 2004). Ambient temperature during harvest, the delay in
refrigerated storage and fluctuation in temperature during storage are three factors that
determine the presence of initial spoilage microflora in fish (Nair et al., 2007). Recent
findings by Paz et al. (2007) have shown that at ambient temperature the microflora at
the point of spoilage is dominated by mesophilic Vibrionaceae.
1.7. Vibrio contamination in fish
Vibrio species belong to the Vibrionaceae family where most of the species
require sodium chloride (2-3%) to grow (Thompson et al., 2005). Vibrios are mostly
mesophilic and their numbers tend to increase during the warmer months (Chan et al.,
1989; Kodama et al., 1991; Alam et al., 2001). They are typical of marine and estuarine
20
![Page 22: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/22.jpg)
environment and are associated with a great variety of fish and seafood (Asenjo and
Ramirez-Ronda, 1991; Hervio-Health et al., 2002; Reidl and Klose, 2002). This is
because the microflora of marine fish is predominantly halotolerant, i.e. it has the ability
to grow in a wide range of salt concentrations (FOSRI, 1997- Internet; Adams and Moss,
2000).
There are about 34 species of Vibrios of which 13 can cause human diseases,
including wound infections, gastroenteritis and also septicaemia (Asenjo and Ramirez-
Ronda, 1991; Powell, 1999; Kaysner, 2000; FAO/ WHO, 2001). Studies conducted in
countries like China (Yano et al., 2004), Malaysia (Elhadi et al., 2004), Hong Kong (Chan
et al., 1989), India (Ananthalakshmy et al., 1990), Brazil (Ayulo et al., 1994) and U.S.A
(Lipp and Rose, 1997) have indicated the occurrence and contamination of fish by
various types of bacteria of which the most common pathogens isolated were Vibrio
species.
1.8. Common Vibrio species of concern
The genus Vibrio now includes a large number of species and clear evidence is
available for the etiological role of Vibrio cholerae, Vibrio vulnificus and Vibrio
parahaemolyticus in foodborne disease (Donovon and Netten, 2000). It has been further
substantiated that these three pathogens are known to be some of the well known
documented pathogens (Scoging, 1992; Hocking et al., 1997; Oliver and Kaper, 1997;
Hoi et al., 1998; Moreno and Landgraf, 1998; Donovan and Netten, 2000; DePaola et
al., 2001; Kaysner and DePaola, 2000; Hervio-Heath et al., 2002).
21
![Page 23: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/23.jpg)
1.9. Vibrio cholerae
1.9.1. Distribution and occurrence
Vibrio cholerae is the etiological agent of cholera, one of few foodborne diseases
with epidemic and pandemic potentials (Mintz et al., 1994; Colwell, 1996). V. cholerae is
a mesophilic organism that grows in the temperature range of 10 - 43ºC with optimum
growth at 37ºC (Kaynser, 2000).
Although it is a pathogen infecting the human population, researchers have
confirmed that aquatic ecosystems are the major habitat of Vibrio species including both
pathogenic and non-pathogenic strains (Faruque and Nair, 2002). Investigations on the
occurrence of V. cholerae in fresh and marine waters have been carried out by
Chowdhury et al. (1992), where their study revealed that 12% of water samples from the
environment was contaminated with toxigenic V. cholerae. This bacterium not only has
the ability to thrive in marine waters, but also has the ability to grow in rivers as well. This
is further confirmed in investigations carried out by Yamai et al. (1996) whose findings
showed V. cholerae O1 and non-O1 in 3.6% and 61.1% water samples derived from
river indicating a possible source of contamination.
The prevalence of this pathogen is also high in fish (Shiraishi et al., 1996; Saha
et al., 1999; Montes et al., 2006). Since the gills, gut and the skin are the common entry
points of pathogenic bacteria, studies carried out by Saha et al. (1999) have found
pathogenic strains of V. cholerae (O1 and O139 serotypes) on these regions. However,
their study proved that the occurrence of these microorganisms on different regions of
22
![Page 24: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/24.jpg)
fish had less chance of contamination by toxigenic and disease producing strains of V.
cholerae.
1.9.2. Infections and diseases
Symptoms of cholera infections include sudden onset of profuse painless watery
diarrhoea, accompanied by nausea and vomiting (Gyobu et al., 1984; Faruque and Nair,
2002; Reidl and Klose, 2002). Studies carried out by Hocking et al. (1997) have found
that carriage of V. cholerae by infected humans has a contributing factor in the
transmission of this disease. Recent laboratory findings have also found that V. cholerae
O1 and Inaba El Tor strains are responsible for gastrointestinal tract infections (Hartley
et al., 2006).
1.10. Vibrio parahaemolyticus
1.10.1. Distribution and occurrence
Another pathogen of concern is Vibrio parahaemolyticus. It was first isolated in
Japan in early 1950s following food poisoning outbreaks (Chiou et al., 1991; Novotny et
al., 2004; Deepanjali et al., 2005). It has now become one of the most prevalent
foodborne pathogens in many Asian countries where seafood is consumed in a variety
of ways, including raw seafood (Oliver and Kaper, 1997; Marshall et al., 1999).
V. parahaemolyticus is a naturally occurring marine bacterium found worldwide in
estuarine and marine areas and despite its halophilic nature, it has also been isolated
from saline free waters and is often associated with food poisoning incidences relating to
seafood products (Joseph et al., 1982; Scoging, 1992; DePaloa et al., 2000; Hara-Kudo
23
![Page 25: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/25.jpg)
et al., 2003). Both pathogenic and non-pathogenic forms of this organism can be
isolated from marine and estuarine environments and from fish and shellfish dwelling in
these environments (Daniels et al., 2000; Deepanjali et al., 2005).
This bacterium is distributed in temperate and tropical coastal waters throughout
the world and is a leading cause of foodborne pathogen causing gastroenteritis (Hara-
Kudo et al., 2003; Deepanjali et al., 2005). Outbreaks caused by this pathogen have
been reported in countries such as the United States, China (Taiwan) and Spain (Hervio-
Heath et al., 2002; Herrera et al., 2006). Moreover, in several Asian countries foodborne
poisoning outbreaks were also caused by V. parahaemolyticus (Chiou et al., 2000;
Matsumoto et al., 2000; Cabrera-Garica et al., 2004; Levin, 2006; Nair et al., 2007).
1.10.2. Infections and diseases
Consumption of large numbers of V. parahaemolyticus causes vibriosis or
gastroenteritis and symptoms may be severe, resulting in nausea, diarrhoea and
sometimes abdominal cramps and fever (CDC, 1999; Kagiko et al., 2001; Wong, 2003;
Laohaprertthisan et al., 2003). Extra-intestinal infections can also occur with this
bacterium (Daniels et al., 2000). Long term effects include reactive arthritis. The
incubation period from consumption to illness may range between 4 to 96 hours and
recovery may take as long as a week (Wong, 2003).
Infections and diseases caused by V. parahaemolyticus occur when this
bacterium attaches itself to the small intestine and secretes an unidentified toxin. The
disease usually runs its course in 2 - 3 days although some cases may require
hospitalization or antibiotic treatment (Nair et al., 2007). Severe disease is rare and
occurs more commonly in persons with weakened immune systems.
24
![Page 26: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/26.jpg)
V. parahaemolyticus can also cause an infection of the skin when an open wound is
exposed to warm seawater (Nair et al., 2007). Raw or undercooked seafood including
fish will put consumers at risk (Croci and Suffredini, 2003).
1.11. Escherichia coli
1.11.1. Distribution and occurrence
Escherichia coli are common contaminants of seafood. It is one of the most
common aerobic microorganisms found in the intestinal tract of man and warm blooded
animals (www.fao.org). E. coli strains found in the intestinal tract are mostly harmless
commensals, playing an important role in maintaining intestinal physiology (Teophilo,
2002; www.fao.org). Due to its common occurrence in faeces, it is readily culturable and
survival characteristics in water led to the adaptation of E. coli as an indicator of faecal
contamination and the possible presence of enteric pathogens (Feldhusen, 2000).
E. coli was first reported to be a cause of gastroenteritis in the 1940s and until
1982, these strains have acquired the ability to cause diarrhoea indicating that this
bacterium is of microbiological concern. In some countries, waste water enriched fish
ponds are used for fish cultivation and this leads to a high occurrence of enteric
pathogens (bacteria and viruses) (Fattal et al., 1998). The high load of enteric pathogens
exhibit their pathogenicity due to their penetration and accumulation rate in the fish
tissue and constitutes a potential public health hazard, especially in countries where raw
fish is consumed (Fattal et al., 1998). E. coli including other coliforms and bacteria such
as Staphylococcus species and sometimes Enterococci, are common indices of
hazardous conditions during processing of fish (Novotny et al., 2004).
25
![Page 27: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/27.jpg)
Reports have shown that contamination by E. coli in fish sold in countries such
as Taiwan (Hwang et al., 2004) and Patna in India (Kumari et al., 2001) are high. Their
study has also revealed that the high incidence of E. coli in fish were detected during the
summer seasons.
1.11.2. Infections and diseases
E. coli can cause a variety of different diseases which include diarrhoea,
dysentery, hemolytic uremic syndrome, bladder and kidney infections, septicaemia,
pneumonia and meningitis (Teophilo, 2002).
1. 12. Sources of V. cholerae, V. parahaemolyticus and E. coli in fish
1.12.1. Raw and inadequate cooked seafood
The common cause of cholera infections in humans is by consuming raw fish
(Kam et al., 1995; Maggi et al., 1997). Dalsgaard and his co-workers (2002) have also
identified that raw seafood were common carriers of V. cholerae and the incidence of
this pathogen was high in fish products originating from tropical areas. This has been
further substantiated by Vuddhakul et al. (2000) whose findings have suggested that
people become infected with V. parahaemolyticus primarily through consumption of raw
or uncooked seafood. These infections have been well reported in countries like Japan
(Marshall et al., 1999), Hong Kong (Chan et al., 1989), Kenya (Kagiko et al., 2001) and
India (Deepanjali et al., 2005) where outbreaks by this bacterium were mainly caused by
ingestion of raw or undercooked seafood. Earlier studies have reported that diarrhoeal
outbreaks were also caused by ingestion of raw and undercooked seafood (Joseph et
al., 1982; Mitsuda et al., 1998; Vuddhakul et al., 2000).
26
![Page 28: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/28.jpg)
1.12.2. Faecal contamination
The emergence of two common biotypes of V. cholerae, namely O1 and El Tor
serovars, have been reported to be caused by sewage contamination (Medina, 1991).
This is consistent with reports by Colaco et al. (1998) that 86% of the contamination in
water pointed to faecal contamination as the most common source and vehicle for rapid
spread of the microorganism in the aquatic environment. Other reports have also
suggested that 66% of cholera outbreaks in Africa were caused by water source
contamination, heavy rainfall, flooding and population dislocation (Naidoo and Patrick,
2002). Earlier findings by Maggi et al. (1997) have demonstrated that seafood obtained
from lagoons contaminated with human wastes resulted in a high occurrence of cholera
cases.
Foods that are washed with water contaminated with V. cholerae can also lead to
a widespread transmission of cholera (Mintz et al., 1994). V. cholerae can become
established and extremely difficult to eradicate when seafood from enclosed bodies of
faecally contaminated water is frequently eaten raw (McIntyre et al., 1979). Therefore,
these studies have shown the central role of faecal contaminated waters as a common
vehicle for transmission of cholera.
E. coli occurs on fish products as a result of contamination from the animal/
human reservoir. Contamination is normally associated with faecal contamination or
pollution of natural waters or water environments, where these organisms may survive
for a long time or through direct contamination of products during processing (FOSRI,
1997). Studies carried out by Kumar et al. (2005) have revealed that sewage
contamination of fish harvesting areas is the major reason for the presence of E. coli, but
contamination can also occur through use of non-potable water or ice in the landing
27
![Page 29: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/29.jpg)
centres or fish markets. Faecal matter enters aquatic bodies in the form of human or
animal faeces, storm water run-offs and from farmlands. As this faecal matter enters the
aquatic system, chances are that the fauna of the marine environment, such as fish,
could ingest or accumulate it in their system.
1.12.3. Temperature and water salinity
Warm summer temperatures and estuarine conditions (reduced ocean salinity)
are favourable for growth of V. cholerae and V. parahaemolyticus. Studies conducted by
Kodoma et al. (1991) and Daniels et al. (2000) have found that the V. cholerae count
isolated from fish during summer seasons was higher, as compared to other seasons.
Findings also showed that this bacterium has the ability to thrive in almost any aquatic
environment, provided the salinity of the water is favourable (Jiang, 2001).
Investigations carried out by Johnston and Brown (2002) found that the
occurrence of V. parahaemolyticus bacterium in seafood is not related to pollution or
sewage contamination but is directly related to temperature. This has been reflected in
studies conducted by Wong (2003) where findings have shown that this bacterium is
rarely found in water where the temperature is less than 15ºC.
E. coli is an organism whose presence is useful as an indicator of contamination
(presence in small numbers) or mishandling such as temperature abuse in product
handling (presence in large numbers). This is supported by researchers whose studies
have confirmed that contamination of fish probably occurred during handling and
production processes (Ayulo et al., 1994; Asai et al., 1999).
28
![Page 30: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/30.jpg)
1.13. Fish sales in the local economy
Fiji is a tropical country surrounded by sea where the majority of local fisher folk
are involved in the harvesting of fish for subsistence consumption within the household.
Due to easy accessibility and cheap labour, the fishing industry has seen an increase in
fish sales and also the number of people engaged in fish sales businesses. Therefore,
fish as a common food commodity forms the livelihood of most of the local coastal
populace. The dietary lifestyles of many people are changing and many are adapting fish
as a healthy source of protein.
Fish are caught from waters in the lagoons and the reefs of the many islands in
Fiji by fisherman, and the fish vendors either buy the fish from these fishermen or go out
to the sea to catch their fish for sale. The fish industry also plays an important socio-
economic role in Fiji in terms of providing fish for the local population and for export
overseas. Common fish industries are now selling tropical fishes to other countries which
generate money for the country. In addition to this, there are also some fishing industries
which are involved in the canning of fish.
There are a variety of cooking methods involved in preparation of fish and in Fiji,
fish is mainly cooked in lolo which is a traditional soup prepared with coconut cream.
Many of the restaurants and hotels in Fiji include fish as common seafood on their
menus. Although fresh fish is a common delicacy, there are consumers who like to buy
dried and smoked fish for their domestic consumption. The food outlets of Suva in Fiji
are a common place to discover the variety of fish prepared in different ways for sale.
29
![Page 31: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/31.jpg)
1.14. Common outlets for procuring fish
A wide variety of species, including reef fishes and deep ocean fish, can be
obtained from a number of places in Fiji. The price of fish depends on its size, weight
and species.
1.14.1. Roadside fish stalls
The city of Suva is inundated with fish vendors selling fish next to the roadsides
and this is because of its easy accessibility to the consumers. Furthermore, it is a cheap
mode of reaching to the consumers compared to the fish markets, where they are
required to pay stall fees. Local fisher folk and fish vendors display fish on the roadsides
by laying the fish bundles on paper boards, sacks and tarpaulin pieces with no proper
icing conditions and storage techniques.
While some fish are displayed on wooden racks or opened-up sacks and
tarpaulins, other unsold fish are kept in ice-chests and old refrigerators containing ice.
Injured fish with or without gut and gills are stored together and sometimes fish are
displayed on the racks for the whole day, exposed at ambient temperatures to dust and
pollution from motor vehicle emissions. Since the climatic conditions in Fiji are almost
always warm, the high temperature plays a major contributing factor in the spoilage of
these fish.
1.14.2. Local markets
Another way of obtaining fish is from local fish markets. The fish markets are
easily accessible as they are centrally located in the shopping areas or in towns. In
30
![Page 32: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/32.jpg)
Suva, for example, the main fish market is located in the city centre while other smaller
markets, such as Raiwaqa, Lami and Laqere, are located around the periphery of the
city limits. In these markets fish are displayed on tiled stalls rather than the wooden
racks in roadside stalls. Fish at these outlets are usually washed with water during
display and sale, which is not practiced by the fish sellers near the roadsides. There are
other fish vendors in the market who display their fish on the pavement and walkways
due to the lack of space.
1.14.3. Fish shops
Fish shops are considered to be the best source for purchasing fish for domestic
consumption. This is because the fresh fish is sold in a closed and air-conditioned shop
where the exposure to dust and environmental contaminants is less and the fish are
cleaned (with the gut and gills removed). Fish sellers have started to de-gut and remove
gills, since fish are believed to carry a high load of microbial contaminants in the gills and
gut areas. Consumers at fish shops are informed that the fish are cleaned (with gills and
gut removed) however, there are cases where some of the tissues are still present in the
fish after cleaning. Fish vendors at roadside stalls and local markets do not follow the
practice of removing the gills and gut and hence presence of these tissues can result in
fish spoilage.
Given the incidence of bacterial contamination of fish stocks in previous studies
and the possible health risks caused by these pathogens (as discussed in the previous
sections), it is possible that fish available in the local seafood markets in Suva could
possibly have similar types of bacterial contamination. Although there are documented
guidelines on safe seafood handling and reported incidences of seafood spoilage in Fiji
(Chamberlain and Titili, 2001), there is no data available for foodborne illnesses
31
![Page 33: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/33.jpg)
associated with fish and fishery products in Fiji. This research therefore intends to
provide an indication on the hygienic quality of fish that are sold at various outlets in
Suva, Fiji.
1.15. Aim and Objectives
The aims and objectives of the current research are to:
To carry out a qualitative investigation on the occurrence of Vibrio
parahaemolyticus, Vibrio cholerae and Escherichia coli in fish (gills, skin
surface and gut) sold at various outlets (roadside stalls, local markets and fish
shops) in Suva, Fiji.
To identify pathogenic strains of Vibrio species in fish samples obtained from
local markets, roadside stalls and fish shops using molecular identification
techniques.
To compare the incidence of these pathogens at different regions of the fish
samples and to determine whether the various outlets have any significant
effect on the prevalence of these pathogens in the fish.
32
![Page 34: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/34.jpg)
CHAPTER 2: METHODOLOGY
2.1. Description of study area
Suva is the capital city and is located in the Central Division of the Fiji Islands
(Latitude: 18.142º, Longitude: 178.44º). Fish sold in Suva are harvested from coastal
waters (including the lagoons and coral reefs) of Viti Levu and Vanua Levu (two major
islands in the Fiji group). In Suva, fresh fish are commonly sold in local markets,
roadside stalls and fish shops mostly at the weekends. For the current research, fish
samples were purchased from three different types of outlets in and around Suva. The
different outlets represent the major categories, including the roadside fish stalls, local
fish markets and fish shops.
Three different sites were chosen from these major three categories. The sites in
the retail fish shops included Food Processors (A1), Fresh ‘et Fish Shop (A2) and
Cakaudrove Fish Shop (A3). The sites in the local markets included the Suva Market
(B1), Lami Market (B2) and Laqere Market (B3). The sites in the roadside stalls included
the Bailey Bridge (C1), Vatuwaqa Bridge (C2) and the Raiwaqa roadside (C3) (Figure 1).
All these sites are popular places where fish are bought by many people in Suva. Hence,
a total of nine stations were commonly visited for fish collection.
33
![Page 35: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/35.jpg)
.Laqere Market
.Lami Market
.Cakaudrove Fish Shop
.Bailey Bridge
. Fresh’et Fish shop
.Raiwaqa
.Va waqa Bridge tu. Food Processors
. Suva Market
Figure 1: Map showing the sampling sites within and around Suva.
34
![Page 36: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/36.jpg)
2.2. Collection and transportation of samples
A total of 180 fish samples were purchased during the period of October (2006)
to January (2007) from these nine different sites in and around Suva for analysis to
determine the presence and absence of Vibrio cholerae, Vibrio parahaemolyticus and
Escherichia coli. Of this total, 20 fish samples were purchased from each site within
each major category.
The fish species selected for analysis included White-lined Rock cod
[Anyperodon leucogrammicus, local name: Kawakawa] (Figure 2) and Bicolour Parrot
fish [Cestoscarus bicolour, local name: Ulavi) (Figure 3). The Spinefoot Rabbit fish
[Siganus vermiculatus, local name: Nuqa] was purchased at one station (Vatuwaqa
Bridge) due to the unavailability of the other two fish species (Figure 4).
Fish samples were purchased from various vendors randomly in the fish market
and from the roadside stalls. Fish bought from fish markets and roadsides were selected
by identifying clarity and the firmness of the eyes, red colour of the gills and the seaweed
smell as these qualities are used to identify the freshness of the fish (Chamberlain and
Titili, 2001). Fish collections were made between 6 am and 8 am during the sampling
days.
35
![Page 37: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/37.jpg)
10 cm
Figure 2: White-lined Rock cod (Anyperodon leucogrammicus, Local name: Kawakawa)
10 cm
Figure 3: Bicolour Parrot fish (Cestoscarus bicolour, Local name: Ulavi)
10 cm
Figure 4: Spinefoot Rabbit fish (Siganus vermiculatus, Local name: Nuqa)
36
![Page 38: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/38.jpg)
The fish samples were placed into sterile bags (Bio Lab, N.Z.) and transported to
the laboratory in an ice chest containing adequate ice (with a temperature at around
4ºC). Direct contact of the fish samples with the ice was avoided to ensure maximal
survival and recovery of Vibrios and to reduce the tendency for overgrowth by
indigenous marine microflora (Kaysner and DePaola, 2001). All samples were analyzed
within two hours of sample collection. Aseptic procedures were strictly followed during
collection, transportation and analysis of the fish samples.
2.3. Preparation for analysis
Sterile media were prepared according to the manufacturers’ descriptions
provided on media bottles, whereas the reagents were prepared according to the
procedures as described by Downes and Ito (2001). Templates of 25cm² in size were
prepared by cutting squares off a cardboard and sterilized at 121ºC for 15 minutes in an
autoclave.
2.4. Quality control
Reference cultures of Escherichia coli, Vibrio parahaemolyticus, and Vibrio
cholerae [obtained from ESR, New Zealand; NZRM# 820 (V. parahaemolyticus); # 916
(E. coli) and # 1099 (V. cholerae)] were used in this study in order to compare the results
and also to check if there were any chances of contamination that could affect the
results.
37
![Page 39: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/39.jpg)
2.5. Bacteriological analysis
2.5.1. Isolation
In the laboratory, each fish sample was placed in a sterile tray disinfected with
70% ethanol. Different regions of the fish were used to test for bacterial contamination
and these included the skin surface, gills and the gut region. These regions were
swabbed separately with sterile cotton swabs (Bio Lab, N.Z.) as illustrated in Figures
5(a) - 5(c). For swabbing of the skin surface, a sterile template was used to swab an
area of 25 cm2 [Figure 5(a)] whereas the gills (opened aseptically using sterile forceps)
were swabbed from both sides [Figure 5(b)]. The gut region was swabbed [Figure 5(c)]
by making an insertion in the abdomen using a sterile scalpel. Although, fish procured
from the fish shops were considered to be cleaned (gills and the gut area removed),
swabbing was still carried out in order to identify any sources of cross contamination.
(a) (b) (c) Figure 5: Swabbing of different regions of the fish (a) gill area, (b) skin surface, (c) gut area
38
![Page 40: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/40.jpg)
2.5.2. Isolation of Vibrio cholerae and Vibrio parahaemolyticus
After swabbing, the swabs were transferred to 10ml alkaline peptone water
(APW; pH 8.5 ± 0.2, 3% (w/v) NaCl) and incubated at 37ºC for 18-24 hours for
enumeration of V. parahaemolyticus and 6-8 hours for enumeration of V. cholerae. After
incubation, the APW cultures that showed turbidity were streaked onto the Thiosulphate
Citrate Bile Salts Sucrose Agar (TCBS agar; Bio Lab, N.Z.) and incubated again at 37ºC
for 18-24 hours. As described in the Bacteriological Analytical Manual (BAM, 2004-
Internet), typical colonies of V. cholerae on TCBS agar appear as large (2-3mm),
smooth, yellow and slightly flattened with opaque centres and translucent peripheries,
whereas V. parahaemolyticus colonies are round, 2-3mm in diameter, green or blue
green colonies. Therefore, with reference to BAM (2004), two or more typical and
suspected colonies from each medium (Figure 6) were transferred to nutrient agar (Bio
Lab, N.Z.) slants (NA, 2% (w/v) NaCl) and incubated at 37ºC overnight. These isolates
on the slants were then stored at room temperature until further analysis for biochemical
testing.
(a) (b)
Figure 6: Showing typical colonies of (a) V. cholerae- like colonies and
(b) V. parahaemolyticus- like colonies on TCBS agar
39
![Page 41: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/41.jpg)
2.6. Identification- biochemical tests All cultures retrieved from nutrient agar slants were grown on Tryptic Soy Agar
plates (Bio Lab, N.Z.) (TSA, 2% (w/v) NaCl) and were incubated at 37ºC overnight
before performing biochemical tests (Figure 7). Three biochemical tests were performed
in order to streamline the results for molecular analysis. The tests performed included
carbohydrate fermentation (lactose and sucrose), Oxidase test and Salt tolerance test (in
0%, 6% and 8% NaCl).
Figure 7: Showing growth on TSA (2% NaCl)
2.6.1. Carbohydrate fermentation test
Phenol Red broths with carbohydrate (lactose and sucrose) were used for the
determination of fermentation reactions of Vibrio species. McCartney tubes containing
10ml of phenol red sucrose and lactose medium were prepared in laboratory from the
following components: peptone 5g; sodium chloride 5g, phenol red 0.0018g, sucrose 1%
and lactose 1% made up to one litre and the pH adjusted to 7. These tubes were
inoculated with growth from TSA (2% NaCl) plates and incubated at 37ºC for 18-24
hours. The presence of acid (yellow colour) indicated a positive test (BAM, 2004).
V. cholerae is sucrose positive (yellow colour) and lactose negative (brown or pink
40
![Page 42: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/42.jpg)
colour) whereas V. parahaemolyticus is both sucrose and lactose negative [Figure 8(a)
and (b)].
Carbohydrate fermentation salt tolerance
(a) (b)
Dark purple colour development within 10 seconds
(c) Figure 8: Biochemical tests reactions of (a) Vibrio parahaemolyticus
(b) Vibrio cholerae (c) A positive oxidase test
2.6.2. Cytochrome oxidase test
The overnight cultures from TSA plates with 2% NaCl (Banksia, Australia) were
transferred using a sterile wood applicator stick to a filter paper saturated with oxidase
reagent 1% [N,N,N,N'-tetramethyl-p-phenylenediamine.2HCl] (Banksia, Australia)
prepared in lab by dissolving 0.1g of [N, N, N, N'-tetramethyl-p-phenylenediamine.2HCl]
in 10ml of distilled water. A dark purple colour developing within 10 seconds indicated a
41
![Page 43: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/43.jpg)
positive test [Figure 8(c)]. Vibrio cholerae and Vibrio parahaemolyticus are both oxidase
positive.
2.6.3. Salt tolerance test
Tubes containing 5 ml of Tryptic Soy Broth (TSB) (Bio Lab, N.Z.) each
containing 0%, 6% and 8% NaCl were inoculated using growth from TSA (2% NaCl)
plates and incubated at 37ºC for 18-24 hours. Tubes showing turbidity were noted as
positive and those showing no growth was noted as negative (BAM, 2004). V. cholerae
does not require salt for growth hence is positive in 0% NaCl whereas V.
parahaemolyticus requires 6% NaCl and 8% NaCl in order to grow [Figure 8(a) and (b)].
Presumptive results obtained from these tests that indicated the presence of the target
Vibrio species were further confirmed by molecular analysis.
2.7. Confirmation tests
2.7.1. DNA extraction
This protocol for DNA extraction has been adapted and modified from Marmur
(1961). Bacterial cultures were grown in 10ml TSB (3% NaCl) in a shaking incubator at
37ºC overnight. An aliquot of 0.5ml of liquid culture was transferred to a 1.5 ml
Eppendorf tube. The suspensions were spun at 12 500 revolutions per minute (rpm) for
2 minutes in a mini-centrifuge. The supernatant was discarded and the clumped cells
were re-suspended completely in 750ul of P1 buffer (made from 50mM Tris pH 8; 10mM
EDTA), with 3.75ul of 100mg/ml RNase A (0.5mg/ml final concentration). This was
mixed by inverting the tube and incubated for 60 minutes at 37ºC in a water bath.
42
![Page 44: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/44.jpg)
After incubation, 37.5ul of 20% Sodium Dodecyl Sulphate (SDS) (Banksia,
Australia) was added together with 8ul of 10mg/ml Proteinase K (BioLab, N.Z.) to each
of the tubes and these were mixed completely and incubated for 45 minutes at 37ºC in a
water bath. After incubation, the tubes were removed and incubated again for 30
minutes at 65ºC in a water bath. The tubes were retrieved and in a fume hood, 200ul of
chloroform was added to these tubes using extra precaution. The tubes were then
shaken in a Vortex Mixer for 30 seconds. In cases where the samples were not
completely emulsified, more chloroform was added and spinning was repeated at 12 500
rpm for 2 minutes.
After spinning, the solution became biphasic, with chloroform formed on the
bottom layer in the tubes. To this, an aliquot of 200ul of potassium acetate (saturated)
was added to precipitate the SDS, mixed gently, then spun again at 12 500 rpm for 2
minutes. The top aqueous layer obtained by the above procedure was completely clear,
and where it was hazy, more potassium acetate was added to clear the haze. In some
tubes the aqueous layer was viscous, which was corrected by adding more chloroform
and spinning for 1 minute.
An aliquot of 700ul clear aqueous layer from section 2.7.1 was transferred to a
fresh Eppendorf tube and one volume of cold isopropanol (i.e. 700ul kept in a 4ºC
refrigerator) was added and spun for 10 minutes at 12 500 rpm. The supernatant was
carefully poured off from the DNA pellet, the pellet washed with 70% ethanol (400ul) and
spun again at 4ºC for 2 minutes at 12 500 rpm. The ethanol was poured off and the
pellets were dried by inverting the tubes and draining on a paper towel until no ethanol
remained.
43
![Page 45: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/45.jpg)
The DNA was re-suspended in 50ul of Low TE buffer (containing 10mM Tris, pH
7.6 – 8.5; 0.1mM EDTA). This was left overnight at room temperature. These bacterial
DNA samples were then sent to the Allan Wilson Centre for Molecular Ecology and
Evolution at Massey University in Palmerston North, New Zealand for Polymerase Chain
Reaction (PCR) analysis and molecular sequencing, because the University of the South
Pacific labs lacks the facilities.
2.7.2. PCR and sequencing
This procedure was carried out at the laboratories of Allan Wilson Centre for
Genome Services, Massey University, Palmerston North, New Zealand. Initial sequence
determinations were made for the 16SrDNA gene regions for the DNA samples. PCR
products were generated using the primers F800: GGAGCGAACAGGATTAGATACC
and RC1492: TACGGCTACCTTGTTACGACTT. The PCR thermocycling conditions
used were as follows: 1 cycle of 94ºC for 3 minutes, 35 cycles of 94ºC for 30 seconds,
50ºC for 30 seconds and 72ºC for 45 seconds, 1 cycle of 72ºC for 5 minutes and a
10ºC hold. These conditions gave a single PCR product of approximately 800 base pairs
(bp) in length. Unincorporated PCR primers were subsequently removed enyzmatically
by the addition of 1U of shrimp alkaline phosphatase (SAP, USB corp) and 5U
exonuclease 1 (EXO 1, USB corp) and incubated at 37ºC for 15 minutes followed by
80ºC for 30 minutes. The products were sequenced in both directions with the PCR
primers above using protocols provided by Applied Biosystems
(http://www.appliedbiosystems.com/) and run on an Applied Biosystems 3730 automated
capillary sequencer. Electropherograms for each sequence were edited using the
software Sequencher 4.1 (Gene Codes). BLASTN program adapted from
(http://www.ncbi.nlm.nih.gov/blast) was used to compare each sequence with sequences
in GENEBANK.
44
![Page 46: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/46.jpg)
With some cultures, unambiguous sequences could not be obtained, suggesting
that these may contain a mixture of different bacterial strains. Where an unambiguous
sequence was obtained, the sequence was compared with those in the NCBI Non
Redundant Nucleotide Sequence database using the program BLASTN
(http://www.ncbi.nlm.nih.gov/blast). In numerous cases very similar high scores were
obtained for different Vibrio strains. To distinguish among these, the recA gene region
was also sequenced for the strains identified as Vibrios. For this second experiment
recA PCR primers were used: recA-01F (TGARAARCARTTYGGTAAAGG) and recA-
04R (GGGTTACCRAACATCACVCC) (Thompson et al., 2005). The same PCR
amplification conditions were used as for the 16S rDNA resulting in a single PCR
product 547bp in length. These were sequenced in the same manner as the 16S rDNA
products, edited and compared with sequences in the NCBI Non Redundant Nucleotide
sequence database using the program BLASTN.
2.8. Qualitative testing for Escherichia coli
2.8.1. Isolation
Similar Isolation technique was used as described in section 2.5.1.
2.8.2. Isolation of E. coli
Different fish regions were swabbed separately and swabs were transferred to
10ml tubes containing Lactose broth (Bio Lab, N.Z.) with inverted Durham tube and
incubated at 44.5ºC in a water bath for 24 hours. Tubes showing turbidity with gas
production (gas trapped in the inverted Durham tubes) were used to streak onto Eosin
Methylene Blue Agar (EMBA). These were then incubated at 37ºC for 24 hours.
45
![Page 47: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/47.jpg)
Typical E. coli like colonies (green-metallic sheen) (Figure 9) were picked using a
sterile inoculation needle and aseptically transferred to sterile nutrient agar slants for
further biochemical confirmation using Indole, Methyl red, Voges porskauer and Citrate
(IMViC) identification tests.
Figure 9: Showing typical colonies (green metallic sheen) of E.coli on EMB agar.
2.9. Confirmation tests
Confirmation tests for E. coli were done using standard microbial procedures.
2. 9.1. Indole test
The presence of indole was detected by the addition of Kovacs reagent [typical
composition includes r-dimethylaminobenzaldeyde (50g), concentrated hydrochloric acid
(25ml) and amyl alcohol (75ml)]. Kovacs reagent reacts with indole, producing a bright
red compound (rosindol dye) in the reagent layer. The isolates were inoculated using a
sterile inoculation needle in 10ml tubes containing tryptone water and were incubated at
37ºC for 48 hours. After incubation, 0.5 ml of Kovacs reagent was aseptically added to
tryptone water tubes. The development of a red colour ring at the reagent layer showed
a positive test for indole [Figure 10(a)]. The absence of a red colour indicated that
tryptophan was not hydrolyzed and the bacteria were indole negative.
46
![Page 48: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/48.jpg)
2.9.2. Methyl Red test
The isolates were inoculated into tubes containing 10ml dextrose phosphate
broth (MRVP medium) (BioLab, N.Z.) using a sterile inoculation loop and incubated at
37ºC for 48 hours. After incubation, 0.6ml of methyl red indicator was added into the
MRVP medium. Methyl red turns red at a pH of 4, indicating a positive methyl red test
[Figure 10(b)] and turns yellow at a pH of 6 indicating a negative methyl red test.
2.9.3. Voges Proskauer test
The isolates were inoculated in tubes containing 10ml dextrose phosphate broth
(MRVP medium) using a sterile inoculation loop and incubated at 37ºC for 48 hours.
After incubation, 0.6 ml of Barritts reagent A (typical composition in g/ml: α-napthol 5g,
absolute ethanol 100ml) and 0.2 ml of Barritts reagent B (typical composition in g/ml:
potassium hydroxide: 40g, distilled water: 100ml) were added to the MRVP medium. The
tubes were shaken well to allow aeration of the solution. A minimum of 15 minutes was
given for the reaction to occur in the tubes before reading the results, since this process
occurs at a slower rate. Periodical shaking was done to enhance the speed of the
reaction. The development of a red colour in the culture medium 15 minutes following
addition of Barritts reagent represents a positive VP test and absence of red colour is
considered a negative VP test [Figure 10(c)].
2.9.4. Citrate utilization test
The citrate utilization test determines the ability of bacteria to use citrate as a
sole carbon source for their energy needs. The medium used was Simmon Citrate agar,
which contains sodium citrate as the carbon source, ammonia as nitrogen source and
47
![Page 49: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/49.jpg)
bromothymol blue as a pH indicator. This test was done on Simmon Citrate agar slants
since oxygen is needed for citrate utilization. Using a sterile inoculation needle, the
isolates were streaked over the agar slant. These were then incubated for 48 hours at
37ºC. After incubation, the slants were checked for colour change. Development of blue
colour indicated a positive test for citrate utilization whereas negative test is indicated by
absence of colour change [Figure 10(d)]. Results showing a ++- - were noted as E. coli
and a -+- - were noted as E. coli II for the four tests in Section 2.8.
(a) Indole test (+ve) (b) Methyl Red test (+ve)
(c) Voges Proskauer test (-ve) (d) Simmon citrate test (-ve) Figure 10: IMVic results for confirmation of E. coli
48
![Page 50: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/50.jpg)
2.10. Statistical analysis
The data of positive results obtained were subjected to Analysis of Variance
(one-way ANOVA) to compare differences in the incidences of contamination positive in
at least one of the three regions of the fish sampled. The data were also subjected to
repeated measure- ANOVA to compare the data between the three major stations
(roadside stalls, fish shops and local markets) and within the regions (gills, gut and skin
surface) using SPSS 13.0 software.
49
![Page 51: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/51.jpg)
CHAPTER 3: RESULTS
3.1. Biochemical tests for identification of Vibrio cholerae
The biochemical test results for all fish samples that had yellow colonies on TCBS
agar indicating possible V. cholerae (in the initial alkaline peptone water (APW) (BAM,
2004) are given in Appendix 1. Results did not show the presence of V. cholerae. Some
cultures (that produced yellow colonies on TCBS agar) were subjected to further
molecular screening. This was done to confirm the results of the biochemical tests and
to determine if other pathogens were present in the fish samples. The results of the
molecular analysis confirmed that there was no incidence of V. cholerae (Table 1).
3.2. Biochemical tests for identification of Vibrio parahaemolyticus
Results of biochemical analysis of green colonies indicated the possibility of the
presence of V. parahaemolyticus in initial APW test (Appendix 2). Cultures that showed
possible characteristics of V. parahaemolyticus in biochemical results (Table 1; cultures
G1-85; rows 7-20) were subjected to further analysis for confirmation of V.
parahaemolyticus.
50
![Page 52: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/52.jpg)
Table 1: Molecular confirmation of V. parahaemolyticus cultures BEST BLAST MATCH CULTURE
NO. 16S rDNA rec A
PERCENTAGE IDENTITY
Y9 * -
Y31(b) Marinomonas sp - -
Y32(b) Marinomonas sp - -
Y37(b) Marinomonas sp - - Y55 (a) Vibrios Vibrio fluvialis
Strain LMG 11654 99
Y87 Oceanimonas smirnovii
- -
G1 Vibrios V. parahaemolyticus Strain LMG 11670
99
G8 Vibrios V. parahaemolyticus Strain LMG 11670
100
G14 Vibrios V. parahaemolyticus Strain LMG 11670
100
G17 Vibrios V. parahaemolyticus Strain LMG 11670
100
G19 Vibrios V. parahaemolyticus Strain LMG 11670
100
G21 Vibrios V. parahaemolyticus Strain LMG 11670
100
G24 Vibrios V. parahaemolyticus Strain LMG 11670
100
G27 Vibrios V. parahaemolyticus Strain LMG 11670
100
G29 Vibrios V. parahaemolyticus Strain LMG 11670
98
G31 Vibrios V. parahaemolyticus Strain LMG 11670
98
G46 Vibrios V. alginolyticus strain 4409T
99
G61 Vibrios V. parahaemolyticus Strain LMG 11670
99
G82 Vibrios V. parahaemolyticus Strain LMG 11670
99
G85
Vibrios V. parahaemolyticus Strain LMG 11670
99
G87 Shewanella sp. - -
G97 Vibrios V. parahaemolyticus Strain LMG 11670
99
G105 Vibrios V. parahaemolyticus Strain LMG 16874
99
G109 Vibrios V. alginolyticus strain 4409T
99
* Mixed sequence (could not obtain readable sequence) - Not determined
BLAST analyses for 16S rDNA and recA sequences determined from 24 cultures. Using
the 16S rDNA, it was found that although the best match for all sequences in the above
51
![Page 53: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/53.jpg)
cultures (G1- G109) were similar to V. parahaemolyticus however, near equal good
matches were made to other species (Vibrios: V. parahaemolyticus, V. fortis, V.
alginolyticus). Therefore, these cultures were also sequenced for the recA gene.
52
![Page 54: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/54.jpg)
Table 2: Percentage incidence of pathogens at different body regions of fish collected from various sources
Body Region Sources
Number of fish
sampled
Pathogens Skin
Surface Gills Gut
A1 (Food Processors) 20 0 0 0 A2 (Fresh ‘et) 20 0 0 1
(5)* A3 (Cakaudrove Fish) 20
V. parahaemolyticus
0 0 1 (5)*
A1 (Food Processors) 20 3 (15)*
4 (20)*
3 (15)*
A2 (Fresh ‘et) 20 0 1 (5)*
2 (10)*
A3 (Cakaudrove Fish) 20
E. coli
2 (10)*
3 (15)*
4 (20)*
A1 (Food Processors) 20 0 0 0 A2 (Fresh ‘et) 20 0 0 0
Fish shops
A3 (Cakaudrove Fish) 20
V. cholerae
0 0 0
B1 (Suva market)
20
0 1 (5)*
1 (5)*
B2 (Lami market) 20 0 0 1 (5)*
B3 (Laqere market) 20
V. parahaemolyticus
0 0 1 (5)*
B1 (Suva market) 20 3 (15)*
0 1 (5)*
B2 (Lami market) 20 0 5 (25)*
4 (20)*
B3 (Laqere market) 20
E. coli
0 4 (20)*
3 (15)*
B1 (Suva market) 20 0 0 0
B2 (Lami market) 20 0 0 0
Local markets
B3 (Laqere market) 20
V. cholerae
0 0 0 C1 (Bailey Bridge) 20 0 2
(10)* 2
(10)* C2 (Vatuwaqa Bridge) 20 0 1
(5)* 2
(10)* C3 (Raiwaqa) 20
V. parahaemolyticus
1 (5)*
1 (5)*
1 (5)*
C1 (Bailey Bridge) 20 1 (5)*
2 (10)*
2 (10)*
C2 (Vatuwaqa Bridge) 20 3 (15)*
5 (25)*
2 (10)*
C3 (Raiwaqa) 20
E. coli
8 (40)*
5 (25)*
3 (15)*
C1 (Bailey Bridge) 20 0 0 0 C2 (Vatuwaqa Bridge) 20 0 0 0
Roadside
stalls
C3 (Raiwaqa) 20
V. cholerae
0 0 0
* Values in parenthesis indicate percentage incidence at each source
53
![Page 55: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/55.jpg)
Figure 11: Occurrence of pathogens in fish positive at one of the three regions in fish obtained from various sources
0
2
4
6
8
10
12
VP E.coli VC VP E.coli VC VP E.coli VC
Fish shops Local markets Roadsides
Sources
Mea
n of
inci
denc
e (p
er fi
sh)
The data of 20 fish samples assessed (n = 20) from each of the outlets are
expressed as the mean (± 1 standard error) per fish.
3.3. Escherichia coli
E. coli contamination in fish sold at different outlets is higher compared to V.
parahaemolyticus. One-way ANOVA analysis showed that there was no significant
difference in E. coli contamination in fish sold at different outlets (F = 3.444, P = 0.742,
d.f.= 2, 6).
3.4. Vibrio parahaemolyticus
The data subjected to one-way ANOVA showed that there was significant
difference in the occurrence of V. parahaemolyticus in fish (positive in at least one of the
three regions) bought from each outlet (F = 4.874, P = 0.04, d.f. = 2, 8).
54
![Page 56: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/56.jpg)
Figure 12: Occurrence of pathogens at different regions of fish bought from roadsides
0
1
2
3
4
5
6
7
skin gills gut skin gills gut skin gills gut
V. parahaemolyticus
E. coli V. cholerae
Pathogens
Mea
n In
cide
nce
(per
fish
)
E. coli and V. parahaemolyticus contamination on the skin and gills of fish was found to
be equal whereas none of the fish tested positive for V. cholerae.
Figure 13: Occurrence of pathogens at different regions of fish bought from fish shops
0
0.5
1
1.5
2
2.5
3
3.5
4
skin gills gut skin gills gut skin gills gut
V. parahaemolyticus
E. coli V. cholerae
Pathogens
Mea
n In
cide
nce
(per
fish
)
Contamination by V. parahaemolyticus was only detected in the gut region whereas all
regions of fish were contaminated by E. coli.
55
![Page 57: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/57.jpg)
Figure 14: Occurrence of pathogens at different regions of fish bought from local markets
0 0.5
1 1.5
2 2.5
3 3.5
4 4.5
5
skin gills gut skin gills gut skin gills gut
V. parahaemolyticus
E. coli V. cholerae
Pathogens
Mea
n In
cide
nce
(per
fish
regi
on)
All regions of fish were contaminated with E. coli whereas there was no incidence of V.
parahaemolyticus in the skin region of fish samples analysed.
Figure 15: Percentage occurence of pathogens at different regions of fish obtained from different Fish shops
0
5
10
15
20
25
E. c
oli (
A1)
E. c
oli (
A2)
E. c
oli (
A3)
VP
(A1)
VP
(A2)
VP
(A3)
VC
(A1)
VC
(A2)
VC
(A3)
Pathogens
% In
cide
nce
per r
egio
n
SKINGILLGUT
VP: Vibrio parahaemolyticus VC: Vibrio cholerae
56
![Page 58: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/58.jpg)
A higher percentage of E. coli contamination is found on the gills of fish bought from
Food Processors (A1) as compared to fish bought from Fresh ’et (A2) and Cakaudrove
Fish Shop (A3). V. parahaemolyticus contamination was only prevalent in the gut
regions of fish bought from Fresh ’et (A2) and Cakaudrove Fish Shop (A3).
Figure 16: Percentage Incidence of pathogens at different regions of fish obtained from different Local markets
0
5
10
15
20
25
30E
.col
i (B
1)
E.c
oli (
B2)
E.c
oli (
B3)
VP
(B1)
VP
(B2)
VP
(B3)
VC
(B1)
VC
(B2)
VC
(B3)
Pathogens
% In
cide
nce
per r
egio
n
SKINGILLGUT
Fish samples procured from Suva market (B1) had a higher incidence of E. coli on the
skin region and E. coli contamination on skin was absent in fish sold at Lami market (B2)
and Laqere market (B3). Equal contamination by V. parahaemolyticus was present on
the gills and gut of fish sold in Lami market (B2) and Laqere market (B3).
57
![Page 59: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/59.jpg)
Figure 17: Percentage Incidence of pathogens in fish regions obtained from different roadsides
0
5
10
15
20
25
30
35
40
45
E. c
oli (
C1)
E. c
oli (
C2)
E. c
oli (
C3)
VP
(C1)
VP
(C2)
VP
(C3)
VC
(C1)
VC
(C2)
VC
(C3)
Pathogens
% In
cide
nce
per r
egio
n
SkinGill
Gut
A higher percentage of fish is contaminated by E. coli on the skin surface in fish sold at
Raiwaqa roadside (C3) as compared to the other two sites, whereas equal percentage of
E. coli was found in fish sold at Vatuwaqa Bridge (C2) and Bailey Bridge (C1).
3.5. Escherichia coli at different regions
Results subjected to one-way ANOVA for repeated measures, showed that
there was no significant difference in the occurrence of E. coli at the different regions of
the fish analyzed ( F = 0.782, P = 0.479, d.f. 2, 12).
3.6. Vibrio parahaemolyticus at different regions Results subjected to one-way ANOVA for repeated measures, showed that there
was a significant difference in the occurrence of V. parahaemolyticus in the three regions
of the fish samples analyzed (F =7.548, P = 0.008, d.f. 2, 12).
58
![Page 60: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/60.jpg)
CHAPTER 4: DISCUSSION
4.1. Escherichia coli
The results indicate that fish sold in the markets, roadside stalls and fish shops
are contaminated by pathogenic bacteria such as E. coli and V. parahaemolyticus. A
higher incidence of E. coli was found in fish as compared to V. parahaemolyticus
indicating that E. coli is a more common contaminant of fish in the tropics (Thampuran
and Surendara, 2005). There was no significant difference in E. coli contamination in fish
sold at different major outlets (roadside stalls, fish shops and fish markets). This shows
that E. coli contamination in fish sold in Suva is high and regardless of the site where the
fish were purchased from. Thus presence of E. coli contamination in fish could be a
possible health risk to the local populace.
The presence of E. coli was detected both in the internal and external surface of
the fish (Figures 12, 13 and 14). It was found that there was no significant difference of
E. coli contamination at different regions of fish. All regions of fish sold along roadside
stalls were contaminated by E. coli (Figure 17). This shows that fish samples sold along
roadside stalls are more susceptible to microbial contamination and buying fish from
roadside stalls is not recommended. Fish sold in fish shops are usually degutted and
gills removed to avoid fish deterioration and spoilage. However, my results showed that
although the gut and gills were removed, E. coli was still present. This suggests that the
freshly cut exposed surfaces may have lead to microbial spoilage. The remnants of
tissues in the gut and gill regions could explain the presence of E. coli in fish bought
from fish shops.
59
![Page 61: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/61.jpg)
The use of poor quality water and improper storage conditions may contribute to
the high occurrence of E. coli (El-Zanfaly and Ibrahim, 1982; Lartesva et al., 1997;
Chattopadhyay, 2000; Edwin et al., 2004; El- Shafai et al., 2004; Al-Harbi and Uddin,
2005). Water used for washing and ice for chilling seafood may also be contaminated
with E. coli (Landeiro et al., 2007). Therefore, E. coli contamination may be minimized by
proper removal of the gills and gut. Proper storage (such as in ice chests) with adequate
good quality ice may also reduce contamination. However, the extent of E. coli
contamination in ice and water used for storing and washing fish in the current research
was not determined. So it cannot be established that the presence of E. coli is due to the
use of sub-quality ice and water.
4.2. V. parahaemolyticus
V. parahaemolyticus contamination in fish was significantly different at different
outlets. Fish sold at roadside stalls were highly contaminated with V. parahaemolyticus
followed by those sold in local markets and fish shops. A higher incidence of this
pathogen in fish sold at roadside stalls could be due to the temperature abuse.
Temperature is a crucial factor in the multiplication of bacteria where fish samples
sold at roadside stalls are mostly exposed to ambient temperatures with no proper
storage conditions. Previous investigators have also reported that the levels of V.
parahaemolyticus increases in seafood that are exposed to temperatures from 20 to
30ºC (Adams and Moss 2000). If the seafood is exposed to temperatures at 20 – 35ºC,
moderate levels of bacteria can increase to high levels within 2-3 hours (Adams and
Moss, 2000). The temperatures in Suva are usually within this range and this may
explain the presence of V. parahaemolyticus contaminating the fish stocks.
60
![Page 62: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/62.jpg)
Storing fish in direct contact with ice is injurious to V. parahaemolyticus (Kaysner
and DePaola 2001). This is supported by my findings which show that fish sold in fish
shops had a lower level of contamination as fish were stored at low temperatures.
Storing fish at low temperatures may also reduce the numbers of V. parahaemolyticus to
some extent but bacteria could survival up to two months at -20ºC (FOSRl, 1997).
Reports have indicated that V. parahaemolyticus dies at temperature of 0-5ºC. This
implies that efficient monitoring of freezer temperatures in fish shops should be
practised. Researchers have investigated the presence of V. parahaemolyticus in retail
pre-packed portions of marine fish sold in Spain (Herrera et al., 2006) and Japan (Miwa
et al., 2006) and showed that improper handling and processing of fish were major
contributors of fish contaminating by V. parahaemolyticus.
4.3. Occurrence of V. parahaemolyticus at different regions
The occurrence of V. parahaemolyticus was significantly different at different
regions of the fish samples analyzed. V. parahaemolyticus was more prevalent in the gut
region of most of the fish samples analysed. A unique microcosm for the proliferation of
V. parahaemolyticus is provided by the gut region (Sarkar et al., 1985) which may
explain the presence of this bacterium in this region. All regions of fish bought from
Vatuwaqa Bridge were contaminated with V. parahaemolyticus. At roadside stalls the
fish skin and gills is in direct contact to microbial contaminants in the environment. This
condition may accelerate the growth of most of the pathogenic bacteria resulting in fish
spoilage.
It was observed that injured fish were stored with the other uninjured fish in the
same bag and the bleeding from fish could have accelerated the rate of fish spoilage,
61
![Page 63: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/63.jpg)
microbial growth and contamination. Fish were displayed on top of ice chests or on the
footpath during sale which could further increase the risk of microbial contamination.
The results suggest that the growth of pathogenic micro-organisms tested were favoured
in warmer temperature conditions. This suggests that rapidly chilling fish after harvest
could reduce possibility of proliferation of these organisms. Studies carried out by Elhadi
et al. (2004) have also indicated that fish should be kept in cold conditions (at around
0ºC) during transit and storage to reduce the risk and level of Vibrios.
4.4. Vibrio cholerae
Vibrio cholerae is part of the natural bacterial flora in aquatic environments. My
results showed no occurrence of V. cholerae in the fish samples that were bought from
roadside stalls, local markets or fish shops (Figures 14-20). Molecular identification of
the yellow colonies on TCBS agar showed the presence of other microorganisms such
as Vibrio alginolyticus, Marinomonas, Oceanimonas and Shewanella species (Table 3).
Similarly, investigations by Herrera et al. (2006) have also identified the presence of
other pathogens in fish samples (Clostridium perfringens, Edwardsiella tarda, Listeria
monocytogenes and Staphylococcus aureus) suggesting that although V. cholerae were
not present, bacterial microflora in fish is diverse. Similar reports have shown the
absence of V. cholerae in fish sold in other countries such as in Iran (Hosseini et al.,
2004), Italy (Bertini et al., 2004), Spain (Herrera et al., 2006) and Australia
(Subramanian, 2007). This suggests that V. cholerae in fish is not as prevalent as V.
parahaemolyticus.
Studies conducted by Nair et al. (2006) have also confirmed that there was no
incidence of cholera-causing strains in Fiji waters and therefore fish from these waters
62
![Page 64: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/64.jpg)
do not contain this disease-causing strain. However, this does not imply that sanitation
conditions and handling techniques are well practiced in Fiji, as other pathogens such as
V. parahaemolyticus and E. coli were detected.
63
![Page 65: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/65.jpg)
CHAPTER 5: CONCLUSION AND RECOMMENDATIONS
The current research confirms that fish samples sold in Suva are contaminated
with pathogenic bacteria such as E. coli and V. parahaemolyticus. Although no fish
samples tested positive for V. cholerae, study have however found that presence of
other microorganisms are contaminating the fish stocks. Many of the local fisher folks
and fish vendors lack complete knowledge of the procedures required to ensure safe
and hygienic handling of fish. As local fishermen are usually unable to bear the cost of
ice, the fish are often stored in poor conditions. The handling, storage and distribution of
fish in the local and domestic markets in Fiji follow regulations adapted from the United
States Food and Drug Administration (USFDA). These laws and regulations are
administered by Ministry of Fisheries in Fiji. Despite the presence of these laws, the local
fisher folks and vendors fail to adhere to these regulations and there is no regular
monitoring and implementation of these laws and regulation. This has led to laxity in
laws that regulate fish sale and regulation resulting in an increased risk to public health
in relation to consumption of infected fish.
Proper handling (such as use of gloves) and storage of fish stocks (at appropriate
temperatures) should be maintained to ensure a reduced or negligible amount of
bacterial contamination. During transfer and sorting of the fish any physical damage
such as puncture and mutilation of the fish should be avoided. The appropriate
measures essential for the safety and hygienic quality of fish stocks include handling of
fish stocks with clean hands and equipment, facilitating the use of proper ice chests and
storage of fish with an adequate amount of good quality ice. Degutting, removal of gills
and washing the fish in brine before storage in ice can considerably reduce the bacterial
load and chance of loss by contamination from the gills and intestines. Fish shops
64
![Page 66: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/66.jpg)
should consistently monitor and control the time, temperature and homogeneity of
chilling.
5.1. Future work
My results show that microbial contaminants in fish samples sold in Suva are
high but further investigations are required to determine the levels and the extent of
microbial contamination. Further studies could involve a quantitative evaluation of the
fish samples contaminated with these pathogens as this would provide a clear indication
of the contamination levels of fish sold in Fiji. Analysis and identification of different
serotypes of E. coli in fish samples analyzed could also be determined. Other work could
involve characterization of different bacteria present in fish samples which would provide
a clear indication on the quality of fish sold in Suva, Fiji.
65
![Page 67: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/67.jpg)
REFERENCES
1. Acha, P. N., and B. Szyfres. 2003. Zoonoses and communicable diseases
common to man and animals. Pan American Health Organization. 3rd ed. pp. 384.
2. Adams, M. R., and M.O. Moss. 2000. Food Microbiology. The Royal Society of
Chemistry. Cambridge. pp. 38-144.
3. Al-Harbi, A., and N. Uddin. 2005. Bacterial diversity of tilapia (Oreochromis
niloticus) cultured in brackish water in Saudi Arabia. Aquaculture. 250: 566-572.
4. Alam, M. J., K. Tomochika, S. Miyoshi, and S. Shinoda. 2001. Analysis of
seawaters for the recovery of culturable Vibrio parahaemolyticus and some other
Vibrios. Microbiol. Immunol. 45: 393-397.
5. Alinovi, A., F. Vecchini, and P. Bassissi. 1993. Sporothricoid mycobacterial
infection- a case report. Acta Dermato-Venerologica. 73: 143-147.
6. Ananthalakshmy, V. K., A. Ramesh, and Y. K. Venugopalan. 1990. Bacterial
production of histamine in some tropical fish. Microbiol. 63: 71-77.
7. Arijo, S., M. Chabrillon, P. Diaz-Rosales, R. M. Rico, E. Martinez-Manzanares,
M. C. Balebona, A. E. Toranzo, and M. A. Morinigo. 2005. Bacteria isolated from
outbreaks affecting cultured sole, Solea senegalensis (Kaup). B. Eur. Assoc. of Fish
Pathol. 25: 148-154.
66
![Page 68: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/68.jpg)
8. Asai, Y., T. Murrase, R. Osawa, T. Okitsu, R. Suzuki, S. Sata, S. Yamai, J.
Terajima, H. Izumiya, K. Tamura, and H. Watanabe. 1999. Isolation of Shiga
toxin producing Escherichia coli O157:H7 from processed salmon roe associated
with the outbreaks in Japan, 1998, and a molecular typing of the isolates by pulse-
field gel electrophoresis. Kansenshogaku Zasshi. 73: 20-24.
9. Asenjo, C., and C. H. Ramirez- Ronda. 1991. Halophilic Vibrio infections: a
review. Bol. Assoc. Med. 83: 154-156.
10. Ayulo, A. M., R. A. Machado, and V. M. Scussel. 1994. Enterotoxigenic
Escherichia coli and Staphylococcus aureus in fish and seafood from the Southern
region of Brazil. Int. J. Food Microbiol. 24: 171- 178.
11. Baird- Parker, T. C. 2000.The production of microbiological safe and stable foods:
In Lund, B.M., T.C. Baird-Parker. and G.W. Gould. The Microbiological Safety and
quality of food. Aspen Publishers, Gaithersburg. pp. 7- 8.
12. Basti, A., A. MisaghI, T. Z. Salehi, and A. Kamkar. 2006. Bacterial pathogens in
fresh, smoked and salted Iranian fish. J. Food. Prot. 17: 183-188.
13. Bertini, S., C. M. Bresciani, M. Tiberto, and S. Bonardi. 2004. Microbiological
control of frozen and thawed cuttlefish (Sepia officinalis). Ital. J. Food. Sci. 16:
255 - 260.
67
![Page 69: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/69.jpg)
14. Bhaskar, N., and N. M. Sachindra. 2006. Bacteria of public health significance
associated with cultured tropical shrimp and related safety issues: a review. J.
Food. Sci. Technol. 43: 228- 238
15. Brown, A. 2008. Understanding food, principles and preparation. University of
Hawaii at Manoa. 3rd ed. pp. 165- 185. (In press).
16. Cabrera-Garcia M. E, C. Vazquez-Salinas, and E. I. Quinones- Ramirez. 2004.
Serologic and molecular characterization of Vibrio parahaemolyticus strains isolated
from seawater and fish products of the Gulf of Mexico. Appl. Environ. Microbiol.
70: 6401- 6406.
17. CDC. 1999. Outbreak of Vibrio parahaemolyticus infection associated with eating
raw oysters and clams harvested from Long Island Sound - Connecticut, New
Jersey, and New York, 1998. Morb. Moral. Wkly. Rep. 48: 48- 51.
18. Chamberlain, T and G. Titili. 2001. Seafood spoilage and sickness- Community
Fisheries Training Pacific Series 4. USP Marine Studies Programme/ Secretariat of
the Pacific Community Publication. pp. iii.
19. Chan, K. Y., M. L. Woo, L.Y. Lam, and G. L. French. 1989. Vibrio
parahaemolyticus and other halophilic Vibrios associated with seafood in Hong
Kong. J. Appl. Bacteriol. 66: 57-64.
20. Chattopadhyay, P. 2000. Fish- catching and handling. In: Robinson, R.K. (ed):
Encyclopedia of food Microbioliolgy. Academic Press. pp. 1547.
68
![Page 70: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/70.jpg)
21. Chiou, A., L. H. Chen, and S. K. Chen. 1991. Foodborne illness in Taiwan, 1981-
1989. Food. Aust. 43: 70-71.
22. Chiou, C., S. Hsu, S. Chiu, T. Wang, and C. Chao. 2000. Vibrio parahaemolyticus
serovar O3:K6 as a cause of unusually high incidence of foodborne disease
outbreaks in Taiwan from 1996-1999. J. Clin. Microbiol. 38: 4621-4625.
23. Cho, S., M. L. Jahncke, and J. B. Fun. 2004. Nutritional composition and
microflora of the flesh and fermented skate (Raja Kenojei) skins. Int. J. Food. Sci.
Nutr. 55: 45- 51.
24. Chowdhury, M., S. Miyoshi, H. Yamanaka, and S. Shinoda. 1992. Ecology and
distribution of toxigenic Vibrio cholerae in aquatic environments of a temperate
region. Microbiol. 72: 203-213.
25. Colaco, W., S.V. Silva Filho, P. Rodrigues, and E. Hofer. 1998. Isolation of
Vibrio cholerae 01 from aquatic environments and foods in Pernambuco State,
Brazil.Cad. Saude Publica. 14: 465-471.
26. Collins, C. H., P. M. Lyne, and J. M. Grange. 1989. Microbiological methods.
Butterworth and Co. (Publishers) Ltd. 3rd ed. Great Britain. pp. 183-192.
27. Colwell, R. R. 1996. Global Climate and Infectious Disease: The cholera paradigm.
Sci. 274: 2025-2031.
28. Connell, J. J. 1995. Control of fish quality. Blackwell Sciences Ltd., UK. pp. 19 -23.
69
![Page 71: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/71.jpg)
29. Croci, L., and E. Suffredini. 2003. Microbiological risk associated with seafood
consumption. Ann. Ist. Supper Sanita. 39: 35- 43.
30. Dalsgaard, A., Mazur, J. and Dalsgaard, I. 2002. Misidentification of Vibrio
cholerae O155 isolated from imported shrimp as O serogroup O139 due to cross-
aggulation with the commercial O139 antisera. J. Food Protect. 65: 670- 672.
31. Daniels, N., L. MacKinnon, R. Bishop, S. Altekruse, B. Ray, R. Hammond, S.
Thompson, S. Wilson, N. Bean, P. Griffin, and L. Slutsker. 2000. Vibrio
parahaemolyticus infections in the United States, 1973-1998. J. Infect. Dis. 181:
1661-1666.
32. Darie, H., T. Leguyadec, and J. E. Touze. 1993. Epidemiologic and clinical
aspects of Buruli ucler in Cote d’Ivoire- about 124 recent cases. Bull. Soc. Pathol.
Exot. 86: 272- 276.
33. Deepanjali, H. A., S. Kumar, I. Karunasagar and I. Karunasagar. 2005.
Seasonal variation in abundance of total and pathogenic Vibrio parahaemolyticus
bacteria in oysters along the Southwest Coast of India. Appl. Environ. Microbiol. 71:
3575- 3580.
34. DePaola, A., C. A. Kaysner, J.C. Bowers, and D.W. Cook. 2000. Environmental
investigations of Vibrio parahaemolyticus in oysters after outbreaks in Washington,
Texas, and New York (1997 and 1998). Appl. Environ. Microbiol. 66: 4649- 4654.
70
![Page 72: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/72.jpg)
35. DePaola, A., J. L. Nordstorm, J. C. Bowers, J. G. Wells, and D. W. Cook. 2003.
Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama
oysters. Appl. Environ. Microbiol. 69: 1521-1526.
36. Din, J. N., D. E. Newby, and A. D. Flapan. 2004. Omega 3 fatty acids and
cardiovascular disease - fishing for a natural treatment. British. Med. J. 328: 30-35.
37. Donovan, T. J., and P. Netten. 2000. Culture media for the isolation and
enumeration of pathogenic Vibrios species in foods and environmental samples.
Intern. J. Food Microbiol. 26: 77-91.
38. Downes, F.P., and K. Ito. 2001. Compendium of methods for microbiological
enumeration of foods. 4th ed. American Public Health Association. pp. 627- 642.
39. Edwin, S., G. Jeyasekaran, R. J. Shakila, and C. Anand. 2004. Sanitary status of
Thoothukkudi Fishing Harbour of Tamil Nadu, India. J. Food Sci. Technol. 41: 530-
533.
40. El-Shafai, S., H. J. Gijzen, FA. Nasr, and F. A, El-Gohary. 2004. Microbial
quality of tilapia reared in faecal- contaminated ponds. Environ. Res. 95: 231-238.
41. El-Zanfaly, H. I., and A. A. Ibrahim. 1982. Occurrence of bacterial pollution
indicators in Boulti (Tilapianilotica Linn) fish. Zernahrungswiss 21: 246-253.
42. Espejo-Hermes, J. 1998. Fish processing technology in the tropics, Tawid
Publications, Philippines. pp. 8.
71
![Page 73: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/73.jpg)
43. Elhadi, N., S. Radu, C. H. Chen, and M. Nishibuch. 2004. Prevalence of
potentially pathogenic Vibrio species in the seafood marketed in Malaysia. J.
Food. Prod. 67: 1469- 75.
44. Falcao, J., A. M. Dias, E. F. Correa, and D. P. Falcao. 2002. Microbiological
quality of ice used to refrigerate foods. Food. Microbiol. 19: 269- 276.
45. Faruque, S. M., and G. B. Nair. 2002. Molecular ecology of toxigenic Vibrio
cholerae. Microbiol. Immunol. 46: 59- 66.
46. Fattal, B., A. Dotan, Y. Tchorsh, L. Parpari, and H. I. Shurval. 1998.
Penetration of E. coli and F2 bacteriophage into fish tissues. Microbio. Immunol.
78: 27- 38.
47. Feldhusen, F. 2000. The role of seafood in bacterial foodborne diseases. Microbes
Infect. 2:1651- 1660.
48. Gram, L., and H. H. Huss. 2000. Fresh and processed fish and shellfish. In Lund,
B.M., T.C. Baird- Parker, G.W. Gould. The microbiological safety and quality of
Food. Volume 1. Aspen Publishers. Gaithersburg. pp. 473- 488.
49. Gyobu, Y., H. Kodama, H. Uetake, and S. Katsuda. 1984. Studies on the
enteropathogenic mechanism of non-O1 Vibrio cholerae isolated from the
environment and fish in Toyama Prefecture. Microbiol. Immunol. 28: 735- 745.
72
![Page 74: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/74.jpg)
50. Hara-Kudo Y., K. Sugiyama, M. Nishiguchi, A. Chowdhury, J. Yatsuyungi, Y.
Ohtomo, H. Konuma, M. Miya, and S. Kumagi. 2003. Prevalence of pandemic
thermo-stable direct hemolysin-producing V. parahaemolyticus O3:126 in seafood
and the coastal environment, J. Appl. Environ. Microbiol. 69: 3883-3891.
51. Hartley, D. M., J. G, Morris, and D. L. Smith. 2006. Hyperinfectivity: A critical
element in the ability of V. cholerae to cause epidemics. PLOS Med. 3: 63-69.
52. Harwood, V. J., J. P. Gandhi, and A.C. Wright. 2004. Methods for isolation and
confirmation of Vibrio vulnificus from oysters and environmental sources.
Microbiol Method. 59: 301-316.
53. Herrera, F., J. A. Santos, A. Otero, and M. L. Garcia-Lopez. 2006. Occurrence of
foodborne pathogenic bacteria in retail prepackaged portions of marine fish in
Spain. J. Appl. Microbiol. 100: 527- 536.
54. Hervio-Health, D., R. R. Colwell, A. Derrien, A. Robert-Pillar, J. M. Fournier,
M. Pommepuy. 2002. Occurrence of pathogenic Vibrios in coastal areas of France.
J. Appl. Microbiol. 92: 1123-1135.
55. Hocking, A. D., G. Arnold, I. Jenson, K. Newton, and P. Sutherland. 1997.
Foodborne microorganisms of public health significance. 5th ed. Institute of Food
Science and Technology, North Sydney. pp. 287-303.
73
![Page 75: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/75.jpg)
56. Hoi, L., I. Dalsgaard, and A. I. Dalsgaard. 1998. Improved isolation of Vibrio
vulnificus from seawater and sediment with cellobiose-colistin agar. Appl. Environ.
Microbiol. 64: 1721-1724.
57. Hosseini, H., A. M. Cheraghali, R. Yalfani, and V. Razavilar. 2004. Incidence of
Vibrio spp. in shrimp caught off the south coast of Iran. Food Control. 15:187-
190.
58. Huss, H. H. 1994. Assurance of seafood quality. FAO Fisheries Technical Paper.
FAO, Rome, Italy. 334: 179.
59. Huss, H. H., L. Ababouch, and L. Gram. (eds) 2004. Assessment and
Management of seafood quality and safety. Fisheries technical Paper. 444: 223.
60. Hwang, D. F., Y. R. Huang, K. P. Lin, T.Y. Chen, S. J. Lin, L.H. Chen, and H.S.
Hsieh. 2004. Investigation of hygienic quality and freshness of marketed fresh
seafood in Northern Taiwan. Shokuhin Eiseigaku Zasshi. 45: 225- 30.
61. Jiang, S. 2001. Vibrio cholerae in recreational beach waters and tributaries of
Southern California. Hydrobiologia. 460:157- 164.
62. Jobling, M. 1995. Environmental Biology of Fishes. Chapman and Hall. London.
pp. 119.
74
![Page 76: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/76.jpg)
63. Johnston, M. D., and M. H, Brown. 2002. An investigation into the changed
physiological state of Vibrio bacteria as a survival mechanism in response to cold
temperatures and studies on their sensitivity to heating and freezing. J. Appl
Microbiol. 92: 1066-1077.
64. Joseph, S., D. T. Ingram, and J. B. Kaper.1982. Vibrio parahaemolyticus and
related Vibrios. Crit. Rev. Microbiol. 10:124.
65. Kagiko, M. M., W. A. Damiano, and M. M. Kayihura. 2001. Characterization of
Vibrio parahaemolyticus isolated from fish in Kenya, East African Med. J. 78:
124- 127.
66. Kam, K. M., T.H. Leung, Ho, Y.Y., Ho, N.K, and T.A. Saw. 1995. Outbreak of
Vibrio cholerae O1 in Hong Kong related to contaminated fish tank water. Public
Health. 109: 389-395.
67. Kannappan, S., R.K. Leela, A. Jacob, and K.S. Manja. 2004. Inhibitory pattern of
seafood-borne bacteria in mackerel against nisapline. J. Food. Sci. Technol.
41:105-108.
68. Karunasagar, I., I. Karunasagar, and A. Paravathi. 2005. Microbial safety of
fishery products. Marine Microbiol: Facets and Opportunities; Ramaiah, N (ed.)
National Institute of Oceanography Goa. pp. 135-144.
75
![Page 77: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/77.jpg)
69. Kaysner, C. A. 2000. Vibrio species. In Lund, B.M., T.C. Baird-Parker, and G.W.
Gould (eds.). The Microbiological Safety and Quality of Food. Vol. II. Aspen
Publishers. Gaithersburg. pp. 1336-1355.
70. Kaysner, C. A., and A. DePaola, Jr. 2001. Vibrio. In Downes, F.P. and Ito. K.
(eds.), Compendium of methods for the microbiological examination of foods.
American Public Health Association, Washington, D.C. pp. 405- 417.
71. Kim, S. H., Field, K.G. Chang, D. S. Wei, C. I. and An, H. J. 2001. Identification
of bacteria crucial to histamine accumulation in Pacific Mackerel during storage. J.
Food. Protect. 64:1556-1564.
72. Kodama, H., M. Hayashi, and Y. Gyobu. 1991. Survey on the contamination of
marine fish with non-01 Vibrio cholerae and Vibrio mimicus and food poisoning
cases by these organisms. Kansenshogaku Zasshi. 65 (2): 193- 9.
73. Kumar, H. S., A. Parvathi, and I. Karunasagar, and I. Karunasagar. 2005.
Prevalence and antibiotic resistance in Escherichia coli in seafood. World J.
Microbiol. Biotechnol. 21: 619- 623.
74. Kumari, S., B. N. Prasad.G. Kumari, A. Quasim. B. K. Sinha. and J. N. Singh.
2001. Microbiological quality of fish, rohu marketed in Patna and its public health
significance. 38: 607- 608.
76
![Page 78: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/78.jpg)
75. Landeiro, C. M., R. C. Alimeida, A. T. Nascimento, J. S. Ferreira, T.
Yano. and P. F. Almeida. 2007. Hazards and critical control points in Brazilian
seafood dish preparation. Food Control. 18: 513- 520.
76. Lartseva, L., IIu. Rogatkina, and S. V. Bormotova. 1997. Microbiological
contamination of fish in the delta of Vultga. Gig. Sanit. 3: 24- 6.
77. Laohaprertthisan, V., A. Chowdhury, U. Kongmuang, S. Kalnauwakul, M.
Ishibashi, C. Matsumoto, and M. Nishibuchi. 2003. Prevalence and serodiversity
of the pandemic clone among clinical strains of Vibrio parahaemolyticus isolated in
southern Thailand. Epidemiol. Infect. 130: 395- 406.
78. Levin, R. E. 2006. Vibrio parahaemolyticus, a notably lethal human pathogen
derived from seafood: a review of its pathogenicity, characteristics, subspecies
characterization and molecular methods of detection. Food Biotechnol. 20: 93-128.
79. Lipp, E.K. and Rose, J.B. 1997. The role of seafood in food-borne diseases in the
United States of America. Rev. Sci. Technol. 16: 620- 40.
80. Maggi, P., S. Carbonara, C. Fico, T. Santantonio, C. Romanelli, E. Sforza, and
G. Pastore. 1997. Epidemiological, clinical and therapeutic evaluation of the Italian
cholera epidemic in 1994. Eur. J. Epidemiol. 13: 95- 7.
81. Marmur, J. 1961. A procedure for isolation of DNA from microorganism.J. Mol.Biol.
3: 208- 218.
77
![Page 79: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/79.jpg)
82. Marshall, S., C.G. Clark, G. Wang, M. Mulvey, M.T. Kelly. and W.M. Johnson.
1999. Comparison of molecular methods for typing Vibrio parahaemolyticus. J. Clin.
Microbiol. 37: 2473- 2478.
83. McIntyre, R. C., T. Tira, T. Flood, and P. A. Blake. 1979. Modes of transmission
of cholera in a newly infected population on an atoll: implications for control
measures. Lancet. 10: 311- 4.
84. Medina, E. 1991. Epidemic of cholera in Chile. Rev. Med. Chil. 119: 943-56.
85. Mintz, E. D., T. Popovic, and P. A. Blake. 1994. Transmission of Vibrio cholerae
O1. In I. K. Wachsmuth, P. A. Blake, and O. Olsvik. (eds.). Vibrio cholerae and
Cholera: Molecular to global perspectives. pp. 88- 93.
86. Mitsuda, T., T. Muto, M. Yamada, N. Koyayashi, M. Toba, Y. Aihara, A. Ito, and
S.Yokota.1998. Epidemiological study of a food borne outbreak of enterotoxigenic
Escherichia coli O25: NM by pulse-field gel electrophoresis and randomly
amplified polymorphic DNA analysis. J. Clin. Microbiol. 36: 625-656.
87. Miwa, N., M. Kashiwagi, F. Kawamori, T. Masuda, Y. Sano, M. Hiroi, and H.
Kurashige. 2006. Levels of Vibrio parahaemolyticus and thermostable direct
haemolysin gene-positive organisms in retail seafood determined by the most
probable number-polymerase chain reaction (MPN-PCR) method. Shokuhin
Eiseigaku Zasshi. 47: 41-45.
78
![Page 80: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/80.jpg)
88. Montes, R., R. Farto, M. J. Perez, S. P. Armada, and T. P. Nieto. 2006.
Genotypic diversity of Vibrio isolates associated with turbout (Scophthalmus
maximus) culture. Res. Microbiol. 157: 487- 495.
89. Moreno, M. L. and M. Landgraf. 1998. Virulence factors and pathogenicity of
Vibrio vulnificus strains isolated from seafood. J. Appl. Microbiol. 84: 747-751.
90. Naidoo, A. and K. Patrick. 2002. Cholera: a continuous epidemic in Africa. J.
Royal Soci. Promo. Health. 122: 89- 94.
91. Nair, B., A. Safa, N. A. Bhuiyan, S. Nusrin, D. Murphy, C. Nicol, M. Valcanis, S.
Iddings, I. Kubuabola, and H. Vally. 2006. Isolation of Vibrio cholerae 01 strains
similar to pre-seventh pandemic El Tor strains during an outbreak of
gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55: 1559-1562.
92. Nair, G., T. Ramamurthy, S. K. Bhattacharya, B. Dutta, Y. Takeda, and D. A.
Sack. 2007. Global dissemination of Vibrio parahaemolyticus serotype O3: K6 and
its serovariants. Clin. Microbiol. Rev. 20: 39- 40.
93. Nickelson, R. I. I, S. McCarthy, and G. Finne. 2001. Fish, crustaceans and
precooked seafoods. In Downes, F.P. and Ito, K., (eds.) Compendium of methods
for the microbiological examination of foods. American Public Health Association.
pp. 497- 505.
79
![Page 81: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/81.jpg)
94. Nortermans, S., and E. Hoornstra. 2000. Risk assessment of Listeria
monocytogenes in fish products: some general principles, mechanism of infection
and the use of performance standards to control human exposure. Int. J. Food.
Microbiol. 62: 223- 229.
95. Novotny, L., R. Halouzka, L. Matlova, O. Vavra, L. Dvorska, M. Bartos, and I.
Pavlik. 2004. Morphology and distribution of granulomatous inflammation in
freshwater ornamental fish infected with Mycobacterium. J. Fish. Dis. 13: 35-42.
96. Oliver, J.D., and J.B. Kaper. 1997. Vibrio species. In Doyle, M. P., L. R.
Beuchat, and T. J. Montville (eds.) Food microbiology: fundamentals and
frontiers. Washington, ASM Press. D.C. pp. 228- 264.
97. Park, M., M. H. Kim, S. T. Choi, Y. M. Kim, K. S. Kim, and D. S. Chang. 2003.
A survey of microbial levels for food in large markets of Busan. Food Sci.
Biotechnol. 12: 274-277.
98. Paz, S., N. Bisharat, E. Paz, O. Kidar, and D. Cohen. 2007. Climate change and
the emergence of Vibrio vulnificus disease in Israel. Environ. Res. 103: 390-
396.
99. Powell, J. L.1999. Vibrio species. Clin. Lab. Med. 19: 537-52.
100. Rabbani, G. H. and W.B. Greenough. 1999. Food as vehicle of transmission of
cholera. J. Diarhoeal. Dis. Res. 17:1- 9.
80
![Page 82: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/82.jpg)
101. Reilly, A. and F. Kaferstein. 1997. Food safety hazards and the application of
the principles of the hazard analysis and critical control point (HACCP) system for
their control in aquaculture production. Aquaculture. Res. 28: 735-52.
102. Riedl, J. and K. Klose. 2002. Vibrio cholerae and cholera: out of water and into
the host. FEMS. Microbiol. Rev. 26: 125-39.
103. Ripabelli, G., M. I. Sammarco, I. Fanelli, and G. M. Grasso. 2004. Detection of
Salmonella, Listeria spp, Vibrio spp and Yesinia entrocolitica in frozen seafood and
comparison with enumeration for faecal indicators: implication for public health.
Systemic. Appl. Microbiol. 16: 531-539.
104. Saha, M. K., P. Dutta and S. P. De. 1999. Possibility of public health hazards by
contamination of toxin producing V. cholerae through fishes reared in sewage fed
fishery. Indian. J. Public Health. 43: 71-72.
105. Said, R., G. Volpin, B. Grimberg, S. R. Friedenstorm, E. Lefler, and S. Stahl.
1998. Hand infections due to non-cholera Vibrios after injuries from St. Peters fish
(Tilipia zillii). J. Hand Sur. British and Eur. 23: 808- 810.
106. Sarkar, B.L., G.B. Nair, K. Banerjee. and S.C. Pal. 1985. Seasonal distribution
of Vibrio parahaemolyticus in freshwater environments and in association with
freshwater fishes in Calcutta. Appl. Environ. 49:132-136.
107. Scoging, A. C. 1992. Illness associated with seafood. Can. Med. Assoc. J. 147:
1344-1347.
81
![Page 83: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/83.jpg)
108. Scoglio, M., A. Di Pietro, A. Mauro, I. Picerno, P. Lagana, and S. A. Delia.
2000. Isolation of Listeria spp., Aeromonas spp., and Vibrio spp. from seafood
products. Ann. Ig. 12: 297-305.
109. Seiberras, S., D. Jarnier, S. Guez, and C. Series. 2000. Mycobacterium marinum
nodular lymphangitis. Presse Med. 29: 2094-2095.
110. Shiraishi, S., K. Takeda, K. Hirata, K. Hayashi, and T. Honda. 1996. Isolation
of Vibrio cholerae in imported frozen seafood and their cholera-enterotoxin
production. Kansenshogaku Zasshi. 70: 175- 179.
111. Snoussi, M., K. Ghaieb, R. Manmoud, and A. Bakhrouf. 2006. Quantitative
study, identification and antibiotics sensitivity of some Vibrionaceae associated to
marine fish hatchery. Ann. Microbiol. 56: 289-293.
112. Subramanian, T. 2007. Effect of processing on bacterial population of cuttle fish
and crab and determination of bacterial spoilage and rancidity developing on
frozen storage. J. Food Processing and Preservation. 31: 13-31.
113. Sumner, J. and T. Ross. 2002. A semi-quantitative seafood safety risk
assessment. Int. J. Food Microbiol. 77: 55-59.
114. Teophilo, G. 2002. Escherichia coli isolated from seafood: toxicity and plasmid
profiles. Int. Microbiol. 5: 11-14.
82
![Page 84: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/84.jpg)
115. Thampuran, S. A. and P.K. Surendara. 2005. Prevalence and characterization of
typical and atypical Escherichia coli from fish sold at retail in Cochin, India. J.
Food Protect. 68: 2208- 2211.
116. Thompson, F. L., T. Lida, and J. Swings. 2004. Biodiversity of Vibrios.
Microbiol. Mol. Biol. Rev. 68: 403- 431.
117. Thompson, F.L., D. Gevers, C. C. Thompson, P. Dawyndt, S. Naser, B. Hoste,
C. B. Munn, and J. Swings. 2005. Phylogeny and molecular identification of
Vibrios on the basis of multilocus sequence analysis. Appl. Environ Microbiol.
71: 5107- 5115.
118. Torres-Vitela, M. R., and E. Fernandez Escartin. 1993. Incidence of Vibrio
parahaemolyticus in raw fish, oysters and shrimp. Rev Latinoam Microbiol.
35: 267-272.
119. Vuddhakul, V., A. Chowdary, Laohaprertthisan, P. Pungrasamee, N.
Patararungrong, P. Thianmontri, M. Ishibashi, C. Matsumoto, and M.
Nishibuchi. 2000. Isolation of a pandemic 03:K6 clone of Vibrio
parahaemolyticus strain from environmental and clinical sources of Thailand.
Appl. Environ. Microbiol. 66: 2685- 2689.
120. Wang, X. H., and K.Y. Leung. 2000. Biochemical characterization of different
types of adherence of Vibrio species to fish epithelial cells. Microbiol. 146: 989-
998.
83
![Page 85: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/85.jpg)
121. Whipple, M. J., and J. S. Rohovec. 1994. The effect of heat and low pH on
selected viral and bacterial fish pathogens. Aquaculture. 123: 179- 189.
122. Wong, C. H. 2003. Detecting and molecular typing of Vibrio parahaemolyticus.
J. Food. Drug Analysis.11: 100-107.
123. Yamai, S., T. Okitsu, and Y. Katsube. 1996. Isolation and incidence of Vibrio
cholerae from river water. Kansenshogaku Zasshi. 70: 1234- 1241.
124. Yano, Y., M. Yokoyama, M. Satomi, H. Oikawa, and S. S. Chen. 2004.
Occurrence of Vibrio vulnificus in fish and shellfish available from markets in
China. J. Food Prod. 67:1617-1623.
125. Zlotkin, A., A. Eldar, C. Ghittino, and H. Bercovier. 1998. Identification of
Lactococcus garvieae by PCR. J. Clin Microbiol. 36: 983- 985.
Internet sites
126. Bacteriological Analytical Manual (BAM). 2004. In http:// www. cfsan.fda.gov
~ebam/bam-9.html.
127. FAO/WHO. 2001. In http://www.who.int/foodsafety/foodborne_disease/general
/en/index.html.
128. FOSRI, 1997. Food Science and Technology Research Institute. Annual Report.
In http://www.unuftp.is/pro99/Massette99-1FF.pdf.
84
![Page 86: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/86.jpg)
129. Robert,T. and K. M. Stadler. 2000. Safe and nutritious seafood in Virgina.
pp.348- 961. In http://www.ext.vt.edu/pubs/foods/348-961/htm.
130. http://www.fao.org/dorcep/meeting/005/x7603e/x7603e0k.htm#bm20.8.6.1.
131. http://vm.cfsan.fda.gov/~mow/chap12.html.
132. http://www.ncbi.nlm.nih.gov/blast.
133. http://www.appliedbiosystems.com/.
85
![Page 87: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/87.jpg)
APPENDICES
86
![Page 88: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/88.jpg)
Appendix 1
BIOCHEMICAL TESTS FOR IDENTIFICATION OF VIBRIO CHOLERAE
(YELLOW COLONIES ISOLATED FROM TCBS AGAR)
(A) Fish bought from local markets (B1: Suva market, B2: Lami market, B3: Laqere market)
(U: Ulavi fish, K: Kawakawa fish, G: gills, A: gut region, S: skin)
Growth in (w/v): Carbohydrate Fermentation
Culture
No.
Regions
Oxidase
Test 0%
NaCl 6%
NaCl 8%
NaCl Lactose Sucrose
V. choleraeDetected/
Not detected
BB2U1A +ve +ve +ve +ve -ve +ve Not
detected
BB2U1G +ve -ve +ve +ve -ve +ve Not detected
Y1
BB2U1S +ve -ve +ve +ve -ve +ve Not detected
BB2U2A +ve +ve +ve +ve -ve +ve Not detected
Y2
BB2U2S +ve -ve +ve +ve -ve +ve Not detected
Y3 BB2U2A +ve -ve +ve +ve -ve +ve Not detected
Y4 BB2U3G +ve +ve +ve +ve -ve +ve Not detected
Y5 BB2U4A +ve +ve +ve -ve -ve +ve Not detected
Y6 BB2U5A +ve -ve +ve +ve +ve -ve Not detected
BB2U6S +ve +ve -ve -ve -ve +ve Not detected
Y7
BB2U6A +ve -ve +ve +ve -ve +ve Not detected
BB2U7G +ve +ve +ve +ve -ve +ve Not detected
BB2U7S +ve +ve +ve +ve -ve +ve Not detected
Y8
BB2U7A +ve -ve +ve +ve -ve +ve Not detected
Y9 BB2U8A +ve -ve +ve +ve -ve +ve Not detected
Y10
BB2U9A +ve +ve +ve +ve -ve +ve Not detected
87
![Page 89: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/89.jpg)
BB2U9G +ve -ve +ve -ve -ve +ve Not detected
Y11 BB2K7G +ve -ve +ve +ve -ve +ve Not detected
BB2K8A +ve -ve +ve +ve -ve +ve Not detected
Y12
BB2K8G +ve -ve +ve +ve -ve +ve Not detected
BB2K9A +ve -ve +ve +ve -ve +ve Not detected
BB2K9G +ve -ve +ve +ve -ve +ve Not detected
Y13
BB2K9G +ve -ve +ve +ve -ve +ve Not detected
BB2K10G +ve -ve +ve +ve -ve +ve Not detected
BB2K10A +ve -ve +ve +ve -ve +ve Not detected
Y14
BB2K10S +ve -ve +ve +ve -ve +ve Not detected
Y15 BB2K11G +ve -ve +ve +ve -ve +ve Not detected
Y16 BB2K14G +ve -ve +ve +ve -ve +ve Not detected
BB2K16G +ve -ve +ve +ve -ve +ve Not detected
Y17
BB2K16A +ve -ve +ve +ve -ve +ve Not detected
Y18 BB2K19G +ve -ve +ve +ve -ve +ve Not detected
BB3U1G +ve +ve +ve +ve N/G N/G Not detected
BB3U1A +ve +ve +ve +ve -ve +ve Not detected
Y19
BB3U1S +ve +ve +ve -ve -ve -ve Not detected
Y20 BB3U2S +ve +ve +ve +ve N/G N/G Not detected
BB3U2G +ve +ve +ve +ve -ve +ve Not detected
Y21
BB3U2A +ve +ve +ve +ve -ve -ve Not detected
Y22
BB3U3G +ve +ve +ve +ve -ve +ve Not detected
BB3U4A +ve +ve -ve +ve -ve +ve Not detected
88
![Page 90: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/90.jpg)
BB3U4S +ve +ve +ve -ve -ve +ve Not detected
Y23
BB3U5S +ve +ve +ve +ve -ve -ve Not detected
BB3U6A +ve +ve +ve +ve -ve -ve Not detected
BB3U6S +ve +ve +ve -ve -ve -ve Not detected
Y24 BB3U6G +ve +ve +ve +ve -ve N/G Not
detected BB3U7S +ve +ve +ve +ve -ve +ve Not
detected
Y25 BB3U7A +ve +ve +ve +ve -ve -ve Not
detected BB3U8G +ve +ve +ve +ve -ve +ve Not
detected
Y26
BB3U8A +ve +ve +ve +ve +ve +ve Not detected
BB3U9G +ve +ve +ve +ve -ve -ve Not detected
Y27
BB3U9S +ve +ve +ve +ve -ve +ve Not
detected BB3K1A +ve +ve +ve +ve -ve +ve Not
detected
B
Y28
B3K1S +ve +ve +ve +ve -ve +ve Not detected
BB3K1G +ve +ve +ve +ve +ve +ve Not detected
BB3K2A +ve +ve +ve +ve -ve +ve Not detected
Y29
BB3K2G +ve +ve +ve +ve -ve +ve Not detected
Y30
BB3K3S +ve +ve +ve +ve N/G +ve Not detected
BB3K4A +ve +ve +ve +ve -ve -ve Not detected
Y31
BB3K4S (b) +ve +ve +ve +ve -ve +ve Not detected
BB3K5A +ve +ve +ve +ve -ve -ve Not detected
Y32
BB3K5S (b) +ve +ve +ve +ve -ve +ve Not detected
BB3K6A +ve +ve +ve +ve -ve +ve Not detected
Y33
BB3K6S +ve +ve +ve +ve -ve +ve Not detected
89
![Page 91: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/91.jpg)
BB1U1A +ve +ve +ve -ve -ve -ve Not detected
Y34
BB1U1S +ve +ve +ve +ve -ve +ve Not
detected BB1U2A +ve +ve +ve -ve -ve +ve Not
detected
Y35 BB1U2S +ve -ve +ve +ve -ve +ve Not
detected BB1U3A +ve +ve +ve +ve -ve +ve Not
detected Y36
BB1U3S +ve +ve +ve +ve -ve +ve Not detected
BB1U4G +ve +ve +ve +ve -ve +ve Not detected
Y37
BB1U4S (b)
+ve +ve +ve +ve -ve +ve Not detected
BB1U5G +ve -ve +ve -ve -ve +ve Not detected
BB1U5G +ve +ve +ve +ve -ve +ve Not detected
Y38
BB1U5S +ve +ve +ve +ve N/G +ve Not detected
BB1U6A +ve +ve +ve +ve -ve +ve Not detected
Y39
BB1U6S +ve +ve +ve +ve -ve +ve Not detected
BB1U7G +ve +ve +ve +ve -ve +ve Not detected
Y40
BB1U7A +ve +ve +ve +ve -ve +ve Not detected
BB1U8S +ve +ve +ve +ve -ve +ve Not detected
Y41
BB1U8G +ve +ve +ve +ve -ve +ve Not detected
BB1U9A +ve +ve +ve +ve -ve +ve Not detected
Y42
BB1U9S +ve +ve +ve +ve -ve +ve Not detected
BB1U10A +ve +ve +ve +ve -ve +ve Not detected
Y43
BB1U10S +ve +ve +ve +ve -ve +ve Not detected
BB1U11A +ve +ve +ve +ve N/G +ve Not detected
BB1U11S +ve +ve +ve +ve N/G +ve Not detected
Y44
BB1U11A +ve +ve +ve +ve N/G +ve Not detected
90
![Page 92: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/92.jpg)
BB1k1S +ve +ve +ve +ve +ve +ve Not detected
Y45
BB1k1A +ve -ve +ve +ve -ve +ve Not detected
BB1k2A +ve -ve +ve +ve -ve +ve Not detected
BB1k2S +ve -ve +ve +ve -ve +ve Not detected
Y46
BB1k2G +ve -ve +ve +ve -ve +ve Not detected
Y47
BB1k3A +ve +ve +ve +ve N/G +ve Not detected
BB1k4A +ve +ve +ve +ve N/G +ve Not detected
Y48
BB1k4G +ve +ve +ve +ve N/G +ve Not detected
BB1k4S +ve +ve +ve +ve -ve +ve Not detected
Y49
BB1k5A +ve +ve +ve +ve N/G +ve Not detected
BB1k6G +ve +ve +ve +ve N/G +ve Not detected
BB1k6S +ve +ve +ve +ve -ve +ve Not detected
Y50
BB1k6A +ve +ve +ve +ve -ve +ve Not detected
BB1k7S +ve +ve +ve +ve N/G +ve Not detected
BB1k7G +ve +ve -ve +ve -ve -ve Not detected
Y51
BB1k7S +ve +ve -ve +ve -ve +ve Not detected
BB1k8S +ve +ve -ve +ve -ve +ve Not detected
BB1k8A +ve +ve -ve +ve -ve +ve Not detected
Y52
BB1k8G +ve +ve -ve +ve -ve -ve Not detected
91
![Page 93: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/93.jpg)
FISH BOUGHT FROM ROADSIDES (C1: Vatuwaqa bridge, C2: Bailey bridge, C3: Raiwaqa)
[C: ROADSIDES, U: ULAVI FISH, N: NUQA FISH, G: GILLS, A: GUT REGION, S: SKIN]
Growth in (w/v): Carbohydrate
Fermentation
Culture no.
Regions
Oxidase Test
0%
NaCl
6%
NaCl
8%
NaCl Lactose Sucrose
V. cholerae detected/
not detected
C1N1S +ve +ve +ve +ve -ve +ve Not detected
C1N1A +ve -ve +ve +ve N/G +ve Not detected
Y53
C1N1G +ve -ve -ve -ve -ve +ve Not detected
Y54 C1N3A +ve -ve -ve -ve -ve -ve Not detected
C1N5G (a)
+ve -ve +ve -ve -ve +ve Not detected
Y55
C1N5A +ve -ve +ve -ve -ve +ve Not detected
Y56
C1N6G +ve -ve +ve +ve -ve +ve Not detected
Y57 C1N7G +ve -ve +ve -ve -ve +ve Not detected
Y58 C1N10A +ve -ve +ve -ve -ve +ve Not detected
Y59 C1N10A +ve -ve +ve -ve -ve +ve Not detected
C1U1A +ve -ve +ve -ve -ve +ve Not detected
Y60
C1U1G +ve -ve +ve -ve -ve +ve Not detected
Y61 C1U3A +ve -ve +ve -ve -ve +ve Not detected
C1U4A +ve -ve +ve -ve -ve +ve Not detected
Y62
C1U4G +ve -ve +ve -ve -ve +ve Not detected
Y63
C1U6A +ve -ve +ve -ve -ve +ve Not detected
C1U7S +ve -ve +ve -ve -ve +ve Not detected
Y64
C1U7A +ve -ve +ve -ve -ve +ve Not detected
92
![Page 94: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/94.jpg)
Y65 C1U8G +ve -ve +ve -ve -ve +ve Not detected
C2U1G -ve -ve +ve +ve -ve +ve Not detected
C2U1A -ve -ve +ve +ve N/G +ve Not detected
Y66 C2U1S -ve -ve +ve +ve N/G +ve Not
detected C2U2S +ve -ve +ve +ve -ve +ve Not
detected C2U2G +ve +ve +ve +ve -ve +ve Not
detected
Y67
C2U2A +ve -ve +ve +ve -ve +ve Not detected
Y68
C2U3A +ve -ve +ve -ve -ve +ve Not detected
Y69
C2U4A +ve -ve +ve +ve -ve +ve Not detected
C2U5S +ve -ve +ve -ve -ve -ve Not detected
Y70 C2U5A +ve -ve +ve -ve -ve +ve Not detected
C2U6G +ve -ve +ve -ve -ve +ve Not detected
Y71
C2U6A +ve -ve +ve -ve -ve -ve Not detected
Y72 C2U8A +ve -ve +ve -ve -ve +ve Not detected
C2N1G +ve -ve +ve -ve +ve +ve Not detected
C2N1A +ve -ve +ve +ve -ve +ve Not detected
Y73
C2N1S +ve +ve +ve +ve -ve +ve Not detected
C2N5G +ve -ve +ve +ve -ve +ve Not detected
Y74 C2N5A +ve -ve +ve +ve -ve +ve Not detected
Y75 C2N6G +ve -ve +ve +ve +ve +ve Not detected
Y76 C2N7G +ve -ve -ve -ve -ve +ve Not detected
Y77 C2N10A +ve -ve +ve +ve -ve +ve Not detected
Y78 C2K1A +ve -ve +ve +ve -ve +ve Not detected
C2K2A +ve +ve -ve +ve -ve +ve Not
93
![Page 95: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/95.jpg)
detected Y79
C2K2S +ve -ve +ve -ve -ve +ve Not detected
C2K3G +ve -ve +ve -ve -ve +ve Not detected
Y80
C2K3A +ve -ve +ve +ve -ve +ve Not detected
Y81 C2K5G +ve -ve +ve +ve -ve +ve Not detected
Y82 C2K6A +ve -ve +ve +ve -ve +ve Not detected
Y83 C2K7A +ve -ve +ve +ve -ve +ve Not detected
Y84 C2K8A +ve -ve +ve +ve -ve +ve Not detected
C2K9G +ve -ve +ve +ve -ve +ve Not detected
Y85
C2K9S +ve -ve +ve +ve -ve +ve Not detected
C2K10S +ve -ve +ve +ve -ve +ve Not detected
C2K10G +ve -ve +ve +ve -ve +ve Not detected
Y86
C2K10A +ve -ve +ve +ve -ve +ve Not detected
Y87 C3U3G +ve +ve -ve +ve -ve +ve Not detected
Y88 C3U4A +ve -ve +ve +ve -ve +ve Not detected
C3U6A +ve +ve -ve +ve -ve +ve Not detected
Y89
C3U6S +ve -ve +ve -ve -ve +ve Not detected
C3U7G +ve -ve +ve -ve -ve +ve Not detected
Y90
C3U7A +ve -ve +ve +ve -ve +ve Not detected
Y91 C3U8G +ve -ve +ve +ve -ve +ve Not detected
Y92 C3U8A +ve -ve +ve +ve -ve +ve Not detected
C3U9S +ve -ve +ve +ve -ve +ve Not detected
Y93
C3U9A +ve -ve +ve +ve -ve +ve Not detected
Y94
C3U10G +ve -ve +ve +ve -ve +ve Not detected
94
![Page 96: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/96.jpg)
C3U10S -ve -ve +ve +ve -ve +ve Not detected
C3K1S -ve -ve +ve +ve -ve +ve Not detected
Y95 C3K1G -ve -ve +ve +ve -ve +ve Not detected
C3K3A -ve -ve +ve +ve -ve +ve Not detected
Y96
C3K3G -ve -ve +ve +ve -ve +ve Not detected
C3K5A -ve -ve +ve +ve -ve +ve Not detected
C3K5S -ve -ve +ve +ve -ve +ve Not detected
Y97
C3K5G -ve -ve +ve +ve -ve +ve Not
detected
Y98 C3K7A -ve -ve +ve +ve -ve +ve Not detected
Y99 C3K9A -ve -ve +ve +ve -ve +ve Not detected
Y100 C3K10A -ve -ve +ve +ve -ve +ve Not detected
N/ G: NO GROWTH
95
![Page 97: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/97.jpg)
FISH BOUGHT FROM FISH SHOPS (A1: Food Processors, A2: Fresh ’et, A3: Cakaudrove)
[A: FISH SHOPS, U: ULAVI FISH, K: KAWAKAWA FISH, G: GILLS, A: GUT REGION, S:SKIN]
Growth in (w/v): Carbohydrate Fermentation
Culture
Nos.
Regions
Oxidase
Test 0%
NaCl
6%
NaCl
8%
NaCl
Lactose Sucrose
V.
cholerae Detected/
Not detected
A1U1G -ve +ve +ve +ve +ve +ve Not detected
A1U1A +ve -ve +ve +ve -ve +ve Not detected
Y101
A1U1S -ve -ve +ve -ve +ve +ve Not detected
A1U2S +ve +ve +ve +ve +ve +ve Not detected
A1U2A +ve +ve +ve +ve +ve +ve Not detected
Y102
A1U2G -ve +ve +ve +ve +ve +ve Not detected
A1U4G -ve +ve +ve +ve +ve +ve Not detected
Y103
A1U4A -ve +ve +ve +ve +ve +ve Not detected
Y104 A1U5G -ve +ve +ve +ve +ve +ve Not detected
Y105 A1U11G -ve +ve +ve +ve +ve +ve Not detected
Y106 A1U15G -ve +ve +ve +ve +ve +ve Not detected
Y107
A1k1S +ve +ve +ve +ve N/G +ve Not detected
Y108 A1k1A +ve -ve +ve +ve +ve +ve Not detected
A1k2S +ve +ve +ve +ve -ve +ve Not detected
A1k2G +ve -ve +ve +ve -ve -ve Not detected
Y109
A1k2A +ve -ve +ve -ve -ve +ve Not detected
A1k8G +ve -ve +ve +ve -ve +ve Not detected
A1k8S +ve +ve +ve +ve -ve +ve Not detected
Y110
A1k8A +ve -ve +ve +ve -ve +ve Not detected
96
![Page 98: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/98.jpg)
Y111 A1k11A -ve +ve +ve +ve +ve +ve Not detected
Y112 A1k13A -ve -ve +ve -ve -ve +ve Not detected
Y113 A1k18A +ve -ve +ve -ve -ve +ve Not detected
A1K19G -ve +ve +ve +ve +ve +ve Not detected
A1K19S -ve -ve +ve -ve -ve +ve Not detected
Y114
A1K19A +ve -ve -ve -ve +ve +ve Not detected
A2N1G +ve +ve -ve +ve -ve +ve Not detected
Y115 A2N1S +ve +ve +ve +ve +ve -ve Not detected
A2N2S +ve +ve -ve +ve -ve +ve Not detected
Y116 A2N2G +ve -ve +ve +ve -ve +ve Not detected
A2N4G +ve +ve -ve -ve -ve +ve Not detected
Y117
A2N4A +ve -ve -ve -ve -ve +ve Not detected
Y118 A2N5S +ve +ve +ve +ve +ve +ve Not detected
Y119 A2K1S +ve -ve +ve +ve +ve +ve Not detected
Y120 A2K2G +ve +ve +ve -ve -ve +ve Not detected
Y121 A2K3S +ve +ve +ve -ve -ve +ve Not detected
A2K6S
+ve -ve +ve +ve +ve +ve Not detected
Y122 A2K6A
+ve -ve +ve +ve +ve +ve Not detected
Y123 A2K7A
+ve -ve +ve +ve -ve -ve Not detected
Y124 A3U1G +ve -ve +ve +ve +ve +ve Not detected
Y125 A3U1A +ve -ve +ve +ve +ve +ve Not detected
Y126 A3U2G +ve -ve +ve +ve +ve +ve Not detected
Y127 A3U3A +ve -ve +ve +ve -ve +ve Not detected
97
![Page 99: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/99.jpg)
Y128 A3U4A +ve -ve +ve +ve -ve +ve Not detected
A3U5A +ve -ve +ve +ve -ve +ve Not detected
A3U5A +ve -ve +ve +ve -ve +ve Not detected
Y129 A3U5S +ve -ve +ve +ve -ve +ve Not
detected Y130 A3U6S +ve -ve +ve +ve -ve +ve Not
detected A3U7A
+ve -ve +ve +ve -ve +ve Not
detected
Y131 A3U7S
+ve -ve +ve +ve -ve +ve Not
detected A3U8G +ve -ve +ve +ve -ve +ve Not
detected
Y132 A3U8S +ve -ve +ve +ve -ve +ve Not
detected Y133 A3U9G +ve -ve +ve +ve -ve +ve Not
detected Y134 A3U12S +ve -ve +ve +ve -ve +ve Not
detected Y135 A3U13G +ve -ve +ve +ve -ve +ve Not
detected
Y136 A3U13A +ve -ve +ve +ve -ve +ve Not detected
Y137 A3U16G +ve -ve +ve +ve -ve +ve Not detected
Y138 A3U19A +ve -ve +ve +ve -ve +ve Not detected
V. cholerae Reference culture
+ve +ve -ve -ve -ve +ve
N/G: No growth
98
![Page 100: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/100.jpg)
Appendix 2
BIOCHEMICAL TESTS FOR IDENTIFCATION OF VIBRIO PARAHAEMOLYTICUS
[GREEN COLONIES ISOLATED FROM TCBS AGAR]
Growth in (w/v): Carbohydrate Fermentation
Culture
Nos.
Regions
Oxidase Test
0% NaCl
6% NaCl
8% NaCl
Lactose Sucrose
V.parahaemolyticus Detected/
Not detected
C3K1A +ve +ve +ve +ve -ve -ve Not detected
C3K1G +ve -ve +ve +ve -ve -ve Detected
G1
C3K1S +ve +ve +ve +ve -ve -ve Not detected
C3K2S +ve +ve +ve +ve -ve -ve Not detected
G2
C3K2G
+ve +ve +ve +ve -ve -ve Not detected
C3K4A +ve +ve +ve +ve -ve -ve Not detected
G3
C3K4G
+ve +ve +ve +ve -ve -ve Not detected
C3K5S +ve +ve +ve +ve -ve -ve Not detected
C3K5G
+ve +ve +ve +ve -ve -ve Not detected
G4
C3K5A +ve +ve +ve +ve -ve -ve Not detected
G5
C3K7G
+ve +ve +ve +ve -ve -ve Not detected
C3K7G +ve +ve +ve +ve -ve -ve Not detected
G6
C3K8A +ve -ve +ve +ve +ve -ve Not Detected
C3U1G +ve -ve +ve +ve -ve +ve Not detected
G7
C3U1S +ve +ve +ve +ve -ve -ve Not detected
G8
C3U2A
+ve -ve -ve +ve -ve -ve Detected
G9
C3U2G +ve -ve +ve +ve -ve +ve Not detected
C3U3G +ve -ve +ve +ve -ve +ve Not detected
G10
C3U3A +ve -ve +ve +ve -ve +ve Not detected
99
![Page 101: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/101.jpg)
C3U4G +ve -ve +ve +ve -ve +ve Not detected
C3U4S
+ve -ve +ve +ve -ve +ve Not detected
G11
C3U4A +ve -ve +ve +ve -ve +ve Not Detected
G12
C3U5G +ve -ve +ve +ve -ve +ve Not detected
C3U6G +ve -ve +ve +ve -ve +ve Not detected
C3U6A +ve -ve +ve +ve -ve +ve Not detected
G13
C3U6S +ve -ve +ve +ve -ve +ve Not detected
C3U8G +ve -ve +ve +ve -ve +ve Not detected
C3U8S +ve -ve +ve +ve -ve -ve Detected
G14
C2K1A
+ve +ve +ve +ve -ve -ve Not detected
G15 C2K1S +ve -ve +ve +ve -ve +ve Not detected
C2U2S +ve -ve +ve +ve +ve -ve Not detected
C2U2G +ve +ve +ve +ve -ve +ve Not detected
G16
C2U2A +ve -ve +ve +ve -ve +ve Not detected
G17 C2U5A +ve -ve +ve +ve -ve -ve Detected
C2U2S +ve +ve +ve +ve +ve -ve Not detected
G18
C2U2A +ve +ve +ve +ve +ve -ve Not detected
C2U4G +ve -ve +ve +ve -ve -ve Detected G19
C2U4A +ve -ve +ve +ve -ve -ve Not detected
C2U6G +ve -ve +ve +ve -ve +ve Not detected
G20
C2U6A +ve -ve -ve +ve -ve -ve Not detected
C2U8G +ve -ve +ve -ve -ve -ve Not detected
C2U8A +ve -ve +ve +ve -ve -ve Detected
G21
C2U8S +ve -ve +ve +ve +ve -ve Not detected
G22 C2U10G +ve -ve +ve +ve -ve -ve Not detected
100
![Page 102: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/102.jpg)
C2U10S +ve +ve +ve +ve -ve -ve Not detected
C1N1A -ve +ve +ve +ve -ve -ve Not detected
C1N1S +ve +ve +ve +ve +ve -ve Not detected
G23
C1N1G +ve +ve +ve -ve -ve -ve Not detected
G24 C1N2A +ve -ve +ve +ve -ve -ve Detected
C1N2G +ve +ve +ve -ve -ve -ve Not detected
G25
C1N2S +ve +ve +ve -ve -ve -ve Not detected
C1N3A -ve +ve +ve +ve -ve -ve Not detected
G26
C1N3S +ve +ve +ve +ve -ve -ve Not detected
C1N4A +ve -ve +ve +ve -ve -ve Detected G27
C1N4G +ve +ve +ve -ve +ve -ve Not detected
C1N5A +ve +ve +ve +ve -ve -ve Not detected
G28
C1N5G +ve +ve +ve +ve -ve -ve Not detected
C1N6A(a) -ve +ve +ve +ve -ve -ve Not detected
G29
C1N6G +ve -ve +ve +ve -ve -ve Detected
C1N7S +ve +ve +ve -ve -ve -ve Not detected
G29
C1N7A +ve +ve +ve +ve -ve -ve Not detected
C1N8A +ve -ve +ve +ve -ve +ve NotDetecte
d
G30
C1N8S +ve +ve +ve +ve -ve +ve Not detected
C1N10G +ve -ve +ve +ve -ve -ve Detected G31
C1N10S +ve +ve +ve -ve -ve -ve Not detected
C1N11G +ve +ve +ve -ve +ve -ve Not detected
G32
C1N11A +ve -ve +ve +ve +ve -ve Not Detected
101
![Page 103: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/103.jpg)
C1N12S +ve +ve +ve +ve -ve -ve Not detected
G34
C1N12G +ve -ve +ve +ve -ve +ve Not Detected
G35 A2U1A
+ve +ve +ve +ve -ve +ve Not detected
G36
A2U2G +ve +ve +ve +ve -ve +ve Not detected
G37
A2U3A +ve +ve +ve +ve -ve +ve Not detected
G38
A2U4G +ve +ve +ve +ve -ve +ve Not detected
G39
A2U7A -ve +ve +ve +ve -ve +ve Not detected
G40
A2U9S +ve +ve +ve +ve -ve +ve Not detected
A2K1A +ve +ve +ve +ve -ve +ve Not detected
G41
A2K1G(b) -ve +ve +ve +ve -ve +ve Not detected
G42
A2K2S +ve +ve +ve +ve -ve +ve Not detected
A2K3A +ve -ve +ve +ve -ve -ve Detected G43
A2K3S +ve +ve +ve +ve +ve -ve Not
detected G44 A2K4S +ve -ve +ve +ve +ve +ve Not
detected
A2K5G +ve +ve -ve +ve +ve +ve Not detected
G45
A2K5A +ve +ve +ve +ve +ve -ve Not
Detected
G46
A2K8A +ve -ve +ve +ve -ve -ve Detected
G47
A2K9A +ve -ve +ve +ve +ve -ve
Not detected
G48
A1U2S -ve +ve -ve +ve +ve +ve Not detected
G49
A1U3G +ve +ve -ve +ve +ve +ve Not detected
G50
A1U4A +ve +ve -ve +ve +ve +ve Not detected
102
![Page 104: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/104.jpg)
A1U4S +ve +ve -ve +ve +ve +ve Not detected
A1U8S +ve +ve -ve +ve +ve +ve Not detected
G51 A1U8G +ve +ve -ve +ve +ve +ve Not
detected
G52
A1K4S +ve +ve -ve +ve +ve +ve Not detected
A1K6G(a) -ve +ve -ve +ve +ve +ve Not detected
A1K6G +ve +ve -ve +ve +ve +ve Not detected
G53
G57 A1K9G +ve +ve -ve +ve +ve +ve Not
detected
G58
A3K1A +ve +ve -ve +ve +ve +ve Not detected
G59
A3K2A +ve +ve -ve +ve +ve +ve Not detected
G60
A3K8A -ve +ve -ve +ve +ve +ve Not detected
A3K9A +ve -ve +ve +ve -ve -ve Detected
G61 A3K9G -ve +ve -ve +ve +ve +ve Not
detected
A3K10A -ve +ve -ve +ve +ve +ve Not detected
G62 A3K10G -ve +ve -ve +ve +ve +ve Not
detected
A3U4A -ve +ve -ve +ve +ve +ve Not detected
G63 A3U4A -ve +ve -ve +ve +ve +ve Not
detected
G64 A3U7A -ve +ve -ve +ve +ve +ve Not detected
G65 A3U9A -ve +ve -ve +ve +ve +ve Not detected
G66 BB1U1G +ve +ve +ve +ve -ve -ve Not detected
BB1U2G +ve -ve +ve +ve -ve -ve Not detected
103
![Page 105: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/105.jpg)
BB1U2A +ve +ve +ve +ve -ve -ve Not detected
G67
BB1U2G +ve +ve +ve +ve -ve -ve Not detected
G68
BB1U3A +ve +ve +ve +ve -ve +ve Not detected
G69
BB1U5A +ve -ve +ve +ve -ve +ve Not Detected
G70
BB1U5G +ve +ve +ve -ve -ve -ve Not detected
G71
BB1U5S +ve +ve +ve +ve -ve -ve Not detected
BB1U6S +ve +ve +ve +ve -ve -ve Not detected
G72 BB1U6S +ve +ve +ve +ve -ve -ve Not
detected
G73
BB1U7S +ve +ve +ve +ve -ve +ve Not detected
G74
BB1U8A +ve +ve +ve +ve -ve +ve Not detected
G75
BB1U9G +ve +ve +ve +ve -ve +ve Not detected
BB1U10S +ve -ve +ve +ve -ve +ve Not detected
G76 BB1U10A +ve -ve +ve +ve -ve -ve Not
detected
G77
BB1U12G +ve +ve +ve -ve -ve -ve Not detected
G78
BB1U13A +ve +ve +ve -ve -ve -ve Not detected
G79
BB1U14G +ve -ve +ve +ve -ve +ve Not detected
G80
BB1U15A +ve +ve +ve -ve -ve -ve Not detected
G81
BB1K1G +ve +ve +ve -ve -ve -ve Not detected
BB1K2S +ve +ve +ve -ve -ve -ve Not detected
G82 BB1K2G +ve -ve +ve +ve -ve -ve Detected
104
![Page 106: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/106.jpg)
G83
BB1K4G +ve +ve +ve +ve -ve -ve Not detected
G84
BB1K5G +ve +ve +ve +ve -ve +ve Not detected
G85
BB1K5A +ve -ve +ve +ve -ve -ve Detected
BB1K6S +ve +ve +ve +ve -ve -ve Not detected
BB1K6A +ve +ve +ve +ve -ve +ve Not detected
G86
BB1K6G +ve +ve +ve +ve -ve -ve Not detected
BB3U1A +ve -ve +ve +ve -ve -ve Detected
G87 BB3U1G +ve +ve +ve +ve -ve -ve Not detected
BB3U2G +ve +ve +ve +ve -ve -ve Not detected
BB3U2A +ve +ve +ve +ve -ve -ve Not detected
G88
BB3U2S +ve +ve +ve +ve -ve -ve Not detected
G89
BB3U3G +ve +ve +ve +ve -ve -ve Not detected
BB3U4A +ve +ve +ve +ve +ve +ve Not detected
BB3U4S +ve +ve +ve +ve -ve +ve Not detected
G90
BB3U4G +ve +ve +ve +ve -ve +ve Not detected
G91
BB3U5G +ve +ve +ve +ve -ve -ve Not detected
BB3U5A +ve +ve +ve +ve -ve +ve Not detected
G92
BB3U7G +ve +ve +ve +ve -ve +ve Not detected
BB3U8G -ve +ve +ve +ve -ve -ve Not detected
BB3U8S +ve -ve +ve +ve -ve +ve Not detected
G93
BB3U8A +ve +ve +ve +ve -ve +ve Not detected
105
![Page 107: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/107.jpg)
G94
BB3U9S +ve +ve +ve +ve -ve +ve Not detected
BB3K1A -ve +ve +ve +ve -ve +ve Not detected
G95
BB3K1S -ve +ve +ve +ve -ve +ve Not detected
BB3K2G +ve +ve +ve +ve -ve +ve Not detected
BB3K2S +ve +ve +ve +ve -ve +ve Not detected
G96
BB3K2A +ve -ve +ve +ve -ve -ve Not detected
BB3K3A +ve -ve +ve +ve -ve -ve Detected G97
BB3K3G +ve -ve +ve +ve -ve +ve Not Detected
G98
BB3K4A +ve +ve +ve +ve -ve +ve Not detected
G99
BB3K6A +ve +ve +ve +ve -ve +ve Not detected
BB3K1A +ve +ve +ve +ve -ve +ve Not detected
G100
BB2K1S +ve +ve +ve +ve -ve +ve Not detected
G101 BB2K1G +ve -ve +ve +ve +ve +ve Not detected
BB2K2S +ve +ve +ve +ve -ve -ve Not detected
G102 BB2K2A +ve -ve +ve +ve -ve -ve Detected
BB2K3S +ve -ve +ve +ve -ve +ve Not detected
BB2K3G +ve -ve +ve +ve -ve +ve Not detected
G103
BB2K3A +ve +ve +ve +ve -ve +ve Not detected
BB2K4S +ve -ve +ve +ve -ve +ve Not detected
G104 BB2K4A +ve -ve +ve +ve -ve +ve Not
Detected
G105
BB2K5A +ve -ve +ve +ve -ve -ve Detected
106
![Page 108: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/108.jpg)
G106
BB2K6G +ve -ve +ve +ve -ve +ve Not detected
G107
BB2K7G +ve +ve +ve +ve -ve +ve Not detected
BB2K7A +ve +ve +ve +ve -ve +ve Not detected
BB2K8S +ve +ve +ve +ve -ve +ve Not detected
G108 BB2K8G +ve +ve +ve +ve -ve +ve Not
detected
G109
BB2K8A +ve -ve +ve +ve -ve -ve Detected
G110
BB2K9A +ve +ve +ve +ve -ve +ve Not detected
G111
BB2U1S +ve +ve +ve +ve -ve +ve Not detected
G112
BB2U2S +ve +ve +ve +ve -ve +ve Not detected
G113
BB2U3S +ve +ve +ve +ve -ve +ve Not detected
BB2U6A +ve +ve +ve +ve -ve +ve Not detected
G114 BB2U6G +ve +ve +ve +ve -ve +ve Not
detected
BB2U7G +ve +ve +ve -ve -ve -ve Not detected
G115 BB2U7A +ve +ve +ve +ve -ve +ve Not
detected
G116
BB2U8A +ve +ve +ve +ve -ve +ve Not detected
G117
BB2U9G +ve +ve +ve +ve -ve +ve Not detected
BB2U10A +ve -ve +ve +ve -ve -ve Not detected
G118 BB2U10S +ve -ve +ve +ve -ve +ve Not
detected
G119
BB2U12G +ve +ve +ve +ve -ve +ve Not detected
G120
BB2U13A +ve +ve +ve +ve -ve +ve Not detected
107
![Page 109: CHAPTER 1: INTRODUCTION AND LITERATURE REVIEWdigilib.library.usp.ac.fj/gsdl/collect/usplibr1/index/assoc/HASHd439... · I hereby declare that this thesis is a report of research work](https://reader035.vdocuments.us/reader035/viewer/2022071016/5fcead3ebdbf40048a6baece/html5/thumbnails/109.jpg)
BB2U13G +ve +ve +ve +ve -ve +ve Not detected
BB2U13A +ve +ve +ve +ve -ve -ve Not detected
G121
BB2U13S +ve +ve +ve +ve -ve +ve Not detected
G122
BB2U14G +ve +ve +ve +ve -ve +ve Not detected
V. parahaemolyticus Reference culture
+ve -ve +ve +ve -ve -ve
108