chapter 1: introduction and literature...

THE UNIVERSITY OF THE SOUTH PACIFIC LIBRARY

Author Statement of Accessibility- Part 2- Permission for Internet Access

IUameofCandidate : REFMA 1 51Q6,H

Degree : MASTER OF SLIE~,CE

DepartmenVSchool : PI v I ~ I O ~ OF BIOLOGICAL S L 16 d.ICO, FALU 1.T-j OF SCI ENG ~ T G L H N O C O ~ \ (

Institution/University : U I V EP3 I J J D f i H E SO U Tli PAC. l F C

Thesis Title : PRNALEIJLE 07 PATI-IO~ENIL McTFPA IE) ?%Id SoLb AT Y/t PIOUS , . / , , , , . A r - v u I L E l 3 I W b Y V A ,

Date of completion of . L 1- - - A -

requirements for award : P I U ~ t~ &LK, 2 u u t - 1

1. I authorise the University to make this thesis available on the Internet for access by USP authorised users.

/

L. I ~ U L I IVI 13c LI IC VI IIVCI 3 1 ~ y LV 111akc LI 1 1 3 LI 1 ~ 3 1 3 a v a ~ ~ a u ~ c VI I LI IC 11 ILCI I ICL UI IUCI

the International digital theses project

Signed: v

Date: ~ 9 ' ' IJo~tm~t'n; 2007 -

Contact Address Permanent Address

PREVALENCE OF PATHOGENIC BACTERIA IN

FISH SOLD AT VARIOUS OUTLETS IN SUVA, FIJI

A thesis presented to the University of the South Pacific

as a partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

by

Reema Reshmi Singh

Division of Biological Sciences

School of Biological, Chemical and Environmental Sciences

Faculty of Science and Technology

University of the South Pacific

Fiji Islands

This thesis is dedicated with kind gratitude to my husband, Ravin Lal

for his love, care, support and providing encouragement and motivation

throughout this research

&

to my dad, Mr. Pardeep Singh & mum, Mrs. Anita Singh for their love, support and blessings

2

AUTHOR’S DECLARATION I hereby declare that this thesis is a report of research work carried out by me

and has not been submitted in any form for another degree or diploma at any other

University to the best of my knowledge. Information obtained from the published work of

others and assistance received has been acknowledged elsewhere.

Candidate: Reema Reshmi Singh

Supervisor: Dr. Dhana Rao

Date Submitted: 27th July, 2007

3

ACKNOWLEDGEMENT

I would like to express my appreciation to the Faculty Research Committee of the

Faculty of Science and Technology, USP, for funding the current research and for

approval of my study for Masters degree research.

I would like to express my sincere gratitude and heartfelt thanks to my principal

supervisor, Dr. Dhana Rao, Lecturer in Microbiology, Faculty of Science and

Technology, USP, for her assistance, constant support, guidance and encouragement

during the due course of this research.

I would like to extend my appreciation to my co-supervisor, Professor William

Aalbersberg, Director of the Institute of Applied Sciences, USP, for his helpful support

and guidance during this research.

My appreciation is also extended to Professor Peter Lockhart, Principal and

Associate Investigator and Trish McLenachan, Laboratory Manager at the Allan Wilson

Center for Molecular Ecology and Evolution at Massey University in Palmerston North,

New Zealand for helping me with the Polymerase Chain Reaction (PCR) analysis and

molecular sequencing of the DNA products.

I also wish to thank Dr. Abdulla Mohammad Hatha, former Lecturer in

Microbiology, USP, and my supervisor in post-graduate studies for teaching me the

techniques in the isolation of Vibrio species from fish.

4

My appreciation and heartfelt thanks is also extended to Professor Linton

Winder, Associate Dean in Research and Consultancy, USP, for assisting me with

statistical analysis.

I wish to thank Ms. Reena Sagar, Accounts Clerk and Sesenieli Gukivuli, Senior

Technician at Institute of Applied Sciences for ordering the chemicals, solvents and

media for my research.

I would like to thank Mr. Klaus Feussner, Assistant Project Manager at the

Marine Natural Products Unit of the Institute of Applied Sciences for his assistance in

DNA extraction procedures and assisting me in obtaining permits for sending the DNA

extracts to New Zealand.

I would like to extend my appreciation to Ms. Anjila Nand of the Microbiology Unit

and Mr. Philip Gabriel of the Food Unit at the Institute of Applied Sciences, USP for

assisting me in various ways.

I also wish to thank Mr. Dinesh Kumar, Senior Technician, Ms. Babita Narayan,

Mr. Shiva and Ms. Parneeta, Technicians at the Division of Biology, for their assistance

in outlining the various techniques in DNA extraction and also providing equipment and

materials for sample collection.

I would finally like to extend my sincere appreciation and gratitude to my parents

for their endless encouragement, motivation, support and blessings provided to me

during this research.

5

ABSTRACT

In Fiji, fish are harvested for subsistence consumption within the domestic

household and also for small-scale retail sales. Microbial contaminants in fish are

suspected to be high but the incidences in fish sold at various commercial outlets in Fiji

are unknown.

The present study investigated the presence of Escherichia coli, Vibrio

parahaemolyticus and Vibrio cholerae in fish samples sold at various outlets in Suva.

These outlets included roadside stalls (Vatuwaqa Bridge, Bailey Bridge and Raiwaqa

roadside), local markets (Suva, Lami and Laqere Market) and fish shops (Fresh ’et,

Food Processors and Cakaudrove Fish). Standard microbial analysis techniques were

adopted for detecting E. coli in the gills, gut and on the skin surface of fish samples

obtained from these outlets. The presence of V. parahaemolyticus and V. cholerae was

identified by biochemical tests (Oxidase, Salt tolerance [0, 6, 8% NaCl] and

Carbohydrate fermentation [Lactose and Sucrose]) and were further confirmed by

molecular identification.

Results indicated that there was no significant difference in the occurrence of E.

coli within the different regions of fish and between the different sources (P<0.05),

although the data indicated that microbial contamination caused by E. coli in fish was

high. There was a significant difference in the occurrence of V. parahaemolyticus in fish

obtained from different outlets (P>0.05) and significant difference of contamination by

this pathogen were found within the regions. The roadside stalls showed a high

occurrence of V. parahaemolyticus compared to the local markets and fish shops

suggesting that fish exposed to ambient temperatures could be the reason for high

6

occurrence of V. parahaemolyticus. Incidence of E. coli and V. parahaemolyticus were

also detected in fish sold in fish shops, as it was observed that proper removal of gut

and gills was not practiced. V. cholerae was not detected in any of the fish samples

analyzed from all the outlets.

Inadequate fish storage facilities, limited use of ice to keep the fish cool and

improper, unhygienic handling of fish could be considered as some of the factors

contributing to the occurrence of these pathogens. Creating more awareness among the

fisher folk and fish vendors regarding the proper and hygienic handling of fish, proper

storage facilities for fish and the use of good quality ice could help rectify and improve

the situation.

7

TABLE OF CONTENTS Dedication………………………………………………………………………………………..2 Author’s Declaration…………………………………………………………...……..............3 Acknowledgements…………………………………………………………………..….........4 Abstract………………………………………………………………………….……..............6 Table of Contents……………………………………………………………….……….........8 List of Figures……………………………………………………………………….…….…..10 List of tables………………………………………………………………………….………..12 CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW…………..……..13 1.1. Microbial contamination……………………………………………………..…….......13

1.2. Common routes of entry of microorganisms………………………………...……15

1.3. Nutritional Benefits of fish………………………………………………………..……15

1.4. Fish as carriers of foodborne diseases………………………………………..…….16

1.5. Microbial contamination in fish gills, gut and skin…………………………..……16

1.6. Factors affecting microbial growth in fish……………………………………..…...19

1.7. Vibrio contamination in fish………………..………………………………………….20

1.8. Common Vibrio species of concern…………………………………………….…....21

1.9. Vibrio cholerae……………………………………………………………………….…..22

1.10. Vibrio parahaemolyticus…………………………………………….………………..23

1.11. Escherichia coli……………………………………………………………….………..25

1. 12. Sources of V. cholerae, V. parahaemolyticus and E. coli in fish……….……26

1.13. Fish sales in the local economy……………………………………………………..29

1.14. Common outlets for procuring fish……………………………………………..…..30

1.15. Aims and Objectives…………………………………………………………………..32

8

CHAPTER 2: METHODOLOGY…………………………………………………….33

2.1. Description of study area……………………………………………………………....33

2.2. Collection and transportation of samples…………………………………………..35

2.3. Preparation for analysis……………………………………….……………………….37

2.4. Quality control……………………………………………………..……………………..37

2.5. Bacteriological Analysis………………………………………………………………..38

2.6. Identification- Biochemical tests…………………………………………………..….40 2.7. Confirmation tests……………...…………………………………………….…………42

2.8. Qualitative testing for Escherichia coli………………………………………………45

2.9. Confirmation tests………………………………………………………………………46

2.10. Statistical analysis……………………………………………………………………..49

CHAPTER 3: RESULTS…………………………………………………………………...50

3.1. Biochemical tests for identification of Vibrio cholerae…………..……………….50

3.2. Biochemical tests for Vibrio parahaemolyticus……………………..……………..50

3.3. Escherichia coli…………………………………………………………………………..54

3.4. Vibrio parahaemolyticus………………………………………………………………..54

3.5. E. coli at different regions…………………………………………………………...…58

3.6. Vibrio parahaemolyticus at different regions………………………………………58

CHAPTER 4: DISCUSSION……………………………………………………….…59

4.1. Escherichia coli………………………………………….……………………………….59

4.2. V. parahaemolyticus…………………………………………………………………….60

4.3. Occurrence of V. parahaemolyticus at different regions…………………………61

4.4. Vibrio cholerae……………………………….……………………………………….….62

CHAPTER 5: CONCLUSION AND RECOMMENDATIONS……………………….64

9

5.1. Future work………………………………..………………………………………….…..65

REFERENCES………………………………………………………………………………..66

LIST OF FIGURES

Figure 1: Map showing the sampling sites within and around Suva…………………..…34

Figure 2: White-lined Rock cod (Anyperodon leucogrammicus, Local name: Kawakawa)………………..…..36 Figure 3: Bicolour Parrot fish

(Cestoscarus bicolour, Local name: Ulavi)…………………………………....…36

Figure 4: Spinefoot Rabbit fish (Siganus vermiculatus, Local name: Nuqa)………………………………..…....36 Figure 5: Photographs showing swabbing of different regions of the fish

(a) gill area, (b) skin surface, (c) gut area……………………………………….38

Figure 6: Pictures showing typical colonies of (a) V. cholerae-like colonies and

(b) V. parahaemolyticus-like colonies on TCBS agar………………………….39

Figure 7: Picture showing growth on TSA (2% NaCl)….................................................40 Figure 8: Pictures showing preliminary biochemical tests of:

(a) Vibrio parahaemolyticus, (b) Vibrio cholerae,

10

(c) A positive oxidase test………..…………………………..……….…………...41

Figure 9: Picture showing growth of typical colonies (green metallic sheen)

of E.coli on EMBA agar………………………………………………………..…46

Figure 10: Pictures showing IMVic results for confirmation of E.coli..............................48 Figure 11: Graph showing occurrence of pathogens in fish (positive at one

of the three regions in fish) obtained from various sources……………...…..54 Figure 12: Graph showing occurrence of pathogens at different regions of fish bought from roadside stalls…………………………….………………..55

Figure 13: Graph showing occurrence of pathogens at different regions of fish bought from fish shops…………………….…………………………….55 Figure 14: Graph showing occurrence of pathogens at different regions of fish bought from local markets……………….………………………………56

Figure 15: Graph showing percentage incidence of pathogens at different regions from fish shops………………………………………………………..………….56 Figure 16: Graph showing percentage incidence of pathogens at different regions from local markets……….……………………………………………………….57 Figure 17: Graph showing percentage incidence of pathogens at different regions from roadside stalls………………………….…………………………………...58

11

LIST OF TABLES

Table 1: Molecular confirmation V. parahaemolyticus cultures………………..………....51 Table 2: Percentage incidence of pathogens at different body regions of fish collected from various sources……………………..….……...…53

APPENDICES……………………………………………………………………..…86

Appendix 1: Biochemical tests for identification of Vibrio cholerae…………………..…..87 Appendix 2: Biochemical tests for identification of Vibrio parahaemolyticus...................99

12

CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW

People consumed seafood long before they started cultivating plants or

domesticating animals for food. Excavation of Stone Age sites have uncovered fish nets,

spears and fishing hooks made from upper beaks of birds. At present there are over

20,000 known species of edible fish, shellfish and sea mammals (Brown, In press) but

seafood has a long association with the transmission of diseases. Regulations governing

food hygiene can be found in numerous early sources such as the Old Testament, and

the writings of Confucius, in Hinduism and in Islam. Such early writers had at best only a

vague conception of the true causes of foodborne illnesses and many of their

prescriptions probably had a slight effect on their incidences. Even today, despite our

increased knowledge, foodborne diseases are perhaps the most widespread health

problem and an important cause of reduced economic production. The available

evidence clearly indicates that microbial contaminants are one of the major causes of

foodborne illnesses (Adams and Moss, 2000).

1.1. Microbial contamination

Microbial contamination is caused by microorganisms known as bacteria (Adams

and Moss, 2000). Bacteria are found almost everywhere in the environment including

soil, water, plants, animals and humans (Baird-Parker, 2000). The main carriers of

bacteria are the foods that we consume which are rarely sterile (Adams and Moss,

2000). Food carries microbial associations whose composition depends on the

organisms’ access to food, their ability to grow and the interaction in the foods as time

progresses (Adams and Moss, 2000). Moreover, the exact origin of bacterial

contamination in food depends on the natural microflora of the raw material and those

13

organisms introduced in the course of harvesting, slaughter, processing, storage

conditions and the distribution of food (Adams and Moss, 2000). Microbial contamination

cause infections that are responsible for various food borne illnesses and diseases

(Collins et al., 1989). In uncontrolled conditions, these infections could cause major

foodborne disease outbreaks in a community or population. Espejo-Hermes (1998) has

identified that infections caused by these microbes are more pronounced in developing

countries, where there are improper practices in handling, storage, processing and

distribution of food and food products.

1.1.1. Microbial contamination in the seafood industry

Seafood is a highly perishable food commodity and one of the major causes of

fish spoilage is by microbial contamination (Sumner and Ross, 2002). There are two

groups of bacteria that are of public health importance in the seafood industry. These

are: (1) Those initially present in the seafood or (2) those that are introduced in the

seafood by improper handling and storage conditions (Ripabelli et al., 2004; Scoglio et

al., 2000; www.cfskan.fda.gov).

Previous researchers have indicated that microbial contaminations in seafood

are mostly due to improper storage and handling practises (Reilly and Kaferstein, 1997;

Feldhusen, 2000; Ripabelli et al., 2004; Scoglio et al., 2000; Ananthalakshmy et al.,

1990). Their study have found that microorganisms such as Vibrio parahaemolyticus,

Vibrio cholerae, Vibrio vulnificus, Aeromonas hydrophyla, Clostridium botulium, Listeria

monocytogenes, Enterobacteriaceae such as Salmonella, Shigella and Escherichia coli

are common contaminants in fish. Other species of Vibrios such as Vibrio alginolyticus

and Vibrio fluvalis are also introduced in seafood due to improper handling and storage

14

http://www.cfskan.fda.gov/

techniques (Zlotkin et al., 1998; Lipp and Rose, 1997; Chattopadhyay, 2000; Ripabelli et

al., 2004; Bhaskar and Sachindra, 2006). The improper practices during handling,

storage and processing of seafood cause pathogens to multiply exponentially under

favourable conditions resulting in seafood infections (Lipp and Rose, 1997; Zlotkin et al.,

1998; Chattopadhyay, 2000; Notermans and Hoornstra 2000; Arijo et al., 2005; Al-Harbi

and Uddin, 2005). These microbial agents in seafood may result in a serious threat to

the seafood industry with a high risk of causing illness and disease.

1.2. Common routes of entry of microorganisms

Contamination of seafood by these pathogens is also a contributing factor

towards human morbidity (Ripabelli et al., 2004). These bacteria gain access to the

human body by direct contact with infected fish during improper handling, or being in

contact with other constituents of the fish environment (Alinovi et al., 1993; Acha and

Szyfres, 2003). Individuals can be infected by fish bites and fish fins which contribute to

microbial contaminants gaining entry (Darie et al., 1993; Said et al., 1998; Seiberras et

al., 2000; Novotny et al., 2004).

1.3. Nutritional Benefits of fish

In the last two decades there has been an increased awareness of the nutritional

and health benefits of fish consumption (Din et al., 2004). Fish and other seafood are

excellent sources of proteins, vitamins, minerals and most of them are low in fat. Fish

also provides a very good balance of nutrients, rich in Vitamin A and B complex and

minerals (Robert and Stadler, 2000 - Internet). Proteins from seafood are of high quality

15

and are easily digested, also Vitamin A helps to protect the body from disease, and is

important for proper growth, healthy eyes and skin (Chamberlain and Titili, 2001).

The low fat content of fish and the presence of polyunsaturated fatty acids in

some red meat of fishes are known to reduce the risks of coronary heart disease and

this has increased the dietary and health significance of seafood consumption (Robert

and Stadler, 2000 -Internet; Din et al., 2004). Fish and fishery products therefore

constitute an important food component for a large section of the world population,

especially in developing countries, where fish forms a cheap source of protein (Robert

and Stadler, 2000 - Internet).

1.4. Fish as carriers of foodborne diseases

Fish are also known to be responsible for a significant percentage of foodborne

diseases worldwide (Connell, 1995; Croci and Suffredini, 2003). It has been reported

that in the United States, 10-19% of foodborne illnesses involved consumption of fish

and seafood, whereas in Japan 70% of foodborne illnesses have been attributed to

consumption of raw fish (FAO/ WHO, 2001-Internet). The true incidence of seafood-

borne diseases worldwide is still unknown, as there is no surveillance system in the

developing countries (Karunasagar et al., 2005). With the given data, the importance of

seafood as a vehicle for human illnesses has been highlighted.

1.5. Microbial contamination in fish gills, gut and skin

The gills, skin surface and gut of fish provide the first point of contact in microbial

contamination (Chamberlain and Titili, 2001; Nickelson et al., 2001). Millions of bacteria

are found on the skin surface, on the gills and in the gut of living fish (Huss and Gram,

16

2004). It is suggested that microbial contaminants found in these three regions are

usually present in the fish at the time of capture (Huss, 1994). The gills, gut and the skin

regions of a dead fish are dominated by pathogens such as E. coli, Vibrio species,

Listeria species and Staphylococcus aureus (El- Shafai et al., 2004; Cho et al., 2004;

Thompson et al., 2004).

Adams and Moss (2000) revealed that microbial contamination in fish is mostly

caused by bacteria that have the ability to proliferate in sub-environments provided by

the skin surfaces, gills and alimentary canals. They found that Gram-negative bacteria

such as Pseudomonas, Shewanella, Psychrobacter, Vibrios, Flavobacterium and

Cytophaga were mostly present in the gills, gut and skin surface of the fish.

1.5.1. Fish gills

Fish gills are used for respiration, however they also provide an easy access to

bacteria and harbour a variety of microorganisms (Robert and Stadler, 2000- Internet).

The gills consist of threadlike structures called filaments (Jobling, 1995). Each filament

contains a network of capillaries that allow a large surface area for exchange of gases

(Jobling, 1995). Fish respire by pulling oxygen rich waters through their mouths and

pumping it over the gill filaments. Various microorganisms enter along with water.

Furthermore, when these microbes are provided with favourable conditions for growth,

they get established on the gills.

1.5.2. Fish skin surface

The skin surface is a good source of microbial contamination for investigation

since it is in direct contact with the environment. The flesh of the fish is an excellent

17

substrate for growth of a wide range of microorganisms (FOSRI, 1997 - Internet).

However, studies have indicated that the subsurface of live fish is bacteriologically

sterile, as the immune system prevents bacteria from growing in the flesh. Bacteria gain

entry only when the fish dies and proliferate freely (Nickelson et al., 2001; Huss and

Gram, 2004). Recent findings have also demonstrated that a high incidence of bacterial

microflora dominated by Vibrios was detected on fish skin (Snoussi et al., 2006; Montes

et al., 2006). Furthermore, Adams and Moss (2000) have reported that the numbers of

microorganisms on fish skin ranged from 102-107 colony forming units (c.f.u.)/cm²

suggesting that skin surfaces carry a substantial number of bacteria.

1.5.3. Fish gut

Food is usually present in the gut of the fish when caught and it may carry

microbial contaminants. Also powerful digestive enzymes of the digestive tract

occasionally leak and penetrate the flesh of the dead fish. The leaked enzymes

contribute to the breakdown of protein in the flesh and favours microbial growth resulting

in the deterioration of fish stocks. Huss and Gram (2004) have shown that these

digestive enzymes have the ability to penetrate the flesh of frozen fish. This further

proves that bacteria are able to establish themselves on the outer and inner surface of

the live fish (skin and the gills) and have the ability to gain entry again into the inner

parts of the fish such as in the gut. The occurrence of bacteria on fish gills and the gut

ranges from 103-109 c.f.u./g, suggesting that even though internal organs of freshly

caught fish are usually free from contaminants, all fish could be carrying some levels of

bacteria (Adams and Moss, 2000).

Microorganisms such as Bacillus, Micrococcus and Corynebacterium,

Psychrobacter, Moraxella, Pseudomonas, Actinobacter, Shewanella, Flavobacterium,

18

Cytophaga and Vibrios usually dominate the gills, gut and the skin surface of fish and

the incidence of these microbial agents in fish are vastly affected by the geographical

location (temperate and cold waters) (Hoi et al., 1998; Gram and Huss, 2000; Wang and

Leung, 2000; Yano et al., 2004).

1.6. Factors affecting microbial growth in fish

1.6.1. Geographical location (origin and quantity)

The number and variety of microorganisms in fish are determined by the food

origin, quantity and quality (Nickelson et al., 2001). It is anticipated that fish which

consume more food (heavy feeders) have a higher level of bacteria as compared to non-

heavy feeders. The geographical location of the catch, the season, method of harvest,

handling and storage are some of the factors contributing to fish deterioration (Nickelson

et al., 2001; Novotny et al., 2004).

1.6.2. Improper handling

Fish can be further contaminated by handling onboard, at the docks and at

markets after landing, particularly where they are exposed for sale and are subjected to

contamination with human pathogens by birds and flies (Adams and Moss, 2000).

Studies carried out by Harwood et al. (2004) have demonstrated that microbial

contamination in fish was mainly caused by lack of sanitary procedures in handling fish

during transit from the sea to the market and also during the sale of fish. In addition,

findings have also demonstrated that the initial microflora on the surface of fish is directly

related to the water environment, while the microflora in the gastrointestinal tract

corresponds to the type of food and condition of the fish (FOSRI, 1997- Internet).

19

1.6.3. Improper storage conditions

After capture, fish are commonly stored in ice or refrigerated sea water before

they are transported to land (Adams and Moss, 2000). Hence, it is important that a clean

cooling agent is used, as re-use of ice and other cooling agents will lead to a rapid build-

up of microorganisms and accelerated spoilage of the stored fish (Adams and Moss,

2000).

1.6.4. Time and temperature

Other factors responsible for elevated bacterial contamination in fish include

temperature and time. Temperature and time control are two important factors that need

to be considered when fish are stored and handled as they are responsible for

multiplication of microorganisms (Whipple and Rohovec, 1994). The true storage

temperature is not only the final market box temperature, but the temperature history of

the product (Huss et al., 2004). Ambient temperature during harvest, the delay in

refrigerated storage and fluctuation in temperature during storage are three factors that

determine the presence of initial spoilage microflora in fish (Nair et al., 2007). Recent

findings by Paz et al. (2007) have shown that at ambient temperature the microflora at

the point of spoilage is dominated by mesophilic Vibrionaceae.

1.7. Vibrio contamination in fish

Vibrio species belong to the Vibrionaceae family where most of the species

require sodium chloride (2-3%) to grow (Thompson et al., 2005). Vibrios are mostly

mesophilic and their numbers tend to increase during the warmer months (Chan et al.,

1989; Kodama et al., 1991; Alam et al., 2001). They are typical of marine and estuarine

20

environment and are associated with a great variety of fish and seafood (Asenjo and

Ramirez-Ronda, 1991; Hervio-Health et al., 2002; Reidl and Klose, 2002). This is

because the microflora of marine fish is predominantly halotolerant, i.e. it has the ability

to grow in a wide range of salt concentrations (FOSRI, 1997- Internet; Adams and Moss,

2000).

There are about 34 species of Vibrios of which 13 can cause human diseases,

including wound infections, gastroenteritis and also septicaemia (Asenjo and Ramirez-

Ronda, 1991; Powell, 1999; Kaysner, 2000; FAO/ WHO, 2001). Studies conducted in

countries like China (Yano et al., 2004), Malaysia (Elhadi et al., 2004), Hong Kong (Chan

et al., 1989), India (Ananthalakshmy et al., 1990), Brazil (Ayulo et al., 1994) and U.S.A

(Lipp and Rose, 1997) have indicated the occurrence and contamination of fish by

various types of bacteria of which the most common pathogens isolated were Vibrio

species.

1.8. Common Vibrio species of concern

The genus Vibrio now includes a large number of species and clear evidence is

available for the etiological role of Vibrio cholerae, Vibrio vulnificus and Vibrio

parahaemolyticus in foodborne disease (Donovon and Netten, 2000). It has been further

substantiated that these three pathogens are known to be some of the well known

documented pathogens (Scoging, 1992; Hocking et al., 1997; Oliver and Kaper, 1997;

Hoi et al., 1998; Moreno and Landgraf, 1998; Donovan and Netten, 2000; DePaola et

al., 2001; Kaysner and DePaola, 2000; Hervio-Heath et al., 2002).

21

1.9. Vibrio cholerae

1.9.1. Distribution and occurrence

Vibrio cholerae is the etiological agent of cholera, one of few foodborne diseases

with epidemic and pandemic potentials (Mintz et al., 1994; Colwell, 1996). V. cholerae is

a mesophilic organism that grows in the temperature range of 10 - 43ºC with optimum

growth at 37ºC (Kaynser, 2000).

Although it is a pathogen infecting the human population, researchers have

confirmed that aquatic ecosystems are the major habitat of Vibrio species including both

pathogenic and non-pathogenic strains (Faruque and Nair, 2002). Investigations on the

occurrence of V. cholerae in fresh and marine waters have been carried out by

Chowdhury et al. (1992), where their study revealed that 12% of water samples from the

environment was contaminated with toxigenic V. cholerae. This bacterium not only has

the ability to thrive in marine waters, but also has the ability to grow in rivers as well. This

is further confirmed in investigations carried out by Yamai et al. (1996) whose findings

showed V. cholerae O1 and non-O1 in 3.6% and 61.1% water samples derived from

river indicating a possible source of contamination.

The prevalence of this pathogen is also high in fish (Shiraishi et al., 1996; Saha

et al., 1999; Montes et al., 2006). Since the gills, gut and the skin are the common entry

points of pathogenic bacteria, studies carried out by Saha et al. (1999) have found

pathogenic strains of V. cholerae (O1 and O139 serotypes) on these regions. However,

their study proved that the occurrence of these microorganisms on different regions of

22

fish had less chance of contamination by toxigenic and disease producing strains of V.

cholerae.

1.9.2. Infections and diseases

Symptoms of cholera infections include sudden onset of profuse painless watery

diarrhoea, accompanied by nausea and vomiting (Gyobu et al., 1984; Faruque and Nair,

2002; Reidl and Klose, 2002). Studies carried out by Hocking et al. (1997) have found

that carriage of V. cholerae by infected humans has a contributing factor in the

transmission of this disease. Recent laboratory findings have also found that V. cholerae

O1 and Inaba El Tor strains are responsible for gastrointestinal tract infections (Hartley

et al., 2006).

1.10. Vibrio parahaemolyticus


Another pathogen of concern is Vibrio parahaemolyticus. It was first isolated in

Japan in early 1950s following food poisoning outbreaks (Chiou et al., 1991; Novotny et

al., 2004; Deepanjali et al., 2005). It has now become one of the most prevalent

foodborne pathogens in many Asian countries where seafood is consumed in a variety

of ways, including raw seafood (Oliver and Kaper, 1997; Marshall et al., 1999).

V. parahaemolyticus is a naturally occurring marine bacterium found worldwide in

estuarine and marine areas and despite its halophilic nature, it has also been isolated

from saline free waters and is often associated with food poisoning incidences relating to

seafood products (Joseph et al., 1982; Scoging, 1992; DePaloa et al., 2000; Hara-Kudo

23

et al., 2003). Both pathogenic and non-pathogenic forms of this organism can be

isolated from marine and estuarine environments and from fish and shellfish dwelling in

these environments (Daniels et al., 2000; Deepanjali et al., 2005).

This bacterium is distributed in temperate and tropical coastal waters throughout

the world and is a leading cause of foodborne pathogen causing gastroenteritis (Hara-

Kudo et al., 2003; Deepanjali et al., 2005). Outbreaks caused by this pathogen have

been reported in countries such as the United States, China (Taiwan) and Spain (Hervio-

Heath et al., 2002; Herrera et al., 2006). Moreover, in several Asian countries foodborne

poisoning outbreaks were also caused by V. parahaemolyticus (Chiou et al., 2000;

Matsumoto et al., 2000; Cabrera-Garica et al., 2004; Levin, 2006; Nair et al., 2007).


Consumption of large numbers of V. parahaemolyticus causes vibriosis or

gastroenteritis and symptoms may be severe, resulting in nausea, diarrhoea and

sometimes abdominal cramps and fever (CDC, 1999; Kagiko et al., 2001; Wong, 2003;

Laohaprertthisan et al., 2003). Extra-intestinal infections can also occur with this

bacterium (Daniels et al., 2000). Long term effects include reactive arthritis. The

incubation period from consumption to illness may range between 4 to 96 hours and

recovery may take as long as a week (Wong, 2003).

Infections and diseases caused by V. parahaemolyticus occur when this

bacterium attaches itself to the small intestine and secretes an unidentified toxin. The

disease usually runs its course in 2 - 3 days although some cases may require

hospitalization or antibiotic treatment (Nair et al., 2007). Severe disease is rare and

occurs more commonly in persons with weakened immune systems.

24

V. parahaemolyticus can also cause an infection of the skin when an open wound is

exposed to warm seawater (Nair et al., 2007). Raw or undercooked seafood including

fish will put consumers at risk (Croci and Suffredini, 2003).

1.11. Escherichia coli


Escherichia coli are common contaminants of seafood. It is one of the most

common aerobic microorganisms found in the intestinal tract of man and warm blooded

animals (www.fao.org). E. coli strains found in the intestinal tract are mostly harmless

commensals, playing an important role in maintaining intestinal physiology (Teophilo,

2002; www.fao.org). Due to its common occurrence in faeces, it is readily culturable and

survival characteristics in water led to the adaptation of E. coli as an indicator of faecal

contamination and the possible presence of enteric pathogens (Feldhusen, 2000).

E. coli was first reported to be a cause of gastroenteritis in the 1940s and until

1982, these strains have acquired the ability to cause diarrhoea indicating that this

bacterium is of microbiological concern. In some countries, waste water enriched fish

ponds are used for fish cultivation and this leads to a high occurrence of enteric

pathogens (bacteria and viruses) (Fattal et al., 1998). The high load of enteric pathogens

exhibit their pathogenicity due to their penetration and accumulation rate in the fish

tissue and constitutes a potential public health hazard, especially in countries where raw

fish is consumed (Fattal et al., 1998). E. coli including other coliforms and bacteria such

as Staphylococcus species and sometimes Enterococci, are common indices of

hazardous conditions during processing of fish (Novotny et al., 2004).

25

http://www.fao.org/

Reports have shown that contamination by E. coli in fish sold in countries such

as Taiwan (Hwang et al., 2004) and Patna in India (Kumari et al., 2001) are high. Their

study has also revealed that the high incidence of E. coli in fish were detected during the

summer seasons.


E. coli can cause a variety of different diseases which include diarrhoea,

dysentery, hemolytic uremic syndrome, bladder and kidney infections, septicaemia,

pneumonia and meningitis (Teophilo, 2002).

1. 12. Sources of V. cholerae, V. parahaemolyticus and E. coli in fish

1.12.1. Raw and inadequate cooked seafood

The common cause of cholera infections in humans is by consuming raw fish

(Kam et al., 1995; Maggi et al., 1997). Dalsgaard and his co-workers (2002) have also

identified that raw seafood were common carriers of V. cholerae and the incidence of

this pathogen was high in fish products originating from tropical areas. This has been

further substantiated by Vuddhakul et al. (2000) whose findings have suggested that

people become infected with V. parahaemolyticus primarily through consumption of raw

or uncooked seafood. These infections have been well reported in countries like Japan

(Marshall et al., 1999), Hong Kong (Chan et al., 1989), Kenya (Kagiko et al., 2001) and

India (Deepanjali et al., 2005) where outbreaks by this bacterium were mainly caused by

ingestion of raw or undercooked seafood. Earlier studies have reported that diarrhoeal

outbreaks were also caused by ingestion of raw and undercooked seafood (Joseph et

al., 1982; Mitsuda et al., 1998; Vuddhakul et al., 2000).

26

1.12.2. Faecal contamination

The emergence of two common biotypes of V. cholerae, namely O1 and El Tor

serovars, have been reported to be caused by sewage contamination (Medina, 1991).

This is consistent with reports by Colaco et al. (1998) that 86% of the contamination in

water pointed to faecal contamination as the most common source and vehicle for rapid

spread of the microorganism in the aquatic environment. Other reports have also

suggested that 66% of cholera outbreaks in Africa were caused by water source

contamination, heavy rainfall, flooding and population dislocation (Naidoo and Patrick,

2002). Earlier findings by Maggi et al. (1997) have demonstrated that seafood obtained

from lagoons contaminated with human wastes resulted in a high occurrence of cholera

cases.

Foods that are washed with water contaminated with V. cholerae can also lead to

a widespread transmission of cholera (Mintz et al., 1994). V. cholerae can become

established and extremely difficult to eradicate when seafood from enclosed bodies of

faecally contaminated water is frequently eaten raw (McIntyre et al., 1979). Therefore,

these studies have shown the central role of faecal contaminated waters as a common

vehicle for transmission of cholera.

E. coli occurs on fish products as a result of contamination from the animal/

human reservoir. Contamination is normally associated with faecal contamination or

pollution of natural waters or water environments, where these organisms may survive

for a long time or through direct contamination of products during processing (FOSRI,

1997). Studies carried out by Kumar et al. (2005) have revealed that sewage

contamination of fish harvesting areas is the major reason for the presence of E. coli, but

contamination can also occur through use of non-potable water or ice in the landing

27

centres or fish markets. Faecal matter enters aquatic bodies in the form of human or

animal faeces, storm water run-offs and from farmlands. As this faecal matter enters the

aquatic system, chances are that the fauna of the marine environment, such as fish,

could ingest or accumulate it in their system.

1.12.3. Temperature and water salinity

Warm summer temperatures and estuarine conditions (reduced ocean salinity)

are favourable for growth of V. cholerae and V. parahaemolyticus. Studies conducted by

Kodoma et al. (1991) and Daniels et al. (2000) have found that the V. cholerae count

isolated from fish during summer seasons was higher, as compared to other seasons.

Findings also showed that this bacterium has the ability to thrive in almost any aquatic

environment, provided the salinity of the water is favourable (Jiang, 2001).

Investigations carried out by Johnston and Brown (2002) found that the

occurrence of V. parahaemolyticus bacterium in seafood is not related to pollution or

sewage contamination but is directly related to temperature. This has been reflected in

studies conducted by Wong (2003) where findings have shown that this bacterium is

rarely found in water where the temperature is less than 15ºC.

E. coli is an organism whose presence is useful as an indicator of contamination

(presence in small numbers) or mishandling such as temperature abuse in product

handling (presence in large numbers). This is supported by researchers whose studies

have confirmed that contamination of fish probably occurred during handling and

production processes (Ayulo et al., 1994; Asai et al., 1999).

28

1.13. Fish sales in the local economy

Fiji is a tropical country surrounded by sea where the majority of local fisher folk

are involved in the harvesting of fish for subsistence consumption within the household.

Due to easy accessibility and cheap labour, the fishing industry has seen an increase in

fish sales and also the number of people engaged in fish sales businesses. Therefore,

fish as a common food commodity forms the livelihood of most of the local coastal

populace. The dietary lifestyles of many people are changing and many are adapting fish

as a healthy source of protein.

Fish are caught from waters in the lagoons and the reefs of the many islands in

Fiji by fisherman, and the fish vendors either buy the fish from these fishermen or go out

to the sea to catch their fish for sale. The fish industry also plays an important socio-

economic role in Fiji in terms of providing fish for the local population and for export

overseas. Common fish industries are now selling tropical fishes to other countries which

generate money for the country. In addition to this, there are also some fishing industries

which are involved in the canning of fish.

There are a variety of cooking methods involved in preparation of fish and in Fiji,

fish is mainly cooked in lolo which is a traditional soup prepared with coconut cream.

Many of the restaurants and hotels in Fiji include fish as common seafood on their

menus. Although fresh fish is a common delicacy, there are consumers who like to buy

dried and smoked fish for their domestic consumption. The food outlets of Suva in Fiji

are a common place to discover the variety of fish prepared in different ways for sale.

29

1.14. Common outlets for procuring fish

A wide variety of species, including reef fishes and deep ocean fish, can be

obtained from a number of places in Fiji. The price of fish depends on its size, weight

and species.

1.14.1. Roadside fish stalls

The city of Suva is inundated with fish vendors selling fish next to the roadsides

and this is because of its easy accessibility to the consumers. Furthermore, it is a cheap

mode of reaching to the consumers compared to the fish markets, where they are

required to pay stall fees. Local fisher folk and fish vendors display fish on the roadsides

by laying the fish bundles on paper boards, sacks and tarpaulin pieces with no proper

icing conditions and storage techniques.

While some fish are displayed on wooden racks or opened-up sacks and

tarpaulins, other unsold fish are kept in ice-chests and old refrigerators containing ice.

Injured fish with or without gut and gills are stored together and sometimes fish are

displayed on the racks for the whole day, exposed at ambient temperatures to dust and

pollution from motor vehicle emissions. Since the climatic conditions in Fiji are almost

always warm, the high temperature plays a major contributing factor in the spoilage of

these fish.

1.14.2. Local markets

Another way of obtaining fish is from local fish markets. The fish markets are

easily accessible as they are centrally located in the shopping areas or in towns. In

30

Suva, for example, the main fish market is located in the city centre while other smaller

markets, such as Raiwaqa, Lami and Laqere, are located around the periphery of the

city limits. In these markets fish are displayed on tiled stalls rather than the wooden

racks in roadside stalls. Fish at these outlets are usually washed with water during

display and sale, which is not practiced by the fish sellers near the roadsides. There are

other fish vendors in the market who display their fish on the pavement and walkways

due to the lack of space.

1.14.3. Fish shops

Fish shops are considered to be the best source for purchasing fish for domestic

consumption. This is because the fresh fish is sold in a closed and air-conditioned shop

where the exposure to dust and environmental contaminants is less and the fish are

cleaned (with the gut and gills removed). Fish sellers have started to de-gut and remove

gills, since fish are believed to carry a high load of microbial contaminants in the gills and

gut areas. Consumers at fish shops are informed that the fish are cleaned (with gills and

gut removed) however, there are cases where some of the tissues are still present in the

fish after cleaning. Fish vendors at roadside stalls and local markets do not follow the

practice of removing the gills and gut and hence presence of these tissues can result in

fish spoilage.

Given the incidence of bacterial contamination of fish stocks in previous studies

and the possible health risks caused by these pathogens (as discussed in the previous

sections), it is possible that fish available in the local seafood markets in Suva could

possibly have similar types of bacterial contamination. Although there are documented

guidelines on safe seafood handling and reported incidences of seafood spoilage in Fiji

(Chamberlain and Titili, 2001), there is no data available for foodborne illnesses

31

associated with fish and fishery products in Fiji. This research therefore intends to

provide an indication on the hygienic quality of fish that are sold at various outlets in

Suva, Fiji.

1.15. Aim and Objectives

The aims and objectives of the current research are to:

To carry out a qualitative investigation on the occurrence of Vibrio

parahaemolyticus, Vibrio cholerae and Escherichia coli in fish (gills, skin

surface and gut) sold at various outlets (roadside stalls, local markets and fish

shops) in Suva, Fiji.

To identify pathogenic strains of Vibrio species in fish samples obtained from

local markets, roadside stalls and fish shops using molecular identification

techniques.

To compare the incidence of these pathogens at different regions of the fish

samples and to determine whether the various outlets have any significant

effect on the prevalence of these pathogens in the fish.

32

CHAPTER 2: METHODOLOGY

2.1. Description of study area

Suva is the capital city and is located in the Central Division of the Fiji Islands

(Latitude: 18.142º, Longitude: 178.44º). Fish sold in Suva are harvested from coastal

waters (including the lagoons and coral reefs) of Viti Levu and Vanua Levu (two major

islands in the Fiji group). In Suva, fresh fish are commonly sold in local markets,

roadside stalls and fish shops mostly at the weekends. For the current research, fish

samples were purchased from three different types of outlets in and around Suva. The

different outlets represent the major categories, including the roadside fish stalls, local

fish markets and fish shops.

Three different sites were chosen from these major three categories. The sites in

the retail fish shops included Food Processors (A1), Fresh ‘et Fish Shop (A2) and

Cakaudrove Fish Shop (A3). The sites in the local markets included the Suva Market

(B1), Lami Market (B2) and Laqere Market (B3). The sites in the roadside stalls included

the Bailey Bridge (C1), Vatuwaqa Bridge (C2) and the Raiwaqa roadside (C3) (Figure 1).

All these sites are popular places where fish are bought by many people in Suva. Hence,

a total of nine stations were commonly visited for fish collection.

33

.Laqere Market

.Lami Market

.Cakaudrove Fish Shop

.Bailey Bridge

. Fresh’et Fish shop

.Raiwaqa

.Va waqa Bridge tu. Food Processors

. Suva Market

Figure 1: Map showing the sampling sites within and around Suva.

34

2.2. Collection and transportation of samples

A total of 180 fish samples were purchased during the period of October (2006)

to January (2007) from these nine different sites in and around Suva for analysis to

determine the presence and absence of Vibrio cholerae, Vibrio parahaemolyticus and

Escherichia coli. Of this total, 20 fish samples were purchased from each site within

each major category.

The fish species selected for analysis included White-lined Rock cod

[Anyperodon leucogrammicus, local name: Kawakawa] (Figure 2) and Bicolour Parrot

fish [Cestoscarus bicolour, local name: Ulavi) (Figure 3). The Spinefoot Rabbit fish

[Siganus vermiculatus, local name: Nuqa] was purchased at one station (Vatuwaqa

Bridge) due to the unavailability of the other two fish species (Figure 4).

Fish samples were purchased from various vendors randomly in the fish market

and from the roadside stalls. Fish bought from fish markets and roadsides were selected

by identifying clarity and the firmness of the eyes, red colour of the gills and the seaweed

smell as these qualities are used to identify the freshness of the fish (Chamberlain and

Titili, 2001). Fish collections were made between 6 am and 8 am during the sampling

days.

35

10 cm

Figure 2: White-lined Rock cod (Anyperodon leucogrammicus, Local name: Kawakawa)

10 cm

Figure 3: Bicolour Parrot fish (Cestoscarus bicolour, Local name: Ulavi)

10 cm

Figure 4: Spinefoot Rabbit fish (Siganus vermiculatus, Local name: Nuqa)

36

The fish samples were placed into sterile bags (Bio Lab, N.Z.) and transported to

the laboratory in an ice chest containing adequate ice (with a temperature at around

4ºC). Direct contact of the fish samples with the ice was avoided to ensure maximal

survival and recovery of Vibrios and to reduce the tendency for overgrowth by

indigenous marine microflora (Kaysner and DePaola, 2001). All samples were analyzed

within two hours of sample collection. Aseptic procedures were strictly followed during

collection, transportation and analysis of the fish samples.

2.3. Preparation for analysis

Sterile media were prepared according to the manufacturers’ descriptions

provided on media bottles, whereas the reagents were prepared according to the

procedures as described by Downes and Ito (2001). Templates of 25cm² in size were

prepared by cutting squares off a cardboard and sterilized at 121ºC for 15 minutes in an

autoclave.

2.4. Quality control

Reference cultures of Escherichia coli, Vibrio parahaemolyticus, and Vibrio

cholerae [obtained from ESR, New Zealand; NZRM# 820 (V. parahaemolyticus); # 916

(E. coli) and # 1099 (V. cholerae)] were used in this study in order to compare the results

and also to check if there were any chances of contamination that could affect the

results.

37

2.5. Bacteriological analysis

2.5.1. Isolation

In the laboratory, each fish sample was placed in a sterile tray disinfected with

70% ethanol. Different regions of the fish were used to test for bacterial contamination

and these included the skin surface, gills and the gut region. These regions were

swabbed separately with sterile cotton swabs (Bio Lab, N.Z.) as illustrated in Figures

5(a) - 5(c). For swabbing of the skin surface, a sterile template was used to swab an

area of 25 cm2 [Figure 5(a)] whereas the gills (opened aseptically using sterile forceps)

were swabbed from both sides [Figure 5(b)]. The gut region was swabbed [Figure 5(c)]

by making an insertion in the abdomen using a sterile scalpel. Although, fish procured

from the fish shops were considered to be cleaned (gills and the gut area removed),

swabbing was still carried out in order to identify any sources of cross contamination.

(a) (b) (c) Figure 5: Swabbing of different regions of the fish (a) gill area, (b) skin surface, (c) gut area

38

2.5.2. Isolation of Vibrio cholerae and Vibrio parahaemolyticus

After swabbing, the swabs were transferred to 10ml alkaline peptone water

(APW; pH 8.5 ± 0.2, 3% (w/v) NaCl) and incubated at 37ºC for 18-24 hours for

enumeration of V. parahaemolyticus and 6-8 hours for enumeration of V. cholerae. After

incubation, the APW cultures that showed turbidity were streaked onto the Thiosulphate

Citrate Bile Salts Sucrose Agar (TCBS agar; Bio Lab, N.Z.) and incubated again at 37ºC

for 18-24 hours. As described in the Bacteriological Analytical Manual (BAM, 2004-

Internet), typical colonies of V. cholerae on TCBS agar appear as large (2-3mm),

smooth, yellow and slightly flattened with opaque centres and translucent peripheries,

whereas V. parahaemolyticus colonies are round, 2-3mm in diameter, green or blue

green colonies. Therefore, with reference to BAM (2004), two or more typical and

suspected colonies from each medium (Figure 6) were transferred to nutrient agar (Bio

Lab, N.Z.) slants (NA, 2% (w/v) NaCl) and incubated at 37ºC overnight. These isolates

on the slants were then stored at room temperature until further analysis for biochemical

testing.

(a) (b)

Figure 6: Showing typical colonies of (a) V. cholerae- like colonies and

(b) V. parahaemolyticus- like colonies on TCBS agar

39

2.6. Identification- biochemical tests All cultures retrieved from nutrient agar slants were grown on Tryptic Soy Agar

plates (Bio Lab, N.Z.) (TSA, 2% (w/v) NaCl) and were incubated at 37ºC overnight

before performing biochemical tests (Figure 7). Three biochemical tests were performed

in order to streamline the results for molecular analysis. The tests performed included

carbohydrate fermentation (lactose and sucrose), Oxidase test and Salt tolerance test (in

0%, 6% and 8% NaCl).

Figure 7: Showing growth on TSA (2% NaCl)

2.6.1. Carbohydrate fermentation test

Phenol Red broths with carbohydrate (lactose and sucrose) were used for the

determination of fermentation reactions of Vibrio species. McCartney tubes containing

10ml of phenol red sucrose and lactose medium were prepared in laboratory from the

following components: peptone 5g; sodium chloride 5g, phenol red 0.0018g, sucrose 1%

and lactose 1% made up to one litre and the pH adjusted to 7. These tubes were

inoculated with growth from TSA (2% NaCl) plates and incubated at 37ºC for 18-24

hours. The presence of acid (yellow colour) indicated a positive test (BAM, 2004).

V. cholerae is sucrose positive (yellow colour) and lactose negative (brown or pink

40

colour) whereas V. parahaemolyticus is both sucrose and lactose negative [Figure 8(a)

and (b)].

Carbohydrate fermentation salt tolerance

(a) (b)

Dark purple colour development within 10 seconds

(c) Figure 8: Biochemical tests reactions of (a) Vibrio parahaemolyticus

(b) Vibrio cholerae (c) A positive oxidase test

2.6.2. Cytochrome oxidase test

The overnight cultures from TSA plates with 2% NaCl (Banksia, Australia) were

transferred using a sterile wood applicator stick to a filter paper saturated with oxidase

reagent 1% [N,N,N,N'-tetramethyl-p-phenylenediamine.2HCl] (Banksia, Australia)

prepared in lab by dissolving 0.1g of [N, N, N, N'-tetramethyl-p-phenylenediamine.2HCl]

in 10ml of distilled water. A dark purple colour developing within 10 seconds indicated a

41

positive test [Figure 8(c)]. Vibrio cholerae and Vibrio parahaemolyticus are both oxidase

positive.

2.6.3. Salt tolerance test

Tubes containing 5 ml of Tryptic Soy Broth (TSB) (Bio Lab, N.Z.) each

containing 0%, 6% and 8% NaCl were inoculated using growth from TSA (2% NaCl)

plates and incubated at 37ºC for 18-24 hours. Tubes showing turbidity were noted as

positive and those showing no growth was noted as negative (BAM, 2004). V. cholerae

does not require salt for growth hence is positive in 0% NaCl whereas V.

parahaemolyticus requires 6% NaCl and 8% NaCl in order to grow [Figure 8(a) and (b)].

Presumptive results obtained from these tests that indicated the presence of the target

Vibrio species were further confirmed by molecular analysis.

2.7. Confirmation tests

2.7.1. DNA extraction

This protocol for DNA extraction has been adapted and modified from Marmur

(1961). Bacterial cultures were grown in 10ml TSB (3% NaCl) in a shaking incubator at

37ºC overnight. An aliquot of 0.5ml of liquid culture was transferred to a 1.5 ml

Eppendorf tube. The suspensions were spun at 12 500 revolutions per minute (rpm) for

2 minutes in a mini-centrifuge. The supernatant was discarded and the clumped cells

were re-suspended completely in 750ul of P1 buffer (made from 50mM Tris pH 8; 10mM

EDTA), with 3.75ul of 100mg/ml RNase A (0.5mg/ml final concentration). This was

mixed by inverting the tube and incubated for 60 minutes at 37ºC in a water bath.

42

After incubation, 37.5ul of 20% Sodium Dodecyl Sulphate (SDS) (Banksia,

Australia) was added together with 8ul of 10mg/ml Proteinase K (BioLab, N.Z.) to each

of the tubes and these were mixed completely and incubated for 45 minutes at 37ºC in a

water bath. After incubation, the tubes were removed and incubated again for 30

minutes at 65ºC in a water bath. The tubes were retrieved and in a fume hood, 200ul of

chloroform was added to these tubes using extra precaution. The tubes were then

shaken in a Vortex Mixer for 30 seconds. In cases where the samples were not

completely emulsified, more chloroform was added and spinning was repeated at 12 500

rpm for 2 minutes.

After spinning, the solution became biphasic, with chloroform formed on the

bottom layer in the tubes. To this, an aliquot of 200ul of potassium acetate (saturated)

was added to precipitate the SDS, mixed gently, then spun again at 12 500 rpm for 2

minutes. The top aqueous layer obtained by the above procedure was completely clear,

and where it was hazy, more potassium acetate was added to clear the haze. In some

tubes the aqueous layer was viscous, which was corrected by adding more chloroform

and spinning for 1 minute.

An aliquot of 700ul clear aqueous layer from section 2.7.1 was transferred to a

fresh Eppendorf tube and one volume of cold isopropanol (i.e. 700ul kept in a 4ºC

refrigerator) was added and spun for 10 minutes at 12 500 rpm. The supernatant was

carefully poured off from the DNA pellet, the pellet washed with 70% ethanol (400ul) and

spun again at 4ºC for 2 minutes at 12 500 rpm. The ethanol was poured off and the

pellets were dried by inverting the tubes and draining on a paper towel until no ethanol

remained.

43

The DNA was re-suspended in 50ul of Low TE buffer (containing 10mM Tris, pH

7.6 – 8.5; 0.1mM EDTA). This was left overnight at room temperature. These bacterial

DNA samples were then sent to the Allan Wilson Centre for Molecular Ecology and

Evolution at Massey University in Palmerston North, New Zealand for Polymerase Chain

Reaction (PCR) analysis and molecular sequencing, because the University of the South

Pacific labs lacks the facilities.

2.7.2. PCR and sequencing

This procedure was carried out at the laboratories of Allan Wilson Centre for

Genome Services, Massey University, Palmerston North, New Zealand. Initial sequence

determinations were made for the 16SrDNA gene regions for the DNA samples. PCR

products were generated using the primers F800: GGAGCGAACAGGATTAGATACC

and RC1492: TACGGCTACCTTGTTACGACTT. The PCR thermocycling conditions

used were as follows: 1 cycle of 94ºC for 3 minutes, 35 cycles of 94ºC for 30 seconds,

50ºC for 30 seconds and 72ºC for 45 seconds, 1 cycle of 72ºC for 5 minutes and a

10ºC hold. These conditions gave a single PCR product of approximately 800 base pairs

(bp) in length. Unincorporated PCR primers were subsequently removed enyzmatically

by the addition of 1U of shrimp alkaline phosphatase (SAP, USB corp) and 5U

exonuclease 1 (EXO 1, USB corp) and incubated at 37ºC for 15 minutes followed by

80ºC for 30 minutes. The products were sequenced in both directions with the PCR

primers above using protocols provided by Applied Biosystems

(http://www.appliedbiosystems.com/) and run on an Applied Biosystems 3730 automated

capillary sequencer. Electropherograms for each sequence were edited using the

software Sequencher 4.1 (Gene Codes). BLASTN program adapted from

(http://www.ncbi.nlm.nih.gov/blast) was used to compare each sequence with sequences

in GENEBANK.

44

With some cultures, unambiguous sequences could not be obtained, suggesting

that these may contain a mixture of different bacterial strains. Where an unambiguous

sequence was obtained, the sequence was compared with those in the NCBI Non

Redundant Nucleotide Sequence database using the program BLASTN

(http://www.ncbi.nlm.nih.gov/blast). In numerous cases very similar high scores were

obtained for different Vibrio strains. To distinguish among these, the recA gene region

was also sequenced for the strains identified as Vibrios. For this second experiment

recA PCR primers were used: recA-01F (TGARAARCARTTYGGTAAAGG) and recA-

04R (GGGTTACCRAACATCACVCC) (Thompson et al., 2005). The same PCR

amplification conditions were used as for the 16S rDNA resulting in a single PCR

product 547bp in length. These were sequenced in the same manner as the 16S rDNA

products, edited and compared with sequences in the NCBI Non Redundant Nucleotide

sequence database using the program BLASTN.

2.8. Qualitative testing for Escherichia coli

2.8.1. Isolation

Similar Isolation technique was used as described in section 2.5.1.

2.8.2. Isolation of E. coli

Different fish regions were swabbed separately and swabs were transferred to

10ml tubes containing Lactose broth (Bio Lab, N.Z.) with inverted Durham tube and

incubated at 44.5ºC in a water bath for 24 hours. Tubes showing turbidity with gas

production (gas trapped in the inverted Durham tubes) were used to streak onto Eosin

Methylene Blue Agar (EMBA). These were then incubated at 37ºC for 24 hours.

45

Typical E. coli like colonies (green-metallic sheen) (Figure 9) were picked using a

sterile inoculation needle and aseptically transferred to sterile nutrient agar slants for

further biochemical confirmation using Indole, Methyl red, Voges porskauer and Citrate

(IMViC) identification tests.

Figure 9: Showing typical colonies (green metallic sheen) of E.coli on EMB agar.

2.9. Confirmation tests

Confirmation tests for E. coli were done using standard microbial procedures.

2. 9.1. Indole test

The presence of indole was detected by the addition of Kovacs reagent [typical

composition includes r-dimethylaminobenzaldeyde (50g), concentrated hydrochloric acid

(25ml) and amyl alcohol (75ml)]. Kovacs reagent reacts with indole, producing a bright

red compound (rosindol dye) in the reagent layer. The isolates were inoculated using a

sterile inoculation needle in 10ml tubes containing tryptone water and were incubated at

37ºC for 48 hours. After incubation, 0.5 ml of Kovacs reagent was aseptically added to

tryptone water tubes. The development of a red colour ring at the reagent layer showed

a positive test for indole [Figure 10(a)]. The absence of a red colour indicated that

tryptophan was not hydrolyzed and the bacteria were indole negative.

46

2.9.2. Methyl Red test

The isolates were inoculated into tubes containing 10ml dextrose phosphate

broth (MRVP medium) (BioLab, N.Z.) using a sterile inoculation loop and incubated at

37ºC for 48 hours. After incubation, 0.6ml of methyl red indicator was added into the

MRVP medium. Methyl red turns red at a pH of 4, indicating a positive methyl red test

[Figure 10(b)] and turns yellow at a pH of 6 indicating a negative methyl red test.

2.9.3. Voges Proskauer test

The isolates were inoculated in tubes containing 10ml dextrose phosphate broth

(MRVP medium) using a sterile inoculation loop and incubated at 37ºC for 48 hours.

After incubation, 0.6 ml of Barritts reagent A (typical composition in g/ml: α-napthol 5g,

absolute ethanol 100ml) and 0.2 ml of Barritts reagent B (typical composition in g/ml:

potassium hydroxide: 40g, distilled water: 100ml) were added to the MRVP medium. The

tubes were shaken well to allow aeration of the solution. A minimum of 15 minutes was

given for the reaction to occur in the tubes before reading the results, since this process

occurs at a slower rate. Periodical shaking was done to enhance the speed of the

reaction. The development of a red colour in the culture medium 15 minutes following

addition of Barritts reagent represents a positive VP test and absence of red colour is

considered a negative VP test [Figure 10(c)].

2.9.4. Citrate utilization test

The citrate utilization test determines the ability of bacteria to use citrate as a

sole carbon source for their energy needs. The medium used was Simmon Citrate agar,

which contains sodium citrate as the carbon source, ammonia as nitrogen source and

47

bromothymol blue as a pH indicator. This test was done on Simmon Citrate agar slants

since oxygen is needed for citrate utilization. Using a sterile inoculation needle, the

isolates were streaked over the agar slant. These were then incubated for 48 hours at

37ºC. After incubation, the slants were checked for colour change. Development of blue

colour indicated a positive test for citrate utilization whereas negative test is indicated by

absence of colour change [Figure 10(d)]. Results showing a ++- - were noted as E. coli

and a -+- - were noted as E. coli II for the four tests in Section 2.8.

(a) Indole test (+ve) (b) Methyl Red test (+ve)

(c) Voges Proskauer test (-ve) (d) Simmon citrate test (-ve) Figure 10: IMVic results for confirmation of E. coli

48

2.10. Statistical analysis

The data of positive results obtained were subjected to Analysis of Variance

(one-way ANOVA) to compare differences in the incidences of contamination positive in

at least one of the three regions of the fish sampled. The data were also subjected to

repeated measure- ANOVA to compare the data between the three major stations

(roadside stalls, fish shops and local markets) and within the regions (gills, gut and skin

surface) using SPSS 13.0 software.

49

CHAPTER 3: RESULTS

3.1. Biochemical tests for identification of Vibrio cholerae

The biochemical test results for all fish samples that had yellow colonies on TCBS

agar indicating possible V. cholerae (in the initial alkaline peptone water (APW) (BAM,

2004) are given in Appendix 1. Results did not show the presence of V. cholerae. Some

cultures (that produced yellow colonies on TCBS agar) were subjected to further

molecular screening. This was done to confirm the results of the biochemical tests and

to determine if other pathogens were present in the fish samples. The results of the

molecular analysis confirmed that there was no incidence of V. cholerae (Table 1).

3.2. Biochemical tests for identification of Vibrio parahaemolyticus

Results of biochemical analysis of green colonies indicated the possibility of the

presence of V. parahaemolyticus in initial APW test (Appendix 2). Cultures that showed

possible characteristics of V. parahaemolyticus in biochemical results (Table 1; cultures

G1-85; rows 7-20) were subjected to further analysis for confirmation of V.

parahaemolyticus.

50

Table 1: Molecular confirmation of V. parahaemolyticus cultures BEST BLAST MATCH CULTURE

NO. 16S rDNA rec A

PERCENTAGE IDENTITY

Y9 * -

Y31(b) Marinomonas sp - -

Y32(b) Marinomonas sp - -

Y37(b) Marinomonas sp - - Y55 (a) Vibrios Vibrio fluvialis

Strain LMG 11654 99

Y87 Oceanimonas smirnovii

- -

G1 Vibrios V. parahaemolyticus Strain LMG 11670

99


100


100


100


100


100


100


100


98


98

G46 Vibrios V. alginolyticus strain 4409T

99


99


99

G85

Vibrios V. parahaemolyticus Strain LMG 11670

99

G87 Shewanella sp. - -


99


99

G109 Vibrios V. alginolyticus strain 4409T

99

* Mixed sequence (could not obtain readable sequence) - Not determined

BLAST analyses for 16S rDNA and recA sequences determined from 24 cultures. Using

the 16S rDNA, it was found that although the best match for all sequences in the above

51

cultures (G1- G109) were similar to V. parahaemolyticus however, near equal good

matches were made to other species (Vibrios: V. parahaemolyticus, V. fortis, V.

alginolyticus). Therefore, these cultures were also sequenced for the recA gene.

52

Table 2: Percentage incidence of pathogens at different body regions of fish collected from various sources

Body Region Sources

Number of fish

sampled

Pathogens Skin

Surface Gills Gut

A1 (Food Processors) 20 0 0 0 A2 (Fresh ‘et) 20 0 0 1

(5)* A3 (Cakaudrove Fish) 20

V. parahaemolyticus

0 0 1 (5)*

A1 (Food Processors) 20 3 (15)*

4 (20)*

3 (15)*

A2 (Fresh ‘et) 20 0 1 (5)*

2 (10)*

A3 (Cakaudrove Fish) 20

E. coli

2 (10)*

3 (15)*

4 (20)*

A1 (Food Processors) 20 0 0 0 A2 (Fresh ‘et) 20 0 0 0

Fish shops

A3 (Cakaudrove Fish) 20

V. cholerae

0 0 0

B1 (Suva market)

20

0 1 (5)*

1 (5)*

B2 (Lami market) 20 0 0 1 (5)*

B3 (Laqere market) 20

V. parahaemolyticus

0 0 1 (5)*

B1 (Suva market) 20 3 (15)*

0 1 (5)*

B2 (Lami market) 20 0 5 (25)*

4 (20)*


E. coli

0 4 (20)*

3 (15)*

B1 (Suva market) 20 0 0 0

B2 (Lami market) 20 0 0 0

Local markets


V. cholerae

0 0 0 C1 (Bailey Bridge) 20 0 2

(10)* 2

(10)* C2 (Vatuwaqa Bridge) 20 0 1

(5)* 2

(10)* C3 (Raiwaqa) 20

V. parahaemolyticus

1 (5)*

1 (5)*

1 (5)*

C1 (Bailey Bridge) 20 1 (5)*

2 (10)*

2 (10)*

C2 (Vatuwaqa Bridge) 20 3 (15)*

5 (25)*

2 (10)*

C3 (Raiwaqa) 20

E. coli

8 (40)*

5 (25)*

3 (15)*

C1 (Bailey Bridge) 20 0 0 0 C2 (Vatuwaqa Bridge) 20 0 0 0

Roadside

stalls

C3 (Raiwaqa) 20

V. cholerae

0 0 0

* Values in parenthesis indicate percentage incidence at each source

53

Figure 11: Occurrence of pathogens in fish positive at one of the three regions in fish obtained from various sources

0

2

4

6

8

10

12

VP E.coli VC VP E.coli VC VP E.coli VC

Fish shops Local markets Roadsides

Sources

Mea

n of

inci

denc

e (p

er fi

sh)

The data of 20 fish samples assessed (n = 20) from each of the outlets are

expressed as the mean (± 1 standard error) per fish.


E. coli contamination in fish sold at different outlets is higher compared to V.

parahaemolyticus. One-way ANOVA analysis showed that there was no significant

difference in E. coli contamination in fish sold at different outlets (F = 3.444, P = 0.742,

d.f.= 2, 6).

3.4. Vibrio parahaemolyticus

The data subjected to one-way ANOVA showed that there was significant

difference in the occurrence of V. parahaemolyticus in fish (positive in at least one of the

three regions) bought from each outlet (F = 4.874, P = 0.04, d.f. = 2, 8).

54

Figure 12: Occurrence of pathogens at different regions of fish bought from roadsides

0

1

2

3

4

5

6

7

skin gills gut skin gills gut skin gills gut

V. parahaemolyticus

E. coli V. cholerae

Pathogens

Mea

n In

cide

nce

(per

fish

)

E. coli and V. parahaemolyticus contamination on the skin and gills of fish was found to

be equal whereas none of the fish tested positive for V. cholerae.

Figure 13: Occurrence of pathogens at different regions of fish bought from fish shops

0

0.5

1

1.5

2

2.5

3

3.5

4


V. parahaemolyticus

E. coli V. cholerae

Pathogens

Mea

n In

cide

nce

(per

fish

)

Contamination by V. parahaemolyticus was only detected in the gut region whereas all

regions of fish were contaminated by E. coli.

55

Figure 14: Occurrence of pathogens at different regions of fish bought from local markets

0 0.5

1 1.5

2 2.5

3 3.5

4 4.5

5


V. parahaemolyticus

E. coli V. cholerae

Pathogens

Mea

n In

cide

nce

(per

fish

regi

on)

All regions of fish were contaminated with E. coli whereas there was no incidence of V.

parahaemolyticus in the skin region of fish samples analysed.

Figure 15: Percentage occurence of pathogens at different regions of fish obtained from different Fish shops

0

5

10

15

20

25

E. c

oli (

A1)

E. c

oli (

A2)

E. c

oli (

A3)

VP

(A1)

VP

(A2)

VP

(A3)

VC

(A1)

VC

(A2)

VC

(A3)

Pathogens

% In

cide

nce

per r

egio

n

SKINGILLGUT

VP: Vibrio parahaemolyticus VC: Vibrio cholerae

56

A higher percentage of E. coli contamination is found on the gills of fish bought from

Food Processors (A1) as compared to fish bought from Fresh ’et (A2) and Cakaudrove

Fish Shop (A3). V. parahaemolyticus contamination was only prevalent in the gut

regions of fish bought from Fresh ’et (A2) and Cakaudrove Fish Shop (A3).

Figure 16: Percentage Incidence of pathogens at different regions of fish obtained from different Local markets

0

5

10

15

20

25

30E

.col

i (B

1)

E.c

oli (

B2)

E.c

oli (

B3)

VP

(B1)

VP

(B2)

VP

(B3)

VC

(B1)

VC

(B2)

VC

(B3)

Pathogens

% In

cide

nce

per r

egio

n

SKINGILLGUT

Fish samples procured from Suva market (B1) had a higher incidence of E. coli on the

skin region and E. coli contamination on skin was absent in fish sold at Lami market (B2)

and Laqere market (B3). Equal contamination by V. parahaemolyticus was present on

the gills and gut of fish sold in Lami market (B2) and Laqere market (B3).

57

Figure 17: Percentage Incidence of pathogens in fish regions obtained from different roadsides

0

5

10

15

20

25

30

35

40

45

E. c

oli (

C1)

E. c

oli (

C2)

E. c

oli (

C3)

VP

(C1)

VP

(C2)

VP

(C3)

VC

(C1)

VC

(C2)

VC

(C3)

Pathogens

% In

cide

nce

per r

egio

n

SkinGill

Gut

A higher percentage of fish is contaminated by E. coli on the skin surface in fish sold at

Raiwaqa roadside (C3) as compared to the other two sites, whereas equal percentage of

E. coli was found in fish sold at Vatuwaqa Bridge (C2) and Bailey Bridge (C1).

3.5. Escherichia coli at different regions

Results subjected to one-way ANOVA for repeated measures, showed that

there was no significant difference in the occurrence of E. coli at the different regions of

the fish analyzed ( F = 0.782, P = 0.479, d.f. 2, 12).

3.6. Vibrio parahaemolyticus at different regions Results subjected to one-way ANOVA for repeated measures, showed that there

was a significant difference in the occurrence of V. parahaemolyticus in the three regions

of the fish samples analyzed (F =7.548, P = 0.008, d.f. 2, 12).

58

CHAPTER 4: DISCUSSION


The results indicate that fish sold in the markets, roadside stalls and fish shops

are contaminated by pathogenic bacteria such as E. coli and V. parahaemolyticus. A

higher incidence of E. coli was found in fish as compared to V. parahaemolyticus

indicating that E. coli is a more common contaminant of fish in the tropics (Thampuran

and Surendara, 2005). There was no significant difference in E. coli contamination in fish

sold at different major outlets (roadside stalls, fish shops and fish markets). This shows

that E. coli contamination in fish sold in Suva is high and regardless of the site where the

fish were purchased from. Thus presence of E. coli contamination in fish could be a

possible health risk to the local populace.

The presence of E. coli was detected both in the internal and external surface of

the fish (Figures 12, 13 and 14). It was found that there was no significant difference of

E. coli contamination at different regions of fish. All regions of fish sold along roadside

stalls were contaminated by E. coli (Figure 17). This shows that fish samples sold along

roadside stalls are more susceptible to microbial contamination and buying fish from

roadside stalls is not recommended. Fish sold in fish shops are usually degutted and

gills removed to avoid fish deterioration and spoilage. However, my results showed that

although the gut and gills were removed, E. coli was still present. This suggests that the

freshly cut exposed surfaces may have lead to microbial spoilage. The remnants of

tissues in the gut and gill regions could explain the presence of E. coli in fish bought

from fish shops.

59

The use of poor quality water and improper storage conditions may contribute to

the high occurrence of E. coli (El-Zanfaly and Ibrahim, 1982; Lartesva et al., 1997;

Chattopadhyay, 2000; Edwin et al., 2004; El- Shafai et al., 2004; Al-Harbi and Uddin,

2005). Water used for washing and ice for chilling seafood may also be contaminated

with E. coli (Landeiro et al., 2007). Therefore, E. coli contamination may be minimized by

proper removal of the gills and gut. Proper storage (such as in ice chests) with adequate

good quality ice may also reduce contamination. However, the extent of E. coli

contamination in ice and water used for storing and washing fish in the current research

was not determined. So it cannot be established that the presence of E. coli is due to the

use of sub-quality ice and water.

4.2. V. parahaemolyticus

V. parahaemolyticus contamination in fish was significantly different at different

outlets. Fish sold at roadside stalls were highly contaminated with V. parahaemolyticus

followed by those sold in local markets and fish shops. A higher incidence of this

pathogen in fish sold at roadside stalls could be due to the temperature abuse.

Temperature is a crucial factor in the multiplication of bacteria where fish samples

sold at roadside stalls are mostly exposed to ambient temperatures with no proper

storage conditions. Previous investigators have also reported that the levels of V.

parahaemolyticus increases in seafood that are exposed to temperatures from 20 to

30ºC (Adams and Moss 2000). If the seafood is exposed to temperatures at 20 – 35ºC,

moderate levels of bacteria can increase to high levels within 2-3 hours (Adams and

Moss, 2000). The temperatures in Suva are usually within this range and this may

explain the presence of V. parahaemolyticus contaminating the fish stocks.

60

Storing fish in direct contact with ice is injurious to V. parahaemolyticus (Kaysner

and DePaola 2001). This is supported by my findings which show that fish sold in fish

shops had a lower level of contamination as fish were stored at low temperatures.

Storing fish at low temperatures may also reduce the numbers of V. parahaemolyticus to

some extent but bacteria could survival up to two months at -20ºC (FOSRl, 1997).

Reports have indicated that V. parahaemolyticus dies at temperature of 0-5ºC. This

implies that efficient monitoring of freezer temperatures in fish shops should be

practised. Researchers have investigated the presence of V. parahaemolyticus in retail

pre-packed portions of marine fish sold in Spain (Herrera et al., 2006) and Japan (Miwa

et al., 2006) and showed that improper handling and processing of fish were major

contributors of fish contaminating by V. parahaemolyticus.

4.3. Occurrence of V. parahaemolyticus at different regions

The occurrence of V. parahaemolyticus was significantly different at different

regions of the fish samples analyzed. V. parahaemolyticus was more prevalent in the gut

region of most of the fish samples analysed. A unique microcosm for the proliferation of

V. parahaemolyticus is provided by the gut region (Sarkar et al., 1985) which may

explain the presence of this bacterium in this region. All regions of fish bought from

Vatuwaqa Bridge were contaminated with V. parahaemolyticus. At roadside stalls the

fish skin and gills is in direct contact to microbial contaminants in the environment. This

condition may accelerate the growth of most of the pathogenic bacteria resulting in fish

spoilage.

It was observed that injured fish were stored with the other uninjured fish in the

same bag and the bleeding from fish could have accelerated the rate of fish spoilage,

61

microbial growth and contamination. Fish were displayed on top of ice chests or on the

footpath during sale which could further increase the risk of microbial contamination.

The results suggest that the growth of pathogenic micro-organisms tested were favoured

in warmer temperature conditions. This suggests that rapidly chilling fish after harvest

could reduce possibility of proliferation of these organisms. Studies carried out by Elhadi

et al. (2004) have also indicated that fish should be kept in cold conditions (at around

0ºC) during transit and storage to reduce the risk and level of Vibrios.

4.4. Vibrio cholerae

Vibrio cholerae is part of the natural bacterial flora in aquatic environments. My

results showed no occurrence of V. cholerae in the fish samples that were bought from

roadside stalls, local markets or fish shops (Figures 14-20). Molecular identification of

the yellow colonies on TCBS agar showed the presence of other microorganisms such

as Vibrio alginolyticus, Marinomonas, Oceanimonas and Shewanella species (Table 3).

Similarly, investigations by Herrera et al. (2006) have also identified the presence of

other pathogens in fish samples (Clostridium perfringens, Edwardsiella tarda, Listeria

monocytogenes and Staphylococcus aureus) suggesting that although V. cholerae were

not present, bacterial microflora in fish is diverse. Similar reports have shown the

absence of V. cholerae in fish sold in other countries such as in Iran (Hosseini et al.,

2004), Italy (Bertini et al., 2004), Spain (Herrera et al., 2006) and Australia

(Subramanian, 2007). This suggests that V. cholerae in fish is not as prevalent as V.

parahaemolyticus.

Studies conducted by Nair et al. (2006) have also confirmed that there was no

incidence of cholera-causing strains in Fiji waters and therefore fish from these waters

62

do not contain this disease-causing strain. However, this does not imply that sanitation

conditions and handling techniques are well practiced in Fiji, as other pathogens such as

V. parahaemolyticus and E. coli were detected.

63

CHAPTER 5: CONCLUSION AND RECOMMENDATIONS

The current research confirms that fish samples sold in Suva are contaminated

with pathogenic bacteria such as E. coli and V. parahaemolyticus. Although no fish

samples tested positive for V. cholerae, study have however found that presence of

other microorganisms are contaminating the fish stocks. Many of the local fisher folks

and fish vendors lack complete knowledge of the procedures required to ensure safe

and hygienic handling of fish. As local fishermen are usually unable to bear the cost of

ice, the fish are often stored in poor conditions. The handling, storage and distribution of

fish in the local and domestic markets in Fiji follow regulations adapted from the United

States Food and Drug Administration (USFDA). These laws and regulations are

administered by Ministry of Fisheries in Fiji. Despite the presence of these laws, the local

fisher folks and vendors fail to adhere to these regulations and there is no regular

monitoring and implementation of these laws and regulation. This has led to laxity in

laws that regulate fish sale and regulation resulting in an increased risk to public health

in relation to consumption of infected fish.

Proper handling (such as use of gloves) and storage of fish stocks (at appropriate

temperatures) should be maintained to ensure a reduced or negligible amount of

bacterial contamination. During transfer and sorting of the fish any physical damage

such as puncture and mutilation of the fish should be avoided. The appropriate

measures essential for the safety and hygienic quality of fish stocks include handling of

fish stocks with clean hands and equipment, facilitating the use of proper ice chests and

storage of fish with an adequate amount of good quality ice. Degutting, removal of gills

and washing the fish in brine before storage in ice can considerably reduce the bacterial

load and chance of loss by contamination from the gills and intestines. Fish shops

64

should consistently monitor and control the time, temperature and homogeneity of

chilling.

5.1. Future work

My results show that microbial contaminants in fish samples sold in Suva are

high but further investigations are required to determine the levels and the extent of

microbial contamination. Further studies could involve a quantitative evaluation of the

fish samples contaminated with these pathogens as this would provide a clear indication

of the contamination levels of fish sold in Fiji. Analysis and identification of different

serotypes of E. coli in fish samples analyzed could also be determined. Other work could

involve characterization of different bacteria present in fish samples which would provide

a clear indication on the quality of fish sold in Suva, Fiji.

65

REFERENCES

1. Acha, P. N., and B. Szyfres. 2003. Zoonoses and communicable diseases

common to man and animals. Pan American Health Organization. 3rd ed. pp. 384.

2. Adams, M. R., and M.O. Moss. 2000. Food Microbiology. The Royal Society of

Chemistry. Cambridge. pp. 38-144.

3. Al-Harbi, A., and N. Uddin. 2005. Bacterial diversity of tilapia (Oreochromis

niloticus) cultured in brackish water in Saudi Arabia. Aquaculture. 250: 566-572.

4. Alam, M. J., K. Tomochika, S. Miyoshi, and S. Shinoda. 2001. Analysis of

seawaters for the recovery of culturable Vibrio parahaemolyticus and some other

Vibrios. Microbiol. Immunol. 45: 393-397.

5. Alinovi, A., F. Vecchini, and P. Bassissi. 1993. Sporothricoid mycobacterial

infection- a case report. Acta Dermato-Venerologica. 73: 143-147.

6. Ananthalakshmy, V. K., A. Ramesh, and Y. K. Venugopalan. 1990. Bacterial

production of histamine in some tropical fish. Microbiol. 63: 71-77.

7. Arijo, S., M. Chabrillon, P. Diaz-Rosales, R. M. Rico, E. Martinez-Manzanares,

M. C. Balebona, A. E. Toranzo, and M. A. Morinigo. 2005. Bacteria isolated from

outbreaks affecting cultured sole, Solea senegalensis (Kaup). B. Eur. Assoc. of Fish

Pathol. 25: 148-154.

66

8. Asai, Y., T. Murrase, R. Osawa, T. Okitsu, R. Suzuki, S. Sata, S. Yamai, J.

Terajima, H. Izumiya, K. Tamura, and H. Watanabe. 1999. Isolation of Shiga

toxin producing Escherichia coli O157:H7 from processed salmon roe associated

with the outbreaks in Japan, 1998, and a molecular typing of the isolates by pulse-

field gel electrophoresis. Kansenshogaku Zasshi. 73: 20-24.

9. Asenjo, C., and C. H. Ramirez- Ronda. 1991. Halophilic Vibrio infections: a

review. Bol. Assoc. Med. 83: 154-156.

10. Ayulo, A. M., R. A. Machado, and V. M. Scussel. 1994. Enterotoxigenic

Escherichia coli and Staphylococcus aureus in fish and seafood from the Southern

region of Brazil. Int. J. Food Microbiol. 24: 171- 178.

11. Baird- Parker, T. C. 2000.The production of microbiological safe and stable foods:

In Lund, B.M., T.C. Baird-Parker. and G.W. Gould. The Microbiological Safety and

quality of food. Aspen Publishers, Gaithersburg. pp. 7- 8.

12. Basti, A., A. MisaghI, T. Z. Salehi, and A. Kamkar. 2006. Bacterial pathogens in

fresh, smoked and salted Iranian fish. J. Food. Prot. 17: 183-188.

13. Bertini, S., C. M. Bresciani, M. Tiberto, and S. Bonardi. 2004. Microbiological

control of frozen and thawed cuttlefish (Sepia officinalis). Ital. J. Food. Sci. 16:

255 - 260.

67

14. Bhaskar, N., and N. M. Sachindra. 2006. Bacteria of public health significance

associated with cultured tropical shrimp and related safety issues: a review. J.

Food. Sci. Technol. 43: 228- 238

15. Brown, A. 2008. Understanding food, principles and preparation. University of

Hawaii at Manoa. 3rd ed. pp. 165- 185. (In press).

16. Cabrera-Garcia M. E, C. Vazquez-Salinas, and E. I. Quinones- Ramirez. 2004.

Serologic and molecular characterization of Vibrio parahaemolyticus strains isolated

from seawater and fish products of the Gulf of Mexico. Appl. Environ. Microbiol.

70: 6401- 6406.

17. CDC. 1999. Outbreak of Vibrio parahaemolyticus infection associated with eating

raw oysters and clams harvested from Long Island Sound - Connecticut, New

Jersey, and New York, 1998. Morb. Moral. Wkly. Rep. 48: 48- 51.

18. Chamberlain, T and G. Titili. 2001. Seafood spoilage and sickness- Community

Fisheries Training Pacific Series 4. USP Marine Studies Programme/ Secretariat of

the Pacific Community Publication. pp. iii.

19. Chan, K. Y., M. L. Woo, L.Y. Lam, and G. L. French. 1989. Vibrio

parahaemolyticus and other halophilic Vibrios associated with seafood in Hong

Kong. J. Appl. Bacteriol. 66: 57-64.

20. Chattopadhyay, P. 2000. Fish- catching and handling. In: Robinson, R.K. (ed):

Encyclopedia of food Microbioliolgy. Academic Press. pp. 1547.

68

21. Chiou, A., L. H. Chen, and S. K. Chen. 1991. Foodborne illness in Taiwan, 1981-

1989. Food. Aust. 43: 70-71.

22. Chiou, C., S. Hsu, S. Chiu, T. Wang, and C. Chao. 2000. Vibrio parahaemolyticus

serovar O3:K6 as a cause of unusually high incidence of foodborne disease

outbreaks in Taiwan from 1996-1999. J. Clin. Microbiol. 38: 4621-4625.

23. Cho, S., M. L. Jahncke, and J. B. Fun. 2004. Nutritional composition and

microflora of the flesh and fermented skate (Raja Kenojei) skins. Int. J. Food. Sci.

Nutr. 55: 45- 51.

24. Chowdhury, M., S. Miyoshi, H. Yamanaka, and S. Shinoda. 1992. Ecology and

distribution of toxigenic Vibrio cholerae in aquatic environments of a temperate

region. Microbiol. 72: 203-213.

25. Colaco, W., S.V. Silva Filho, P. Rodrigues, and E. Hofer. 1998. Isolation of

Vibrio cholerae 01 from aquatic environments and foods in Pernambuco State,

Brazil.Cad. Saude Publica. 14: 465-471.

26. Collins, C. H., P. M. Lyne, and J. M. Grange. 1989. Microbiological methods.

Butterworth and Co. (Publishers) Ltd. 3rd ed. Great Britain. pp. 183-192.

27. Colwell, R. R. 1996. Global Climate and Infectious Disease: The cholera paradigm.

Sci. 274: 2025-2031.

28. Connell, J. J. 1995. Control of fish quality. Blackwell Sciences Ltd., UK. pp. 19 -23.

69

29. Croci, L., and E. Suffredini. 2003. Microbiological risk associated with seafood

consumption. Ann. Ist. Supper Sanita. 39: 35- 43.

30. Dalsgaard, A., Mazur, J. and Dalsgaard, I. 2002. Misidentification of Vibrio

cholerae O155 isolated from imported shrimp as O serogroup O139 due to cross-

aggulation with the commercial O139 antisera. J. Food Protect. 65: 670- 672.

31. Daniels, N., L. MacKinnon, R. Bishop, S. Altekruse, B. Ray, R. Hammond, S.

Thompson, S. Wilson, N. Bean, P. Griffin, and L. Slutsker. 2000. Vibrio

parahaemolyticus infections in the United States, 1973-1998. J. Infect. Dis. 181:

1661-1666.

32. Darie, H., T. Leguyadec, and J. E. Touze. 1993. Epidemiologic and clinical

aspects of Buruli ucler in Cote d’Ivoire- about 124 recent cases. Bull. Soc. Pathol.

Exot. 86: 272- 276.

33. Deepanjali, H. A., S. Kumar, I. Karunasagar and I. Karunasagar. 2005.

Seasonal variation in abundance of total and pathogenic Vibrio parahaemolyticus

bacteria in oysters along the Southwest Coast of India. Appl. Environ. Microbiol. 71:

3575- 3580.

34. DePaola, A., C. A. Kaysner, J.C. Bowers, and D.W. Cook. 2000. Environmental

investigations of Vibrio parahaemolyticus in oysters after outbreaks in Washington,

Texas, and New York (1997 and 1998). Appl. Environ. Microbiol. 66: 4649- 4654.

70

35. DePaola, A., J. L. Nordstorm, J. C. Bowers, J. G. Wells, and D. W. Cook. 2003.

Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama

oysters. Appl. Environ. Microbiol. 69: 1521-1526.

36. Din, J. N., D. E. Newby, and A. D. Flapan. 2004. Omega 3 fatty acids and

cardiovascular disease - fishing for a natural treatment. British. Med. J. 328: 30-35.

37. Donovan, T. J., and P. Netten. 2000. Culture media for the isolation and

enumeration of pathogenic Vibrios species in foods and environmental samples.

Intern. J. Food Microbiol. 26: 77-91.

38. Downes, F.P., and K. Ito. 2001. Compendium of methods for microbiological

enumeration of foods. 4th ed. American Public Health Association. pp. 627- 642.

39. Edwin, S., G. Jeyasekaran, R. J. Shakila, and C. Anand. 2004. Sanitary status of

Thoothukkudi Fishing Harbour of Tamil Nadu, India. J. Food Sci. Technol. 41: 530-

533.

40. El-Shafai, S., H. J. Gijzen, FA. Nasr, and F. A, El-Gohary. 2004. Microbial

quality of tilapia reared in faecal- contaminated ponds. Environ. Res. 95: 231-238.

41. El-Zanfaly, H. I., and A. A. Ibrahim. 1982. Occurrence of bacterial pollution

indicators in Boulti (Tilapianilotica Linn) fish. Zernahrungswiss 21: 246-253.

42. Espejo-Hermes, J. 1998. Fish processing technology in the tropics, Tawid

Publications, Philippines. pp. 8.

71

43. Elhadi, N., S. Radu, C. H. Chen, and M. Nishibuch. 2004. Prevalence of

potentially pathogenic Vibrio species in the seafood marketed in Malaysia. J.

Food. Prod. 67: 1469- 75.

44. Falcao, J., A. M. Dias, E. F. Correa, and D. P. Falcao. 2002. Microbiological

quality of ice used to refrigerate foods. Food. Microbiol. 19: 269- 276.

45. Faruque, S. M., and G. B. Nair. 2002. Molecular ecology of toxigenic Vibrio

cholerae. Microbiol. Immunol. 46: 59- 66.

46. Fattal, B., A. Dotan, Y. Tchorsh, L. Parpari, and H. I. Shurval. 1998.

Penetration of E. coli and F2 bacteriophage into fish tissues. Microbio. Immunol.

78: 27- 38.

47. Feldhusen, F. 2000. The role of seafood in bacterial foodborne diseases. Microbes

Infect. 2:1651- 1660.

48. Gram, L., and H. H. Huss. 2000. Fresh and processed fish and shellfish. In Lund,

B.M., T.C. Baird- Parker, G.W. Gould. The microbiological safety and quality of

Food. Volume 1. Aspen Publishers. Gaithersburg. pp. 473- 488.

49. Gyobu, Y., H. Kodama, H. Uetake, and S. Katsuda. 1984. Studies on the

enteropathogenic mechanism of non-O1 Vibrio cholerae isolated from the

environment and fish in Toyama Prefecture. Microbiol. Immunol. 28: 735- 745.

72

50. Hara-Kudo Y., K. Sugiyama, M. Nishiguchi, A. Chowdhury, J. Yatsuyungi, Y.

Ohtomo, H. Konuma, M. Miya, and S. Kumagi. 2003. Prevalence of pandemic

thermo-stable direct hemolysin-producing V. parahaemolyticus O3:126 in seafood

and the coastal environment, J. Appl. Environ. Microbiol. 69: 3883-3891.

51. Hartley, D. M., J. G, Morris, and D. L. Smith. 2006. Hyperinfectivity: A critical

element in the ability of V. cholerae to cause epidemics. PLOS Med. 3: 63-69.

52. Harwood, V. J., J. P. Gandhi, and A.C. Wright. 2004. Methods for isolation and

confirmation of Vibrio vulnificus from oysters and environmental sources.

Microbiol Method. 59: 301-316.

53. Herrera, F., J. A. Santos, A. Otero, and M. L. Garcia-Lopez. 2006. Occurrence of

foodborne pathogenic bacteria in retail prepackaged portions of marine fish in

Spain. J. Appl. Microbiol. 100: 527- 536.

54. Hervio-Health, D., R. R. Colwell, A. Derrien, A. Robert-Pillar, J. M. Fournier,

M. Pommepuy. 2002. Occurrence of pathogenic Vibrios in coastal areas of France.

J. Appl. Microbiol. 92: 1123-1135.

55. Hocking, A. D., G. Arnold, I. Jenson, K. Newton, and P. Sutherland. 1997.

Foodborne microorganisms of public health significance. 5th ed. Institute of Food

Science and Technology, North Sydney. pp. 287-303.

73

56. Hoi, L., I. Dalsgaard, and A. I. Dalsgaard. 1998. Improved isolation of Vibrio

vulnificus from seawater and sediment with cellobiose-colistin agar. Appl. Environ.

Microbiol. 64: 1721-1724.

57. Hosseini, H., A. M. Cheraghali, R. Yalfani, and V. Razavilar. 2004. Incidence of

Vibrio spp. in shrimp caught off the south coast of Iran. Food Control. 15:187-

190.

58. Huss, H. H. 1994. Assurance of seafood quality. FAO Fisheries Technical Paper.

FAO, Rome, Italy. 334: 179.

59. Huss, H. H., L. Ababouch, and L. Gram. (eds) 2004. Assessment and

Management of seafood quality and safety. Fisheries technical Paper. 444: 223.

60. Hwang, D. F., Y. R. Huang, K. P. Lin, T.Y. Chen, S. J. Lin, L.H. Chen, and H.S.

Hsieh. 2004. Investigation of hygienic quality and freshness of marketed fresh

seafood in Northern Taiwan. Shokuhin Eiseigaku Zasshi. 45: 225- 30.

61. Jiang, S. 2001. Vibrio cholerae in recreational beach waters and tributaries of

Southern California. Hydrobiologia. 460:157- 164.

62. Jobling, M. 1995. Environmental Biology of Fishes. Chapman and Hall. London.

pp. 119.

74

63. Johnston, M. D., and M. H, Brown. 2002. An investigation into the changed

physiological state of Vibrio bacteria as a survival mechanism in response to cold

temperatures and studies on their sensitivity to heating and freezing. J. Appl

Microbiol. 92: 1066-1077.

64. Joseph, S., D. T. Ingram, and J. B. Kaper.1982. Vibrio parahaemolyticus and

related Vibrios. Crit. Rev. Microbiol. 10:124.

65. Kagiko, M. M., W. A. Damiano, and M. M. Kayihura. 2001. Characterization of

Vibrio parahaemolyticus isolated from fish in Kenya, East African Med. J. 78:

124- 127.

66. Kam, K. M., T.H. Leung, Ho, Y.Y., Ho, N.K, and T.A. Saw. 1995. Outbreak of

Vibrio cholerae O1 in Hong Kong related to contaminated fish tank water. Public

Health. 109: 389-395.

67. Kannappan, S., R.K. Leela, A. Jacob, and K.S. Manja. 2004. Inhibitory pattern of

seafood-borne bacteria in mackerel against nisapline. J. Food. Sci. Technol.

41:105-108.

68. Karunasagar, I., I. Karunasagar, and A. Paravathi. 2005. Microbial safety of

fishery products. Marine Microbiol: Facets and Opportunities; Ramaiah, N (ed.)

National Institute of Oceanography Goa. pp. 135-144.

75

http://apps.isiknowledge.com/WoS/CIW.cgi?SID=3AdDpDp9gC6J2fc27N9&Func=OneClickSearch&field=AU&val=Johnston+MD&ut=000175677200008&auloc=1&curr_doc=5/9&Form=FullRecordPage&doc=5/9

69. Kaysner, C. A. 2000. Vibrio species. In Lund, B.M., T.C. Baird-Parker, and G.W.

Gould (eds.). The Microbiological Safety and Quality of Food. Vol. II. Aspen

Publishers. Gaithersburg. pp. 1336-1355.

70. Kaysner, C. A., and A. DePaola, Jr. 2001. Vibrio. In Downes, F.P. and Ito. K.

(eds.), Compendium of methods for the microbiological examination of foods.

American Public Health Association, Washington, D.C. pp. 405- 417.

71. Kim, S. H., Field, K.G. Chang, D. S. Wei, C. I. and An, H. J. 2001. Identification

of bacteria crucial to histamine accumulation in Pacific Mackerel during storage. J.

Food. Protect. 64:1556-1564.

72. Kodama, H., M. Hayashi, and Y. Gyobu. 1991. Survey on the contamination of

marine fish with non-01 Vibrio cholerae and Vibrio mimicus and food poisoning

cases by these organisms. Kansenshogaku Zasshi. 65 (2): 193- 9.

73. Kumar, H. S., A. Parvathi, and I. Karunasagar, and I. Karunasagar. 2005.

Prevalence and antibiotic resistance in Escherichia coli in seafood. World J.

Microbiol. Biotechnol. 21: 619- 623.

74. Kumari, S., B. N. Prasad.G. Kumari, A. Quasim. B. K. Sinha. and J. N. Singh.

2001. Microbiological quality of fish, rohu marketed in Patna and its public health

significance. 38: 607- 608.

76

75. Landeiro, C. M., R. C. Alimeida, A. T. Nascimento, J. S. Ferreira, T.

Yano. and P. F. Almeida. 2007. Hazards and critical control points in Brazilian

seafood dish preparation. Food Control. 18: 513- 520.

76. Lartseva, L., IIu. Rogatkina, and S. V. Bormotova. 1997. Microbiological

contamination of fish in the delta of Vultga. Gig. Sanit. 3: 24- 6.

77. Laohaprertthisan, V., A. Chowdhury, U. Kongmuang, S. Kalnauwakul, M.

Ishibashi, C. Matsumoto, and M. Nishibuchi. 2003. Prevalence and serodiversity

of the pandemic clone among clinical strains of Vibrio parahaemolyticus isolated in

southern Thailand. Epidemiol. Infect. 130: 395- 406.

78. Levin, R. E. 2006. Vibrio parahaemolyticus, a notably lethal human pathogen

derived from seafood: a review of its pathogenicity, characteristics, subspecies

characterization and molecular methods of detection. Food Biotechnol. 20: 93-128.

79. Lipp, E.K. and Rose, J.B. 1997. The role of seafood in food-borne diseases in the

United States of America. Rev. Sci. Technol. 16: 620- 40.

80. Maggi, P., S. Carbonara, C. Fico, T. Santantonio, C. Romanelli, E. Sforza, and

G. Pastore. 1997. Epidemiological, clinical and therapeutic evaluation of the Italian

cholera epidemic in 1994. Eur. J. Epidemiol. 13: 95- 7.

81. Marmur, J. 1961. A procedure for isolation of DNA from microorganism.J. Mol.Biol.

3: 208- 218.

77

82. Marshall, S., C.G. Clark, G. Wang, M. Mulvey, M.T. Kelly. and W.M. Johnson.

1999. Comparison of molecular methods for typing Vibrio parahaemolyticus. J. Clin.

Microbiol. 37: 2473- 2478.

83. McIntyre, R. C., T. Tira, T. Flood, and P. A. Blake. 1979. Modes of transmission

of cholera in a newly infected population on an atoll: implications for control

measures. Lancet. 10: 311- 4.

84. Medina, E. 1991. Epidemic of cholera in Chile. Rev. Med. Chil. 119: 943-56.

85. Mintz, E. D., T. Popovic, and P. A. Blake. 1994. Transmission of Vibrio cholerae

O1. In I. K. Wachsmuth, P. A. Blake, and O. Olsvik. (eds.). Vibrio cholerae and

Cholera: Molecular to global perspectives. pp. 88- 93.

86. Mitsuda, T., T. Muto, M. Yamada, N. Koyayashi, M. Toba, Y. Aihara, A. Ito, and

S.Yokota.1998. Epidemiological study of a food borne outbreak of enterotoxigenic

Escherichia coli O25: NM by pulse-field gel electrophoresis and randomly

amplified polymorphic DNA analysis. J. Clin. Microbiol. 36: 625-656.

87. Miwa, N., M. Kashiwagi, F. Kawamori, T. Masuda, Y. Sano, M. Hiroi, and H.

Kurashige. 2006. Levels of Vibrio parahaemolyticus and thermostable direct

haemolysin gene-positive organisms in retail seafood determined by the most

probable number-polymerase chain reaction (MPN-PCR) method. Shokuhin

Eiseigaku Zasshi. 47: 41-45.

78

88. Montes, R., R. Farto, M. J. Perez, S. P. Armada, and T. P. Nieto. 2006.

Genotypic diversity of Vibrio isolates associated with turbout (Scophthalmus

maximus) culture. Res. Microbiol. 157: 487- 495.

89. Moreno, M. L. and M. Landgraf. 1998. Virulence factors and pathogenicity of

Vibrio vulnificus strains isolated from seafood. J. Appl. Microbiol. 84: 747-751.

90. Naidoo, A. and K. Patrick. 2002. Cholera: a continuous epidemic in Africa. J.

Royal Soci. Promo. Health. 122: 89- 94.

91. Nair, B., A. Safa, N. A. Bhuiyan, S. Nusrin, D. Murphy, C. Nicol, M. Valcanis, S.

Iddings, I. Kubuabola, and H. Vally. 2006. Isolation of Vibrio cholerae 01 strains

similar to pre-seventh pandemic El Tor strains during an outbreak of

gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55: 1559-1562.

92. Nair, G., T. Ramamurthy, S. K. Bhattacharya, B. Dutta, Y. Takeda, and D. A.

Sack. 2007. Global dissemination of Vibrio parahaemolyticus serotype O3: K6 and

its serovariants. Clin. Microbiol. Rev. 20: 39- 40.

93. Nickelson, R. I. I, S. McCarthy, and G. Finne. 2001. Fish, crustaceans and

precooked seafoods. In Downes, F.P. and Ito, K., (eds.) Compendium of methods

for the microbiological examination of foods. American Public Health Association.

pp. 497- 505.

79

94. Nortermans, S., and E. Hoornstra. 2000. Risk assessment of Listeria

monocytogenes in fish products: some general principles, mechanism of infection

and the use of performance standards to control human exposure. Int. J. Food.

Microbiol. 62: 223- 229.

95. Novotny, L., R. Halouzka, L. Matlova, O. Vavra, L. Dvorska, M. Bartos, and I.

Pavlik. 2004. Morphology and distribution of granulomatous inflammation in

freshwater ornamental fish infected with Mycobacterium. J. Fish. Dis. 13: 35-42.

96. Oliver, J.D., and J.B. Kaper. 1997. Vibrio species. In Doyle, M. P., L. R.

Beuchat, and T. J. Montville (eds.) Food microbiology: fundamentals and

frontiers. Washington, ASM Press. D.C. pp. 228- 264.

97. Park, M., M. H. Kim, S. T. Choi, Y. M. Kim, K. S. Kim, and D. S. Chang. 2003.

A survey of microbial levels for food in large markets of Busan. Food Sci.

Biotechnol. 12: 274-277.

98. Paz, S., N. Bisharat, E. Paz, O. Kidar, and D. Cohen. 2007. Climate change and

the emergence of Vibrio vulnificus disease in Israel. Environ. Res. 103: 390-

396.

99. Powell, J. L.1999. Vibrio species. Clin. Lab. Med. 19: 537-52.

100. Rabbani, G. H. and W.B. Greenough. 1999. Food as vehicle of transmission of

cholera. J. Diarhoeal. Dis. Res. 17:1- 9.

80

101. Reilly, A. and F. Kaferstein. 1997. Food safety hazards and the application of

the principles of the hazard analysis and critical control point (HACCP) system for

their control in aquaculture production. Aquaculture. Res. 28: 735-52.

102. Riedl, J. and K. Klose. 2002. Vibrio cholerae and cholera: out of water and into

the host. FEMS. Microbiol. Rev. 26: 125-39.

103. Ripabelli, G., M. I. Sammarco, I. Fanelli, and G. M. Grasso. 2004. Detection of

Salmonella, Listeria spp, Vibrio spp and Yesinia entrocolitica in frozen seafood and

comparison with enumeration for faecal indicators: implication for public health.

Systemic. Appl. Microbiol. 16: 531-539.

104. Saha, M. K., P. Dutta and S. P. De. 1999. Possibility of public health hazards by

contamination of toxin producing V. cholerae through fishes reared in sewage fed

fishery. Indian. J. Public Health. 43: 71-72.

105. Said, R., G. Volpin, B. Grimberg, S. R. Friedenstorm, E. Lefler, and S. Stahl.

1998. Hand infections due to non-cholera Vibrios after injuries from St. Peters fish

(Tilipia zillii). J. Hand Sur. British and Eur. 23: 808- 810.

106. Sarkar, B.L., G.B. Nair, K. Banerjee. and S.C. Pal. 1985. Seasonal distribution

of Vibrio parahaemolyticus in freshwater environments and in association with

freshwater fishes in Calcutta. Appl. Environ. 49:132-136.

107. Scoging, A. C. 1992. Illness associated with seafood. Can. Med. Assoc. J. 147:

1344-1347.

81

108. Scoglio, M., A. Di Pietro, A. Mauro, I. Picerno, P. Lagana, and S. A. Delia.

2000. Isolation of Listeria spp., Aeromonas spp., and Vibrio spp. from seafood

products. Ann. Ig. 12: 297-305.

109. Seiberras, S., D. Jarnier, S. Guez, and C. Series. 2000. Mycobacterium marinum

nodular lymphangitis. Presse Med. 29: 2094-2095.

110. Shiraishi, S., K. Takeda, K. Hirata, K. Hayashi, and T. Honda. 1996. Isolation

of Vibrio cholerae in imported frozen seafood and their cholera-enterotoxin

production. Kansenshogaku Zasshi. 70: 175- 179.

111. Snoussi, M., K. Ghaieb, R. Manmoud, and A. Bakhrouf. 2006. Quantitative

study, identification and antibiotics sensitivity of some Vibrionaceae associated to

marine fish hatchery. Ann. Microbiol. 56: 289-293.

112. Subramanian, T. 2007. Effect of processing on bacterial population of cuttle fish

and crab and determination of bacterial spoilage and rancidity developing on

frozen storage. J. Food Processing and Preservation. 31: 13-31.

113. Sumner, J. and T. Ross. 2002. A semi-quantitative seafood safety risk

assessment. Int. J. Food Microbiol. 77: 55-59.

114. Teophilo, G. 2002. Escherichia coli isolated from seafood: toxicity and plasmid

profiles. Int. Microbiol. 5: 11-14.

82

115. Thampuran, S. A. and P.K. Surendara. 2005. Prevalence and characterization of

typical and atypical Escherichia coli from fish sold at retail in Cochin, India. J.

Food Protect. 68: 2208- 2211.

116. Thompson, F. L., T. Lida, and J. Swings. 2004. Biodiversity of Vibrios.

Microbiol. Mol. Biol. Rev. 68: 403- 431.

117. Thompson, F.L., D. Gevers, C. C. Thompson, P. Dawyndt, S. Naser, B. Hoste,

C. B. Munn, and J. Swings. 2005. Phylogeny and molecular identification of

Vibrios on the basis of multilocus sequence analysis. Appl. Environ Microbiol.

71: 5107- 5115.

118. Torres-Vitela, M. R., and E. Fernandez Escartin. 1993. Incidence of Vibrio

parahaemolyticus in raw fish, oysters and shrimp. Rev Latinoam Microbiol.

35: 267-272.

119. Vuddhakul, V., A. Chowdary, Laohaprertthisan, P. Pungrasamee, N.

Patararungrong, P. Thianmontri, M. Ishibashi, C. Matsumoto, and M.

Nishibuchi. 2000. Isolation of a pandemic 03:K6 clone of Vibrio

parahaemolyticus strain from environmental and clinical sources of Thailand.

Appl. Environ. Microbiol. 66: 2685- 2689.

120. Wang, X. H., and K.Y. Leung. 2000. Biochemical characterization of different

types of adherence of Vibrio species to fish epithelial cells. Microbiol. 146: 989-

998.

83

121. Whipple, M. J., and J. S. Rohovec. 1994. The effect of heat and low pH on

selected viral and bacterial fish pathogens. Aquaculture. 123: 179- 189.

122. Wong, C. H. 2003. Detecting and molecular typing of Vibrio parahaemolyticus.

J. Food. Drug Analysis.11: 100-107.

123. Yamai, S., T. Okitsu, and Y. Katsube. 1996. Isolation and incidence of Vibrio

cholerae from river water. Kansenshogaku Zasshi. 70: 1234- 1241.

124. Yano, Y., M. Yokoyama, M. Satomi, H. Oikawa, and S. S. Chen. 2004.

Occurrence of Vibrio vulnificus in fish and shellfish available from markets in

China. J. Food Prod. 67:1617-1623.

125. Zlotkin, A., A. Eldar, C. Ghittino, and H. Bercovier. 1998. Identification of

Lactococcus garvieae by PCR. J. Clin Microbiol. 36: 983- 985.

Internet sites

126. Bacteriological Analytical Manual (BAM). 2004. In http:// www. cfsan.fda.gov

~ebam/bam-9.html.

127. FAO/WHO. 2001. In http://www.who.int/foodsafety/foodborne_disease/general

/en/index.html.

128. FOSRI, 1997. Food Science and Technology Research Institute. Annual Report.

In http://www.unuftp.is/pro99/Massette99-1FF.pdf.

84

129. Robert,T. and K. M. Stadler. 2000. Safe and nutritious seafood in Virgina.

pp.348- 961. In http://www.ext.vt.edu/pubs/foods/348-961/htm.

130. http://www.fao.org/dorcep/meeting/005/x7603e/x7603e0k.htm#bm20.8.6.1.

131. http://vm.cfsan.fda.gov/~mow/chap12.html.

132. http://www.ncbi.nlm.nih.gov/blast.

133. http://www.appliedbiosystems.com/.

85

APPENDICES

86

Appendix 1

BIOCHEMICAL TESTS FOR IDENTIFICATION OF VIBRIO CHOLERAE

(YELLOW COLONIES ISOLATED FROM TCBS AGAR)

(A) Fish bought from local markets (B1: Suva market, B2: Lami market, B3: Laqere market)

(U: Ulavi fish, K: Kawakawa fish, G: gills, A: gut region, S: skin)

Growth in (w/v): Carbohydrate Fermentation

Culture

No.

Regions

Oxidase

Test 0%

NaCl 6%

NaCl 8%

NaCl Lactose Sucrose

V. choleraeDetected/

Not detected

BB2U1A +ve +ve +ve +ve -ve +ve Not

detected

BB2U1G +ve -ve +ve +ve -ve +ve Not detected

Y1

BB2U1S +ve -ve +ve +ve -ve +ve Not detected

BB2U2A +ve +ve +ve +ve -ve +ve Not detected

Y2


Y3 BB2U2A +ve -ve +ve +ve -ve +ve Not detected

Y4 BB2U3G +ve +ve +ve +ve -ve +ve Not detected

Y5 BB2U4A +ve +ve +ve -ve -ve +ve Not detected

Y6 BB2U5A +ve -ve +ve +ve +ve -ve Not detected

BB2U6S +ve +ve -ve -ve -ve +ve Not detected

Y7

BB2U6A +ve -ve +ve +ve -ve +ve Not detected

BB2U7G +ve +ve +ve +ve -ve +ve Not detected

BB2U7S +ve +ve +ve +ve -ve +ve Not detected

Y8

BB2U7A +ve -ve +ve +ve -ve +ve Not detected

Y9 BB2U8A +ve -ve +ve +ve -ve +ve Not detected

Y10


87

BB2U9G +ve -ve +ve -ve -ve +ve Not detected

Y11 BB2K7G +ve -ve +ve +ve -ve +ve Not detected

BB2K8A +ve -ve +ve +ve -ve +ve Not detected

Y12

BB2K8G +ve -ve +ve +ve -ve +ve Not detected



Y13




Y14

BB2K10S +ve -ve +ve +ve -ve +ve Not detected




Y17



BB3U1G +ve +ve +ve +ve N/G N/G Not detected


Y19

BB3U1S +ve +ve +ve -ve -ve -ve Not detected

Y20 BB3U2S +ve +ve +ve +ve N/G N/G Not detected


Y21

BB3U2A +ve +ve +ve +ve -ve -ve Not detected

Y22


BB3U4A +ve +ve -ve +ve -ve +ve Not detected

88

BB3U4S +ve +ve +ve -ve -ve +ve Not detected

Y23

BB3U5S +ve +ve +ve +ve -ve -ve Not detected


BB3U6S +ve +ve +ve -ve -ve -ve Not detected

Y24 BB3U6G +ve +ve +ve +ve -ve N/G Not

detected BB3U7S +ve +ve +ve +ve -ve +ve Not

detected

Y25 BB3U7A +ve +ve +ve +ve -ve -ve Not

detected BB3U8G +ve +ve +ve +ve -ve +ve Not

detected

Y26

BB3U8A +ve +ve +ve +ve +ve +ve Not detected

BB3U9G +ve +ve +ve +ve -ve -ve Not detected

Y27

BB3U9S +ve +ve +ve +ve -ve +ve Not

detected BB3K1A +ve +ve +ve +ve -ve +ve Not

detected

B

Y28

B3K1S +ve +ve +ve +ve -ve +ve Not detected

BB3K1G +ve +ve +ve +ve +ve +ve Not detected

BB3K2A +ve +ve +ve +ve -ve +ve Not detected

Y29

BB3K2G +ve +ve +ve +ve -ve +ve Not detected

Y30

BB3K3S +ve +ve +ve +ve N/G +ve Not detected

BB3K4A +ve +ve +ve +ve -ve -ve Not detected

Y31

BB3K4S (b) +ve +ve +ve +ve -ve +ve Not detected

BB3K5A +ve +ve +ve +ve -ve -ve Not detected

Y32

BB3K5S (b) +ve +ve +ve +ve -ve +ve Not detected


Y33

BB3K6S +ve +ve +ve +ve -ve +ve Not detected

89

BB1U1A +ve +ve +ve -ve -ve -ve Not detected

Y34

BB1U1S +ve +ve +ve +ve -ve +ve Not

detected BB1U2A +ve +ve +ve -ve -ve +ve Not

detected

Y35 BB1U2S +ve -ve +ve +ve -ve +ve Not

detected BB1U3A +ve +ve +ve +ve -ve +ve Not

detected Y36



Y37

BB1U4S (b)

+ve +ve +ve +ve -ve +ve Not detected

BB1U5G +ve -ve +ve -ve -ve +ve Not detected


Y38

BB1U5S +ve +ve +ve +ve N/G +ve Not detected


Y39



Y40



Y41



Y42



Y43


BB1U11A +ve +ve +ve +ve N/G +ve Not detected

BB1U11S +ve +ve +ve +ve N/G +ve Not detected

Y44

BB1U11A +ve +ve +ve +ve N/G +ve Not detected

90

BB1k1S +ve +ve +ve +ve +ve +ve Not detected

Y45

BB1k1A +ve -ve +ve +ve -ve +ve Not detected

BB1k2A +ve -ve +ve +ve -ve +ve Not detected

BB1k2S +ve -ve +ve +ve -ve +ve Not detected

Y46

BB1k2G +ve -ve +ve +ve -ve +ve Not detected

Y47

BB1k3A +ve +ve +ve +ve N/G +ve Not detected


Y48

BB1k4G +ve +ve +ve +ve N/G +ve Not detected

BB1k4S +ve +ve +ve +ve -ve +ve Not detected

Y49


BB1k6G +ve +ve +ve +ve N/G +ve Not detected

BB1k6S +ve +ve +ve +ve -ve +ve Not detected

Y50

BB1k6A +ve +ve +ve +ve -ve +ve Not detected

BB1k7S +ve +ve +ve +ve N/G +ve Not detected

BB1k7G +ve +ve -ve +ve -ve -ve Not detected

Y51

BB1k7S +ve +ve -ve +ve -ve +ve Not detected

BB1k8S +ve +ve -ve +ve -ve +ve Not detected

BB1k8A +ve +ve -ve +ve -ve +ve Not detected

Y52

BB1k8G +ve +ve -ve +ve -ve -ve Not detected

91

FISH BOUGHT FROM ROADSIDES (C1: Vatuwaqa bridge, C2: Bailey bridge, C3: Raiwaqa)

[C: ROADSIDES, U: ULAVI FISH, N: NUQA FISH, G: GILLS, A: GUT REGION, S: SKIN]

Growth in (w/v): Carbohydrate

Fermentation

Culture no.

Regions

Oxidase Test

0%

NaCl

6%

NaCl

8%

NaCl Lactose Sucrose

V. cholerae detected/

not detected

C1N1S +ve +ve +ve +ve -ve +ve Not detected

C1N1A +ve -ve +ve +ve N/G +ve Not detected

Y53

C1N1G +ve -ve -ve -ve -ve +ve Not detected

Y54 C1N3A +ve -ve -ve -ve -ve -ve Not detected

C1N5G (a)

+ve -ve +ve -ve -ve +ve Not detected

Y55

C1N5A +ve -ve +ve -ve -ve +ve Not detected

Y56

C1N6G +ve -ve +ve +ve -ve +ve Not detected

Y57 C1N7G +ve -ve +ve -ve -ve +ve Not detected

Y58 C1N10A +ve -ve +ve -ve -ve +ve Not detected

Y59 C1N10A +ve -ve +ve -ve -ve +ve Not detected

C1U1A +ve -ve +ve -ve -ve +ve Not detected

Y60

C1U1G +ve -ve +ve -ve -ve +ve Not detected

Y61 C1U3A +ve -ve +ve -ve -ve +ve Not detected


Y62


Y63


C1U7S +ve -ve +ve -ve -ve +ve Not detected

Y64


92

Y65 C1U8G +ve -ve +ve -ve -ve +ve Not detected

C2U1G -ve -ve +ve +ve -ve +ve Not detected

C2U1A -ve -ve +ve +ve N/G +ve Not detected

Y66 C2U1S -ve -ve +ve +ve N/G +ve Not

detected C2U2S +ve -ve +ve +ve -ve +ve Not

detected C2U2G +ve +ve +ve +ve -ve +ve Not

detected

Y67

C2U2A +ve -ve +ve +ve -ve +ve Not detected

Y68


Y69


C2U5S +ve -ve +ve -ve -ve -ve Not detected



Y71

C2U6A +ve -ve +ve -ve -ve -ve Not detected


C2N1G +ve -ve +ve -ve +ve +ve Not detected

C2N1A +ve -ve +ve +ve -ve +ve Not detected

Y73


C2N5G +ve -ve +ve +ve -ve +ve Not detected

Y74 C2N5A +ve -ve +ve +ve -ve +ve Not detected

Y75 C2N6G +ve -ve +ve +ve +ve +ve Not detected

Y76 C2N7G +ve -ve -ve -ve -ve +ve Not detected

Y77 C2N10A +ve -ve +ve +ve -ve +ve Not detected

Y78 C2K1A +ve -ve +ve +ve -ve +ve Not detected

C2K2A +ve +ve -ve +ve -ve +ve Not

93

detected Y79

C2K2S +ve -ve +ve -ve -ve +ve Not detected

C2K3G +ve -ve +ve -ve -ve +ve Not detected

Y80

C2K3A +ve -ve +ve +ve -ve +ve Not detected

Y81 C2K5G +ve -ve +ve +ve -ve +ve Not detected




C2K9G +ve -ve +ve +ve -ve +ve Not detected

Y85

C2K9S +ve -ve +ve +ve -ve +ve Not detected

C2K10S +ve -ve +ve +ve -ve +ve Not detected

C2K10G +ve -ve +ve +ve -ve +ve Not detected

Y86

C2K10A +ve -ve +ve +ve -ve +ve Not detected

Y87 C3U3G +ve +ve -ve +ve -ve +ve Not detected

Y88 C3U4A +ve -ve +ve +ve -ve +ve Not detected

C3U6A +ve +ve -ve +ve -ve +ve Not detected

Y89

C3U6S +ve -ve +ve -ve -ve +ve Not detected


Y90


Y91 C3U8G +ve -ve +ve +ve -ve +ve Not detected

Y92 C3U8A +ve -ve +ve +ve -ve +ve Not detected

C3U9S +ve -ve +ve +ve -ve +ve Not detected

Y93


Y94

C3U10G +ve -ve +ve +ve -ve +ve Not detected

94

C3U10S -ve -ve +ve +ve -ve +ve Not detected

C3K1S -ve -ve +ve +ve -ve +ve Not detected

Y95 C3K1G -ve -ve +ve +ve -ve +ve Not detected

C3K3A -ve -ve +ve +ve -ve +ve Not detected

Y96

C3K3G -ve -ve +ve +ve -ve +ve Not detected

C3K5A -ve -ve +ve +ve -ve +ve Not detected

C3K5S -ve -ve +ve +ve -ve +ve Not detected

Y97

C3K5G -ve -ve +ve +ve -ve +ve Not

detected

Y98 C3K7A -ve -ve +ve +ve -ve +ve Not detected



N/ G: NO GROWTH

95

FISH BOUGHT FROM FISH SHOPS (A1: Food Processors, A2: Fresh ’et, A3: Cakaudrove)

[A: FISH SHOPS, U: ULAVI FISH, K: KAWAKAWA FISH, G: GILLS, A: GUT REGION, S:SKIN]


Culture

Nos.

Regions

Oxidase

Test 0%

NaCl

6%

NaCl

8%

NaCl

Lactose Sucrose

V.

cholerae Detected/

Not detected

A1U1G -ve +ve +ve +ve +ve +ve Not detected

A1U1A +ve -ve +ve +ve -ve +ve Not detected

Y101

A1U1S -ve -ve +ve -ve +ve +ve Not detected

A1U2S +ve +ve +ve +ve +ve +ve Not detected

A1U2A +ve +ve +ve +ve +ve +ve Not detected

Y102



Y103

A1U4A -ve +ve +ve +ve +ve +ve Not detected

Y104 A1U5G -ve +ve +ve +ve +ve +ve Not detected



Y107

A1k1S +ve +ve +ve +ve N/G +ve Not detected

Y108 A1k1A +ve -ve +ve +ve +ve +ve Not detected

A1k2S +ve +ve +ve +ve -ve +ve Not detected

A1k2G +ve -ve +ve +ve -ve -ve Not detected

Y109

A1k2A +ve -ve +ve -ve -ve +ve Not detected

A1k8G +ve -ve +ve +ve -ve +ve Not detected

A1k8S +ve +ve +ve +ve -ve +ve Not detected

Y110

A1k8A +ve -ve +ve +ve -ve +ve Not detected

96

Y111 A1k11A -ve +ve +ve +ve +ve +ve Not detected

Y112 A1k13A -ve -ve +ve -ve -ve +ve Not detected

Y113 A1k18A +ve -ve +ve -ve -ve +ve Not detected

A1K19G -ve +ve +ve +ve +ve +ve Not detected

A1K19S -ve -ve +ve -ve -ve +ve Not detected

Y114

A1K19A +ve -ve -ve -ve +ve +ve Not detected

A2N1G +ve +ve -ve +ve -ve +ve Not detected

Y115 A2N1S +ve +ve +ve +ve +ve -ve Not detected

A2N2S +ve +ve -ve +ve -ve +ve Not detected

Y116 A2N2G +ve -ve +ve +ve -ve +ve Not detected

A2N4G +ve +ve -ve -ve -ve +ve Not detected

Y117

A2N4A +ve -ve -ve -ve -ve +ve Not detected

Y118 A2N5S +ve +ve +ve +ve +ve +ve Not detected

Y119 A2K1S +ve -ve +ve +ve +ve +ve Not detected

Y120 A2K2G +ve +ve +ve -ve -ve +ve Not detected

Y121 A2K3S +ve +ve +ve -ve -ve +ve Not detected

A2K6S

+ve -ve +ve +ve +ve +ve Not detected

Y122 A2K6A

+ve -ve +ve +ve +ve +ve Not detected

Y123 A2K7A

+ve -ve +ve +ve -ve -ve Not detected

Y124 A3U1G +ve -ve +ve +ve +ve +ve Not detected

Y125 A3U1A +ve -ve +ve +ve +ve +ve Not detected

Y126 A3U2G +ve -ve +ve +ve +ve +ve Not detected

Y127 A3U3A +ve -ve +ve +ve -ve +ve Not detected

97




Y129 A3U5S +ve -ve +ve +ve -ve +ve Not

detected Y130 A3U6S +ve -ve +ve +ve -ve +ve Not

detected A3U7A

+ve -ve +ve +ve -ve +ve Not

detected

Y131 A3U7S

+ve -ve +ve +ve -ve +ve Not

detected A3U8G +ve -ve +ve +ve -ve +ve Not

detected

Y132 A3U8S +ve -ve +ve +ve -ve +ve Not

detected Y133 A3U9G +ve -ve +ve +ve -ve +ve Not

detected Y134 A3U12S +ve -ve +ve +ve -ve +ve Not

detected Y135 A3U13G +ve -ve +ve +ve -ve +ve Not

detected


Y137 A3U16G +ve -ve +ve +ve -ve +ve Not detected


V. cholerae Reference culture

+ve +ve -ve -ve -ve +ve

N/G: No growth

98

Appendix 2

BIOCHEMICAL TESTS FOR IDENTIFCATION OF VIBRIO PARAHAEMOLYTICUS

[GREEN COLONIES ISOLATED FROM TCBS AGAR]


Culture

Nos.

Regions

Oxidase Test

0% NaCl

6% NaCl

8% NaCl

Lactose Sucrose

V.parahaemolyticus Detected/

Not detected

C3K1A +ve +ve +ve +ve -ve -ve Not detected

C3K1G +ve -ve +ve +ve -ve -ve Detected

G1

C3K1S +ve +ve +ve +ve -ve -ve Not detected


G2

C3K2G

+ve +ve +ve +ve -ve -ve Not detected


G3

C3K4G



C3K5G


G4


G5

C3K7G


C3K7G +ve +ve +ve +ve -ve -ve Not detected

G6

C3K8A +ve -ve +ve +ve +ve -ve Not Detected


G7

C3U1S +ve +ve +ve +ve -ve -ve Not detected

G8

C3U2A

+ve -ve -ve +ve -ve -ve Detected

G9



G10


99


C3U4S

+ve -ve +ve +ve -ve +ve Not detected

G11

C3U4A +ve -ve +ve +ve -ve +ve Not Detected

G12




G13

C3U6S +ve -ve +ve +ve -ve +ve Not detected


C3U8S +ve -ve +ve +ve -ve -ve Detected

G14

C2K1A


G15 C2K1S +ve -ve +ve +ve -ve +ve Not detected

C2U2S +ve -ve +ve +ve +ve -ve Not detected

C2U2G +ve +ve +ve +ve -ve +ve Not detected

G16


G17 C2U5A +ve -ve +ve +ve -ve -ve Detected

C2U2S +ve +ve +ve +ve +ve -ve Not detected

G18

C2U2A +ve +ve +ve +ve +ve -ve Not detected

C2U4G +ve -ve +ve +ve -ve -ve Detected G19

C2U4A +ve -ve +ve +ve -ve -ve Not detected


G20

C2U6A +ve -ve -ve +ve -ve -ve Not detected

C2U8G +ve -ve +ve -ve -ve -ve Not detected

C2U8A +ve -ve +ve +ve -ve -ve Detected

G21

C2U8S +ve -ve +ve +ve +ve -ve Not detected

G22 C2U10G +ve -ve +ve +ve -ve -ve Not detected

100

C2U10S +ve +ve +ve +ve -ve -ve Not detected

C1N1A -ve +ve +ve +ve -ve -ve Not detected

C1N1S +ve +ve +ve +ve +ve -ve Not detected

G23

C1N1G +ve +ve +ve -ve -ve -ve Not detected

G24 C1N2A +ve -ve +ve +ve -ve -ve Detected

C1N2G +ve +ve +ve -ve -ve -ve Not detected

G25

C1N2S +ve +ve +ve -ve -ve -ve Not detected

C1N3A -ve +ve +ve +ve -ve -ve Not detected

G26

C1N3S +ve +ve +ve +ve -ve -ve Not detected

C1N4A +ve -ve +ve +ve -ve -ve Detected G27

C1N4G +ve +ve +ve -ve +ve -ve Not detected

C1N5A +ve +ve +ve +ve -ve -ve Not detected

G28

C1N5G +ve +ve +ve +ve -ve -ve Not detected

C1N6A(a) -ve +ve +ve +ve -ve -ve Not detected

G29

C1N6G +ve -ve +ve +ve -ve -ve Detected


G29

C1N7A +ve +ve +ve +ve -ve -ve Not detected

C1N8A +ve -ve +ve +ve -ve +ve NotDetecte

d

G30


C1N10G +ve -ve +ve +ve -ve -ve Detected G31


C1N11G +ve +ve +ve -ve +ve -ve Not detected

G32

C1N11A +ve -ve +ve +ve +ve -ve Not Detected

101

C1N12S +ve +ve +ve +ve -ve -ve Not detected

G34

C1N12G +ve -ve +ve +ve -ve +ve Not Detected

G35 A2U1A

+ve +ve +ve +ve -ve +ve Not detected

G36

A2U2G +ve +ve +ve +ve -ve +ve Not detected

G37

A2U3A +ve +ve +ve +ve -ve +ve Not detected

G38

A2U4G +ve +ve +ve +ve -ve +ve Not detected

G39

A2U7A -ve +ve +ve +ve -ve +ve Not detected

G40

A2U9S +ve +ve +ve +ve -ve +ve Not detected

A2K1A +ve +ve +ve +ve -ve +ve Not detected

G41

A2K1G(b) -ve +ve +ve +ve -ve +ve Not detected

G42

A2K2S +ve +ve +ve +ve -ve +ve Not detected

A2K3A +ve -ve +ve +ve -ve -ve Detected G43

A2K3S +ve +ve +ve +ve +ve -ve Not

detected G44 A2K4S +ve -ve +ve +ve +ve +ve Not

detected

A2K5G +ve +ve -ve +ve +ve +ve Not detected

G45

A2K5A +ve +ve +ve +ve +ve -ve Not

Detected

G46

A2K8A +ve -ve +ve +ve -ve -ve Detected

G47

A2K9A +ve -ve +ve +ve +ve -ve

Not detected

G48

A1U2S -ve +ve -ve +ve +ve +ve Not detected

G49

A1U3G +ve +ve -ve +ve +ve +ve Not detected

G50

A1U4A +ve +ve -ve +ve +ve +ve Not detected

102

A1U4S +ve +ve -ve +ve +ve +ve Not detected

A1U8S +ve +ve -ve +ve +ve +ve Not detected

G51 A1U8G +ve +ve -ve +ve +ve +ve Not

detected

G52

A1K4S +ve +ve -ve +ve +ve +ve Not detected

A1K6G(a) -ve +ve -ve +ve +ve +ve Not detected

A1K6G +ve +ve -ve +ve +ve +ve Not detected

G53

G57 A1K9G +ve +ve -ve +ve +ve +ve Not

detected

G58

A3K1A +ve +ve -ve +ve +ve +ve Not detected

G59

A3K2A +ve +ve -ve +ve +ve +ve Not detected

G60

A3K8A -ve +ve -ve +ve +ve +ve Not detected

A3K9A +ve -ve +ve +ve -ve -ve Detected

G61 A3K9G -ve +ve -ve +ve +ve +ve Not

detected

A3K10A -ve +ve -ve +ve +ve +ve Not detected

G62 A3K10G -ve +ve -ve +ve +ve +ve Not

detected

A3U4A -ve +ve -ve +ve +ve +ve Not detected

G63 A3U4A -ve +ve -ve +ve +ve +ve Not

detected

G64 A3U7A -ve +ve -ve +ve +ve +ve Not detected

G65 A3U9A -ve +ve -ve +ve +ve +ve Not detected

G66 BB1U1G +ve +ve +ve +ve -ve -ve Not detected

BB1U2G +ve -ve +ve +ve -ve -ve Not detected

103


G67


G68


G69

BB1U5A +ve -ve +ve +ve -ve +ve Not Detected

G70

BB1U5G +ve +ve +ve -ve -ve -ve Not detected

G71



G72 BB1U6S +ve +ve +ve +ve -ve -ve Not

detected

G73


G74


G75



G76 BB1U10A +ve -ve +ve +ve -ve -ve Not

detected

G77


G78


G79

BB1U14G +ve -ve +ve +ve -ve +ve Not detected

G80


G81

BB1K1G +ve +ve +ve -ve -ve -ve Not detected

BB1K2S +ve +ve +ve -ve -ve -ve Not detected

G82 BB1K2G +ve -ve +ve +ve -ve -ve Detected

104

G83

BB1K4G +ve +ve +ve +ve -ve -ve Not detected

G84


G85

BB1K5A +ve -ve +ve +ve -ve -ve Detected

BB1K6S +ve +ve +ve +ve -ve -ve Not detected


G86

BB1K6G +ve +ve +ve +ve -ve -ve Not detected

BB3U1A +ve -ve +ve +ve -ve -ve Detected

G87 BB3U1G +ve +ve +ve +ve -ve -ve Not detected



G88


G89


BB3U4A +ve +ve +ve +ve +ve +ve Not detected


G90


G91



G92


BB3U8G -ve +ve +ve +ve -ve -ve Not detected


G93


105

G94


BB3K1A -ve +ve +ve +ve -ve +ve Not detected

G95

BB3K1S -ve +ve +ve +ve -ve +ve Not detected



G96

BB3K2A +ve -ve +ve +ve -ve -ve Not detected

BB3K3A +ve -ve +ve +ve -ve -ve Detected G97

BB3K3G +ve -ve +ve +ve -ve +ve Not Detected

G98


G99



G100


G101 BB2K1G +ve -ve +ve +ve +ve +ve Not detected

BB2K2S +ve +ve +ve +ve -ve -ve Not detected

G102 BB2K2A +ve -ve +ve +ve -ve -ve Detected



G103



G104 BB2K4A +ve -ve +ve +ve -ve +ve Not

Detected

G105


106

G106


G107




G108 BB2K8G +ve +ve +ve +ve -ve +ve Not

detected

G109


G110


G111


G112


G113



G114 BB2U6G +ve +ve +ve +ve -ve +ve Not

detected


G115 BB2U7A +ve +ve +ve +ve -ve +ve Not

detected

G116


G117


BB2U10A +ve -ve +ve +ve -ve -ve Not detected

G118 BB2U10S +ve -ve +ve +ve -ve +ve Not

detected

G119


G120


107



G121


G122


V. parahaemolyticus Reference culture

+ve -ve +ve +ve -ve -ve

108

chapter 1: introduction and literature...

Documents