Cellular/Molecular

Deletion of Vax1 from Gonadotropin-Releasing Hormone(GnRH) Neurons Abolishes GnRH Expression and Leads toHypogonadism and Infertility

Hanne M. Hoffmann,1 Crystal Trang,1 Ping Gong,1 Ikuo Kimura,2 Erica C. Pandolfi,1 and XPamela L. Mellon1

1Department of Reproductive Medicine and the Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California92093-0674, and 2Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Fuchu-shi183-8509, Japan

Hypothalamic gonadotropin-releasing hormone (GnRH) neurons are at the apex of the hypothalamic-pituitary-gonadal axis that regu-lates mammalian fertility. Herein we demonstrate a critical role for the homeodomain transcription factor ventral anterior homeobox 1(VAX1) in GnRH neuron maturation and show that Vax1 deletion from GnRH neurons leads to complete infertility in males and females.Specifically, global Vax1 knock-out embryos had normal numbers of GnRH neurons at 13 d of gestation, but no GnRH staining wasdetected by embryonic day 17. To identify the role of VAX1 specifically in GnRH neuron development, Vax1flox mice were generated andlineage tracing performed in Vax1flox/flox:GnRHcre:RosaLacZ mice. This identified VAX1 as essential for maintaining expression of Gnrh1.The absence of GnRH staining in adult Vax1flox/flox:GnRHcre mice led to delayed puberty, hypogonadism, and infertility. To address themechanism by which VAX1 maintains Gnrh1 transcription, the capacity of VAX1 to regulate Gnrh1 transcription was evaluated in theGnRH cell lines GN11 and GT1-7. As determined by luciferase and electrophoretic mobility shift assays, we found VAX1 to be a directactivator of the GnRH promoter through binding to four ATTA sites in the GnRH enhancer (E1) and proximal promoter (P), and able tocompete with the homeoprotein SIX6 for occupation of the identified ATTA sites in the GnRH promoter. We conclude that VAX1 isexpressed in GnRH neurons where it is required for GnRH neuron expression of GnRH and maintenance of fertility in mice.

Key words: fertility; GnRH; hypogonadism; transcription; ventral anterior homeobox

IntroductionSexual maturation is associated with increased activity ofgonadotropin-releasing hormone (GnRH) neurons and the re-

sultant pulsatile release of GnRH into the hypothalamic-hypophyseal portal system. Lack of GnRH secretion or absence ofits receptor can lead to lack of or delayed puberty, and infertility

Received July 17, 2015; revised Jan. 5, 2015; accepted Feb. 1, 2016.Author contributions: H.M.H., C.T., P.G., I.K., and P.L.M. designed research; H.M.H., C.T., P.G., I.K., and E.C.P.

performed research; H.M.H., I.K., and P.L.M. contributed unpublished reagents/analytic tools; H.M.H., C.T., P.G., I.K.,and P.L.M. analyzed data; H.M.H., C.T., P.G., and P.L.M. wrote the paper.

This work was supported by National Institutes of Health (NIH) Grants R01 DK044838, R01 HD072754, and R01HD082567 (P.L.M.), the National Institute of Child Health and Human Development/NIH through a cooperativeagreement (U54 HD012303) as part of the Specialized Cooperative Centers Program in Reproduction and InfertilityResearch (P.L.M.), partially supported by P30 DK063491, P30 CA023100, and P42 ES101337 (P.L.M.); The KyotoUniversity Foundation Fellowship Research Grant (I.K.); IMSD NIH Grant R25 GM083275 and a supplement to NIH

R01 HD072754 (E.C.P.); and an Endocrine Society Summer Research Fellowship (C.T.). The University of Virginia,Center for Research in Reproduction, Ligand Assay, and Analysis Core is supported by the Eunice Kennedy ShriverNICHD/NIH (SCCPIR) Grant U54 HD28934. We thank Erica L. Schoeller and Genevieve E. Ryan for reading the paper,Shunichi Shimasaki for assistance with ovarian morphology interpretation, Erica L. Schoeller with testis morphologyevaluation, and Brittainy M. Hereford with staining.

The authors declare no competing financial interests.Correspondence should be addressed to Dr Pamela L. Mellon, University of California, San Diego, 9500 Gilman

Drive, La Jolla, CA 92093-0674. E-mail: pmellon@ucsd.edu.DOI:10.1523/JNEUROSCI.2723-15.2016

Copyright © 2016 the authors 0270-6474/16/363506-13$15.00/0

Significance Statement

Infertility classified as idiopathic hypogonadotropic hypogonadism (IHH) is characterized by delayed or absent sexual matura-tion and low sex steroid levels due to alterations in neuroendocrine control of the hypothalamic-pituitary-gonadal axis. Theincidence of IHH is 1–10 cases per 100,000 births. Although extensive efforts have been invested in identifying genes giving rise toIHH, �50% of cases have unknown genetic origins. We recently showed that haploinsufficiency of ventral anterior homeobox 1(Vax1) leads to subfertility, making it a candidate in polygenic IHH. In this study, we investigate the mechanism by which VAX1controls fertility finding that VAX1 is required for maintenance of Gnrh1 gene expression and deletion of Vax1 from GnRHneurons leads to complete infertility.

3506 • The Journal of Neuroscience, March 23, 2016 • 36(12):3506 –3518

(Mason et al., 1986; Valdes-Socin et al., 2014). The origins ofthese conditions are mainly genetic and in some cases may betraced to alterations of GnRH neuron migration and maturationduring embryonic development. Infertility classified as idio-pathic hypogonadotropic hypogonadism (IHH) is characterizedby delayed or absent sexual maturation, and low gonadotropinand sex steroid levels due to an alteration of the hypothalamic-pituitary-gonadal (HPG) axis (Bianco and Kaiser, 2009; Chan etal., 2009). Sixty percent of IHH cases present with anosmia, de-fective GnRH and olfactory neuron migration, and are classifiedas Kallmann syndrome (Dode et al., 2006; Tsai and Gill, 2006;Pitteloud et al., 2007b). Despite great efforts, �50% of IHH casesstill have unknown genetic origins (Pitteloud et al., 2007a; Biancoand Kaiser, 2009).

In contrast to most CNS neurons, GnRH neurons originate inthe olfactory placode at embryonic day (E)11 in the mouse, mi-grating through the cribriform plate, reaching their final locationin the hypothalamus �E16 (Schwanzel-Fukuda and Pfaff, 1989;Wierman et al., 2011). GnRH neuron migration and final local-ization is restricted to the ventral forebrain. Thus, homeodomaintranscription factors expressed ventrally between E10 and E18could be involved in the correct maturation and migration ofGnRH neurons, making them candidate genes for IHH. This ideais supported by studies of full body and conditional knock-outmouse models in which the absence of specific homeobox genesaffects GnRH neuron numbers and leads to various degrees ofsubfertility or complete infertility (Givens et al., 2005; Diaczok etal., 2011; Larder et al., 2011, 2013). Homeodomain proteins arecharacterized by preferential binding to ATTA sites in target genepromoters and play fundamental roles during embryogenesis.Ventral anterior homeobox 1 (VAX1) is a homeodomain proteinrequired for ventral forebrain development, midline crossing,and eye formation (Hallonet et al., 1998, 1999; Take-uchi et al.,2003; Bharti et al., 2011). Vax1 expression in adulthood is verysparse and is principally restricted to the ventral part of the hy-pothalamus (www.brain-map.org). Vax1 knock-out (KO) micedie soon after birth due to cleft lip/palate, which prevents suck-ling. Due to the overlap in time and localization of Vax1 andGnrh1 during embryogenesis, we hypothesized that VAX1 couldbe important for GnRH neuron development. Indeed we deter-mined that heterozygosity of Vax1 reduced the number ofGnRH-expressing neurons by �50% in the adult brain (Hoff-mann et al., 2014). This reduction in GnRH neuron numbers ledto both male and female subfertility. Although Vax1 heterozygotemales had normal luteinizing hormone (LH), follicle-stimulatinghormone (FSH), and testosterone levels, they presented withpoor sperm quality, possibly due to an unidentified role of VAX1in the testis. On the other hand, Vax1 female heterozygosity led tohigher circulating estrogen and LH in diestrus, which was associ-ated with increased Kiss1 in the anteroventral periventricular nu-cleus. This study identified Vax1 as a potential candidate inpolygenic IHH. Fertility maintenance requires only a handful offunctional GnRH neurons (Herbison et al., 2008), it thereforeremains unclear whether the subfertility of Vax1 heterozygotemice is due to a combined role of VAX1 in GnRH neurons, as wellas other brain areas and/or the testis. To determine the specificrole of Vax1 in GnRH neurons and its relation to IHH we gener-ated Vax1flox mice and crossed them with GnRHcre mice allowingus to identify the specific role of VAX1 in GnRH neurons in vivo.

Materials and MethodsCell culture. GT1-7 (Mellon et al., 1990), GN11 (kindly provided by SallyRadovick, Rutgers University, NJ), NIH3T3 (American Type Culture

Collection), and COS-1 (American Type Culture Collection) cell lineswere cultured in DMEM (Mediatech), containing, 10% fetal bovine se-rum (Gemini Bio), and 1� penicillin-streptomycin (Life Technologies/Invitrogen) in a humidified 5% CO2 incubator at 37°C. For luciferaseassays GT1-7 and GN11 cells were seeded into 24-well plates (Nunc) at100,000 and 35,000 per well, respectively. Cells transfected for quantita-tive real-time PCR (qRT-PCR) were plated into 6-well plates (Nunc) at400,000 (GT1-7) and 140,000 (GN11, NIH3T3) cells per well. Transfec-tion of cells was done �21–24 h after the cells were plated. Cells used forelectrophoretic mobility shift assay (EMSA) and RNA sequencing wereharvested at subconfluency 48 –56 h after seeding in 10 cm dishes(Nunc).

qRT-PCR. Total RNA from GT1-7, GN11, and NIH3T3 cells was ex-tracted using TRIzol (Invitrogen) according to the manufacturer’s rec-ommendations. DNA was eliminated by the use of DNA-free kit(Applied Biosystems), then cDNA was obtained by reverse transcriptionof RNA using iScript cDNA synthesis kit (Bio-Rad). cDNA products weredetected using iQ SYBR Green Supermix (Bio-Rad) on a Q-RT PCR iQ5real-time detection system (Bio-Rad). Primers to the coding sequencesfor mouse Gnrh1 (F: TGCTGACTGTGTGTTTGGAAGGCT, R: TTTGATCCACCTCCTTGCGACTCA), Vax1 (F: CCGGATCCTAGTCCGAGATGCC, R: TCTCCCGGCCCACCACGTAT), Ppia (F: AAGTTCCAAAGACAGCAGAAAAC, R: CTCAAATTTCTCTCCGTAGATGG), andH2afz (F: TCACCGCAGAGGTACTTGAG, R: GATGTGTGGGATGACACCA) permitted amplification of the indicated cDNA products. Data wereexpressed by the 2���C T method by normalizing Gnrh1 and Vax1 to thehousekeeping genes Ppia and H2afz (Livak and Schmittgen, 2001). Dataare expressed as fold-change compared with control, or as indicated in thefigure legends. Data represent mean fold-change � SEM from a minimumof three independent RNA samples for each data point.

Transfection. Transient transfections for luciferase assays, qRT-PCRand EMSA were performed using PolyJet (SignaGen Laboratories) orFugene HD (Roche Diagnostics), according to the manufacturer’s rec-ommendations. For luciferase assays, cells were cotransfected as indi-cated in the figure legends, with 150 ng/well luciferase reporter plasmidsas previously described (Nelson et al., 2000; Iyer et al., 2010; Larder et al.,2011) and 100 ng/well thymidine kinase-�-galactosidase reporter plas-mid as an internal control for transfection efficiency. Cells were cotrans-fected with expression vectors containing Vax1 or Vax1-Flag in a CMV6backbone (CMV; True Clone, Origene) or Six6 in a pcDNA3.1 backbone(Larder et al., 2011). To equalize the amount of DNA transfected intocells, we systematically equalized plasmid concentrations by adding vary-ing concentrations of the appropriate empty vector.

To specifically knock down Vax1, GT1-7 cells seeded in 6-well plateswere transfected with 4 ng/well of Vax1 siRNA or scrambled siRNA(Santa Cruz Biotechnologies) using the siRNA reagent system (SantaCruz Biotechnologies) following the manufacturer’s instructions. Cellswere harvested 32 h after the start of transfection.

Luciferase assay. Cells were harvested 21 h after transfection in lysisbuffer(100 mM potassium phosphate, pH 7.8, and 0.2% TritonX-100). Luciferase and �-galactosidase assays were performed as pre-viously described (Givens et al., 2005). Luciferase values are normal-ized to �-galactosidase values to control for transfection efficiency.Values are normalized to pGL3 or corresponding backbone of expres-sion plasmid as indicated in the figure legends. Data represent themean � SEM of at least three independent experiments done intriplicate.

Cytoplasmic and nuclear extracts. COS-1 cells were scraped in hypo-tonic buffer (20 mM Tris-HCl, pH 7.4, 10 mM NaCl, 1 mM MgCl2, 10 mM

NaF, 1 mM phenylmethylsulfonyl fluoride, 1� protease inhibitor cock-tail; Sigma-Aldrich)and left on ice to swell. Cells were lysed and nucleiwere collected by centrifugation (4°C, 1700 � g, 4 min). Supernatant wascollected and snap frozen until use for Western blot. Nuclear proteinswere extracted on ice for 30 min in hypertonic buffer [20 mM HEPES, pH7.9, 20% glycerol, 420 mM KCl, 2 mM MgCl2, 10 mM NaF, 0.1 mM EDTA,0.1 mM EGTA, 1� protease inhibitor cocktail (Sigma-Aldrich), and 1 mM

phenylmethylsulfonylfluoride]. Debris was eliminated by centrifugation(4°C, 20,000 � g, 10 min), and supernatant was snap-frozen and stored

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3507

at �80°C until use. Protein concentration was determined using theBio-Rad Protein Assay.

Western blotting. Cytoplasmic and nuclear proteins were dissolved anddenatured in loading buffer. Ten micrograms of protein were separatedby 12% SDS-PAGE. Proteins were transferred to a polyvinylidene fluo-ride membrane (Millipore), washed in PBS 0.05% Tween 20 (PBS-T),followed by blocking in 3% nonfat dry milk (Apex, Bioresearch Products,Genesee Scientific) dissolved in PBS-T. Primary antibodies were pre-pared in 1% milk dissolved in PBS-T and incubated overnight at 4°C withgentle agitation. Goat anti-mouse (1:1000; Santa Cruz Biotechnology,SC-2005) horseradish peroxidase (HRP)-conjugated secondary anti-body was incubated at room temperature for 2 h. Antibody binding wasdetected by enhanced chemiluminescence (Thermoscientific). Immuno-blotting was performed using primary antibodies against: mouse anti-DKK (Flag antibody, 1:3000; Origene, TA50011), mouse TATA-bindingprotein (TBP; 1:500; Abcam, AB818), and mouse GAPDH-HRP (1:2000;Abcam, 9482). Image visualization and preparation was performed usingImageJ (NIH Image).

Electrophoretic mobility shift assay. Oligonucleotide probes are listed inFigure 6D. All synthetic oligonucleotides were made by IDT. Annealeddouble-stranded oligonucleotides (1 pmol/�l) were end-labeled with T4polynucleotide kinase (New England Biolabs) and [� 32P]ATP (7000 Ci/mmol; MP Biomedicals). Probes were purified using Micro Bio-Spin 6Chromatography Columns (Bio-Rad). Binding reactions contained 2 �gnuclear protein and 1 fmol of labeled probe in 10 mM HEPES, pH 7.9, 25mM KCl, 2.5 mM MgCl2, 1% glycerol, 0.1% Nonidet P-40, 0.25 mM

EDTA, 0.25% BSA, 1 mM dithiothreitol, and 350 ng poly(dI-dC). Forcompetition experiments, 100-fold excess cold competitor probes wereadded. For supershift experiments, 2 �g of mouse anti-DKK (Flag anti-body; Origene, TA50011) or 2 �g of normal mouse IgG (Santa CruzBiotechnology, sc2025) were added to the reaction. Samples were incu-bated for 20 min at room temperature before loading on a 5% non-denaturing polyacrylamide gel in 0.25� Tris-borate EDTA buffer. Gelswere run for 2 h at 200 V, dried under vacuum, and exposed to film for2–5 d at room temperature.

Mouse breeding. All animal procedures were performed in accordancewith the UCSD Institutional Animal Care and Use Committee regula-tions. Mice were group-housed on a 12 h light/dark cycle with ad libitumchow and water. Vax1tm1Grl (Bertuzzi et al., 1999), here referred to asVax1 mice, were kindly provided by Dr Bharti (National Institutes ofHealth, Bethesda, MD). Vax1flox mice were generated from the KO allelewith conditional potential Vax1tm1a(KOMP)Mbp obtained from KOMP(UC Davis, Knock-Out Mouse Project, www.komp.org). Vax1 knock-out first mice (Vax1tm1a(KOMP)Mbp mice) were crossed with a flpasemouse (Rodríguez et al., 2000; http://jaxmice.jax.org/strain/003800.html) to generate a Vax1 conditional KO allele, here referred to asVax1flox mice. Vax1flox genotyping was performed with Vax1flox forward:5�GCCGGAACCGAAGTTCCTA 3�; Vax1wt forward: 5�CCAGTAAGAGCCCCTTTGGG 3�, reverse 5� CGGATAGACCCCTTGGCATC 3�.Vax1flox mice were crossed with GnRHcre (Wolfe et al., 2008) to generateVax1flox:GnRHcre mice. For lineage tracing Rosa-LacZ (Soriano, 1999;http://jaxmice.jax.org/strain/003309.html) or Rosa-YFP (Srinivas et al.,2001) reporter mice were used. All mice were kept on a C57BL back-ground. Mice were killed by CO2 or isoflurane (Vet One, Meridian)overdose and decapitation.

Determination of pubertal onset and estrus cyclicity. These procedureswere described previously in detail (Hoffmann et al., 2014). To assessestrous cyclicity, vaginal smears were performed daily between 9:00 and11:00 A.M. on 3- to 5-month-old mice by vaginal lavage.

Timed mating. Each heterozygote female mouse was housed with aheterozygote male mouse, and vaginal plug formation was monitored. Ifa plug was present, the day was noted as day 0.5 of pregnancy and used tocollect embryos for timed mating at E13.5, E15.5, and E17.5.

Fertility assessment. At 12–15 weeks of age, virgin Vax1flox (control),Vax1flox/�:GnRHcre (cHET) and Vax1flox/flox:GnRHcre (cKO) mice werehoused in pairs. The number of litters produced in 90 d was recorded.

Hormone levels and GnRH and Kisspeptin-10 challenges. Tail blood wascollected from male and female metestrus/diestrus littermates. Ten min-utes after receiving an intraperitoneal injection of 1 �g/kg GnRH in

physiological serum, or 20 min after receiving an intraperitoneal injec-tion of 3 mmol kisspeptin-10 in physiological serum, a second collectionof tail blood was performed. The total volume of blood collected did notexceed 100 �l. Blood was allowed to clot for 1 h at room temperature,and then centrifuged (15 min, 2600 � g). Serum was collected and storedat �20°C before ELISA analysis of LH and FSH. Blood was collectedbetween 9:00 A.M. and 12:00 P.M. Samples were run as singlet onMILIPLEX (#MPTMAG-49K, Millipore). LH: lower detection limit: 5.6pg/ml, intra-ACOV 15.2, and inter-ACOV 4.7%. FSH: lower detectionlimit: 24.9 pg/ml, intra-ACOV 13.7, and inter-ACOV 3.9%. Estradiol wasmeasured at the University of Virginia, Center for Research in Reproduc-tion, Ligand Assay and Analysis Core. Lower detection limit: 3.6 pg/ml,6.1 intra-ACOV, and inter-ACOV 8.9%.

Embryo collection. Embryos were generated through timed-mating.For immunohistochemistry (IHC), embryos were fixed in 60% ethanol,30% formaldehyde, and 10% acetic acid, overnight at 4°C, then dehy-drated in 70% ethanol before paraffin embedding. Sagittal sections(10 �m) were cut on a microtome and floated onto SuperFrost Plus slides(Thermo Fisher Scientific).

Immunohistochemistry. IHC was performed as previously described(Hoffmann et al., 2014), with the only modification being antigen re-trieval by boiling the samples for 10 min in 10 mM sodium citrate. Briefly,the primary antibody used was rabbit anti-GnRH (1:1000; ThermoFisher Scientific, PA1-121) or rabbit anti-GnRH (1:1000; Novus, NBP2-22444). GnRH-positive neurons were counted throughout the brain.The nasal, cribriform plate, and hypothalamic regions were counted sep-arately in the embryo, but the whole brain was counted for the adult. Forlineage tracing, LacZ expression was detected with a chicken anti-LacZprimary antibody (1:1000; Abcam, ab9361) or yellow fluorescent protein(YFP) expression was detected with a rabbit-anti YFP primary antibody(1:500; Abcam, ab62341). Texas Red (Vector Laboratories) was used tocounterstain sections as directed by the manufactures instructions.

Collection of uterus, ovary, testis, and gonadal histology. Ovaries anduteri from diestrus females and testes from males were dissected andweighed from animals of 2.8 – 4 months of age. Ovaries and testes werefixed for 1.5 h at room temperature and O/N at 4°C, respectively, in 60%ethanol, 30% formaldehyde, 10% glacial acetic acid. Gonads were paraf-fin embedded, serially sectioned at 10 �m, and stained with hematoxylinand eosin (H&E) (Sigma-Aldrich). Histology was examined, and thenumber of corpora lutea in the ovaries recorded and presence of sperm inthe testis assessed.

Statistical analysis. Statistical analyses were performed using eitherStudent’s t test, one-way ANOVA or two-way ANOVA, followed by posthoc analysis by Tukey or Bonferroni as indicated in figure legends, withp � 0.05 to indicate significance.

ResultsCorrect GnRH neuron development requiresVAX1 expressionPreviously, we have shown that adult Vax1 heterozygote (HET)mice had a �50% reduction of GnRH neurons leading to subfer-tility (Hoffmann et al., 2014). As Vax1 is highly expressed in theanterior ventral forebrain between E8 and E18 (Hallonet et al.,1998, 1999), we hypothesized that absence of Vax1 during devel-opment would be responsible for the reduction of GnRH neu-rons in the adult. To test this hypothesis, we collected Vax1wild-type (WT), HET, and KO embryos at E13.5 and E17.5, andcounted the number of GnRH neurons by immunohistochemis-try. At E13.5, GnRH neuron counts were comparable in Vax1WT, HET, and KO embryos (Fig. 1A–D), although a slight, yetstatistically significant, decrease in the number of GnRH neuronsat the cribriform plate (crib. plate) was found in the HET em-bryos (Fig. 1B,C). In contrast, at E17.5, Vax1 KO embryos exhib-ited a complete loss of GnRH-expressing neurons in the brain(Fig. 1E–H). Counting GnRH neurons in the nasal placode area(nose), cribriform plate (crib. plate), and hypothalamic area(hypo, Fig. 1G) revealed that GnRH neurons were present at

3508 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1

comparable numbers in the nose area in WT and HET mice, whereasa slightly reduced number of GnRH neurons were found in thecribriform plate (crib. plate). Remarkably, only 16% of the expectednumber of GnRH neurons was detected in the hypothalamic area inVax1 HET (Fig. 1G). In the entire head, Vax1 HET mice had a 48%reduction in the number of GnRH neurons (Fig. 1H), identifying adose-dependency on Vax1 for correct GnRH neuron populationmaintenance. Furthermore, GnRH staining in the median eminencewas decreased in the HET and absent in the KO (Fig. 1F). The wholehead was systematically analyzed for GnRH neurons, and no ectopiclocalization of the neurons was observed.

Deletion of Vax1 in GnRH neurons abolishesGnRH expressionTo determine whether the loss of GnRH neurons in Vax1 KO atE17.5 was due to loss of VAX1 expression within GnRH neuronsas opposed to loss of VAX1 expression in the cells of the environ-ment through which they migrate, we generated Vax1flox mice

(Fig. 2A,B) and crossed them with GnRHcre mice (Wolfe et al.,2008), allowing for specific deletion of VAX1 in GnRH neurons.GnRH-expressing neurons were counted in adult Vax1flox/flox:GnRHcre mice [conditional KO (cKO)]. Only a couple of GnRH-expressing neurons were identified in the whole cKO brain andno staining at the median eminence was detected (Fig. 2C, me-dian eminence). No differences in GnRH neuron counts wereobserved between males and females and the data were pooled forcounts of every second section: control: 275.9 � 61.8; cKO: 2.8 �1.3; Student’s t test, p 0.0003, n 5– 6.

The absence of GnRH staining could arise from either a lack ofGnRH gene expression (Livne et al., 1993) or GnRH neurondeath (Diaczok et al., 2011). To determine the destiny and timingof the loss of GnRH-expressing cells in the cKO, we first askedwhether recombination had taken place at E13.5, a time pointwhen full-body Vax1 KO embryos had normal GnRH neuronnumbers (Fig. 1D). To detect recombination, we performed IHCfor YFP using the floxed-stop YFP cassette inserted in the ROSA

Figure 1. E17.5 Vax1 KO brains are depleted of GnRH neuron staining. Vax1 WT, HET, and KO embryos at E13.5, n 2–5 (A–D) and E17.5 d, n 3– 4 (E–H ) were processed for IHC staining forGnRH. A, E, Green boxed areas on the drawings of the sagittal mouse head sections to the left of the panels indicate where the B and F images were taken. me, Median eminence; pit, pituitary; op,olfactory placode; cp, cribriform plate. The number of GnRH-stained neurons was counted in different subregions of the brain (C, G) and in the whole brain (D, H ). Crib. plate, Cribriform plate; hypo,hypothalamus. Statistical analysis by two-way ANOVA followed by Bonferroni (C, G) and one-way ANOVA compared with WT (D, H ). *p 0.05, **p 0.01, ***p 0.001; n 3– 4 embryos. Scalebars, 100 �m.

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3509

gene as a Cre-dependent reporter (Srinivas et al., 2001). We de-tected YFP expression at E13.5, showing recombination in GnRHneurons had taken place (Fig. 2D). To establish a time frame for theloss of GnRH expression in cKO mice (Fig. 2C), we counted GnRHneurons at E15.5 in WT and cKO mice. In agreement with GnRHneuron numbers in the Vax1 KO at E13.5 (Fig. 1D), we found com-parable GnRH neuron numbers in WT and cKO E15.5 embryos(Fig. 2E). Every second 10 �m section was counted and stained forGnRH. GnRH neuron numbers were as follows: WT 538 � 108,cKO 415 � 35, n 2–3; Student’s t test, p 0.827). Finally, todetermine whether GnRH neurons had died or survived but stoppedexpressing GnRH in adulthood (Fig. 2C), we performed GnRHlineage tracing in mice with Vax1 deleted in GnRH neurons(Vax1flox/flox:GnRHcre:Rosa LacZ mice) and controls (GnRHcre:Rosa

LacZ mice). LacZ staining in the adult brain of GnRHcre:Rosa LacZmice and Vax1flox/flox:GnRHcre:Rosa LacZ mice was indistinguish-able, showing that deletion of Vax1 in GnRH neurons abolishedGnrh1 gene expression but that the neurons themselves survive (Fig.2F). To determine whether GnRH neurons migrated differently inthe cKO, we evaluated the localization of LacZ expression through-out the brain. We observed GnRHcre driven expression of Rosa LacZin non-GnRH neuron expressing areas, as previously described foranother GnRHcre mouse (Yoon et al., 2005), as well as in other un-identified cells (data not shown). Despite this, we were able to deter-mine that there was no difference in GnRH neuron localization inGnRHcre:Rosa LacZ and Vax1flox/flox:GnRHcre:Rosa LacZ mice, withthe exception of the area close to the suprachiasmatic nucleus(SCN), where a tendency for GnRH neurons to migrate slightly fur-

Figure 2. Vax1flox/flox:GnRHcre mice have no GnRH-expressing neurons. A, Strategy for generating the Vax1flox/flox:GnRHcre mouse. The Vax1 knock-out first mouse was crossed with a flpase mouseto create the conditional allele, then that Vax1flox mouse was crossed with a GnRHcre mouse to create a homozygous Vax1flox/flox with the GnRHcre as a heterozygous allele. B, Genotyping for the floxedallele (Fl). C, IHC of GnRH in adult male Vax1flox/flox (WT) and Vax1flox/flox:GnRHcre (cKO) mice. Arrow indicates where GnRH staining is expected to be at the median eminence. D, GnRH neuron lineagetracing in GnRHcre:RosaYFP at E13.5; arrow indicates YFP expression. E, IHC of GnRH in E15.5 WT and cKO; arrows indicate GnRH neurons. Green boxed areas on the drawings of the sagittal mouse headsections to the left of the panels (D, E) indicate where the image was taken. F, Lineage tracing in adult female GnRHcre:RosaLacZ and Vax1flox/flox:GnRHcre:RosaLacZ (cKO:RosaLacZ) hypothalamus. G,Comparison of GnRHcre:RosaLacZ driven LacZ-expressing cell localization in WT and cKO:RosaLacZ mice (n 3). Nucl acc, Nucleus accumbens; MPOA, medial preoptic area; SCN, suprachiasmaticnucleus. Scale bars, 100 �m.

3510 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1

ther posterior in Vax1flox/flox:GnRHcre:Rosa LacZ mice was noted(Fig. 2F).

Vax1flox/flox:GnRHcre mice are hypogonadalAbsence of GnRH or its receptor results in delayed puberty, hy-pogonadism and infertility because of dramatic reductions incirculating LH and FSH (Gibson et al., 1994; Gill et al., 2008). Toassess the impact of lack of GnRH expression in Vax1flox/flox:Gn-RHcre males (cKO), progression through puberty was assessed.We found that Vax1flox/flox:GnRHcre males had a micropenis (Fig.3A; cKO) and did not achieve puberty, as determined by prepu-tial separation (Korenbrot et al., 1977), or until 56.67 � 9.60 d ofage (no preputial separation observed at 9 weeks of age in 2 of theevaluated males not included in the average; one-way ANOVA,p 0.0002, n 3–7), whereas littermate controls had preputialseparation at 30.43 � 0.75 d of age and cHET males at 29.83 �1.3 d of age. As expected, the absence of GnRH-expressing neu-rons resulted in adult hypogonadism (Fig. 3B; cKO), and absenceof all stages of spermatogenesis in the testis (Fig. 3C, yellow ar-row), whereas cHET male testes and seminal vesicles were indis-tinguishable from WT (Fig. 3C). Testicular development relies onLH and FSH release from the pituitary in response to GnRH(Schinckel et al., 1984). Indeed, Vax1flox/flox:GnRHcre males hadextremely low circulating FSH and LH levels (Fig. 3D). Interest-ingly, there was a tendency for reduced LH in the cHET males,whereas FSH was close to WT levels (Fig. 3D). Finally, to confirmthat the lack of circulating LH and FSH originated at the levelof the GnRH neurons, we performed GnRH and Kisspeptin(Kiss-10) challenges. The pituitaries of WT, cHET and cKO were

able to respond to a GnRH challenge, confirming that the mech-anism for low LH was upstream of the pituitary (Fig. 3E). How-ever, a kisspeptin challenge, which acts on the KISS1 receptorsexpressed by GnRH neurons to stimulate GnRH release, was un-able to elicit LH increase in the cKO mouse, localizing the defectof pituitary hormone release to the level of the GnRH neuron(Fig. 3F).

The fertility of Vax1flox/flox:GnRHcre females was next assessed.Vax1flox/flox:GnRHcre females had delayed vaginal opening (Fig.4A), an external marker of pubertal onset in females. Vaginalopening in WT occurred at 29.29 � 0.99, cHET females at30.33 � 0.67 d of age, whereas opening occurred in cKO at 49.6 �5.20 d of age (one-way ANOVA, p 0.00041, n 3–7). Thedevelopment and function of the ovary relies on LH and FSHrelease from the pituitary and absence of gonadotropic hormonerelease leads to hypogonadism (Mason et al., 1986; Gibson et al.,1994). Indeed, Vax1flox/flox:GnRHcre females were hypogonadal(Fig. 4B), with an average reduction in ovary size compared withWT of 58% (WT 13.48 � 2.27 mg; cKO 5.62 � 2.0 mg; Student’st test, p 0.026, n 6). In addition, we observed a 92% reductionin the weight of the uterine horn (WT 73.06 � 11.93 mg; cKO5.59 � 2.72 mg; n 6, Student’s t test, p 0.0003). Ovarianmorphology was evaluated by H&E staining. The WT and cHETmice presented with all the expected stages of follicular develop-ment and corpora lutea (CL), an ovarian marker of ovulation(Fig. 4C). In contrast, the cKO ovaries had a high accumulation ofprimary follicles, some presenting with the expected granulosacell layer (Fig. 4C, black arrows), and some without (Fig. 4C,yellow arrows). Late stage primary follicles, secondary follicles,

Figure 3. Vax1flox/flox:GnRHcre males have a micropenis and are hypogonadal. A, Image of 6-week-old WT, cHET and cKO males. Scale bar, 0.5 cm. B, Testes of adult mice. Scale bar, 0.5 cm. C, H&Estaining of testes from adult WT, cHET, and cKO males. Scale bar, 10 �m. WT and cHET males have a well defined penis (white arrow), preputial separation (WT, cHET), full size testes, seminal vesiclesand normal spermatogenesis, whereas cKO have a micropenis (white arrow), delayed preputial separation, very small testes and seminal vesicles, as well as an absence of spermatogenesis. D, Basalcirculating LH and FSH levels. One-way ANOVA compared with control. *p 0.05. E, Circulating LH levels after GnRH and (F ) kisspeptin-10 (kiss-10) challenges. Numbers over the histogram indicatefold-change after GnRH or Kiss-10 challenge; n 4 – 8.

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3511

and corpora lutea were not observed in the cKO (Fig. 4C). Theabsence of corpora lutea indicates abnormal progression throughthe estrous cycle and absence of an LH surge. To determinewhether cKO females progressed correctly through the estrouscycle, vaginal smears were collected daily for 25 d in adult mice.WT females progressed through the estrous cycle in 5.95 � 0.31 d(n 7), whereas cHET females required an average of 8.2 � 0.5 dto complete one cycle (n 11; Fig. 4D,E). In contrast, cKOfemales remained in diestrus during the entire 25 d of monitoring(cycle length �25 d, n 6; Fig. 4D,E). Indeed, circulating di-estrus LH and FSH levels were strongly reduced in cKO femalescompared with WT and cHET females (Fig. 4F), indicating anabsence of GnRH release at the median eminence. Estrogen levelswere assessed in diestrus. Due to the low levels of circulatingestrogen in diestrus, none of the cKO samples, and most of theWT and cHET samples were below detection limit of the assay(data not shown). Finally, to confirm that the lack of circulatingLH and FSH originated at the level of the GnRH neurons, weperformed GnRH and Kisspeptin (Kiss-10) challenges. As ex-pected, LH levels were induced in response to a GnRH challenge(Fig. 4G), but not a kisspeptin challenge (Kiss-10; Fig. 4H), con-firming that the very low levels of circulating LH and FSH weredue to a defect in the release of GnRH by GnRH neurons in cKOfemales.

Finally the fertility of cKO was assessed. Indeed, hypogonad-ism of males and females led to complete infertility, and no litterswere recovered from either cKO males or cKO females eachpaired with WT mates during a 90 d fertility study, whereas WTto WT matings produced an average of 2.25 � 0.48 litters in thistime frame (n 3– 4). Interestingly, there was no obvious infer-tility phenotype observed when pairing cHET males or femaleswith a WT; however, only one-third of the cHET to cHET mat-

ings generated litters within 90 d, indicating that these mice aresubfertile.

VAX1 is expressed in GnRH neurons where it directlyregulates Gnrh1 transcriptionThe absence of GnRH expression in Vax1flox/flox:GnRHcre:RosaLacZ mice, indicates that VAX1 might regulate the GnRH pro-moter. To explore this possibility, we asked whether Vax1 wasexpressed in two model GnRH cell lines, the immature GnRHcells GN11 (Radovick et al., 1991), and the mature GnRH cellsGT1-7 (Mellon et al., 1990). We performed qRT-PCR in GN11,GT1-7, and the mouse fibroblast cell line, NIH3T3 (3T3). Vax1was highly expressed in GT1-7 cells, whereas no Vax1 wasdetected in GN11 or NIH3T3 cells (Fig. 5A). Comparable re-sults were confirmed by RNA sequencing in these same celllines (data not shown). Using a Vax1 siRNA to knock downendogenous Vax1 from GT1-7 cells, we identified a decrease inVax1 transcription at the same time point as an increase inGnrh1 transcription (Fig. 5B, left; Vax1 knock-down), indicat-ing that VAX1 is a repressor of Gnrh1 transcription. Consis-tent with this finding, overexpression of Vax1 from anexpression plasmid transfected into GT1-7 cells repressed en-dogenous Gnrh1 levels (Fig. 5B, right). In contrast, overex-pression of Vax1 in GN11 cells led to a detectable increase inendogenous Gnrh1 (Fig. 5B, right; Vax1 overexpression). Itshould be noted that although GN11 and GT1-7 cells are ex-cellent in vitro models of immature and mature GnRH neu-rons, respectively, these remain cell lines that may notrecapitulate all of the characteristics of GnRH neurons in vivo.However, these cell lines are very useful tools to understandgene transcription regulation in GnRH neurons and to ad-vance our understanding of GnRH neuron function.

Figure 4. Vax1flox/flox:GnRHcre females have delayed pubertal onset and are hypogonadal. A, Pubertal onset was determined by vaginal opening (WT and cHET, white arrow). Panel shows imagesof 6-week-old females. Scale bar, 0.5 cm. B, Ovaries and uteri were collected from 25-week-old females. Scale bar, 0.5 cm. C, H&E-stained ovary. CL, Corpora lutea. Black arrows show stage 2primordial follicles with the expected granulosa cell layer (black arrows), and some without (yellow arrows). Scale bar, 0.5 mm. D, Estrus cycling was monitored daily in adult 12- to 20-week-old WT,cHET, and cKO mice. M, Metestrus; E, estrus; P, proestrus; D, diestrus. E, Representative cell morphology for 5 d in WT and cKO females. F, Diestrus circulating LH and FSH levels. One-way ANOVA;**p 0.01, ***p 0.001. Circulating LH levels after (G) GnRH and (H ) kisspeptin-10 (kiss-10) challenges. Numbers over the histograms indicate fold-change after GnRH or Kiss-10 challenge.n 6 –11.

3512 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1

Figure 5. VAX1 regulates Gnrh1 transcription through the GnRH enhancer 1 and promoter. Levels of Vax1 mRNA were determined by A, qRT-PCR in a mature GnRH cell line (GT1-7), an immatureGnRH cell line (GN11), and NIH3T3 fibroblasts (3T3). The horizontal bar indicates lowest detectable RNA level. n 6 – 8. B, GT1-7 cells were transfected with siRNA containing a scrambled or Vax1sequence. Endogenous RNA levels of Vax1 or Gnrh1 were determined by qRT-PCR. Data represent fold-change compared with scrambled siRNA; N 3–5 in duplicates. Statistical analysis byStudent’s t test compared with control. *p 0.05, **p 0.01. C, Left, GT1-7 cells were transfected with a Vax1-expression vector (Vax1, black hatched) and its empty vector (control, black). Right,GN11 cells were transfected with Vax1-expression vector (Vax1, black hatched) and its empty vector (control, black). Data represent fold-change compared with (Figure legend continues.)

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3513

To identify the region of the GnRH promoter where VAX1acts, we used a 5 kb rat GnRH promoter driving luciferase. Adose–response study was conducted by cotransfecting the 5 kbGnRH promoter into GN11 and GT1-7 cells with increasingVax1 concentrations. Twenty-one hours after transfection,VAX1 increased GnRH-promoter driven luciferase transcriptionin GN11 cells and reached maximal effect at 20 ng of Vax1 (Fig.5C, left). In contrast, VAX1 repressed Gnrh1 transcription inGT1-7 cells (Fig. 5C, right). Maximal repression was observed at50 ng of Vax1 (Fig. 5C). To avoid nonspecific transcriptional

effects due to an excessive amount of VAX1, we chose to conductfurther studies with 10 or 20 ng, producing �70% of the maximaleffect. Interestingly, VAX1 regulated the Gnrh1 promoter oppo-sitely in the two GnRH cell lines depending on their state ofmaturation, perhaps since GT1-7 cells have ample endogenousVax1, whereas GN11 cells lack Vax1 entirely. Another possibleexplanation for this difference could be that VAX1 uses differentbinding sites in the Gnrh1 promoter to regulate transcription atdifferent developmental stages. A characteristic of homeodomainproteins is their capacity to bind ATTA sites in the promoterregion of their target genes. We identified numerous ATTA andATTAA sequences in the 5 kb GnRH promoter region. To narrowdown the potential binding sites for VAX1, we used a series of 5�truncations of the 5 kb GnRH promoter (Fig. 5D; Iyer et al.,2010). In GN11 cells, elimination of enhancer 3 (E3) abolishedthe capacity of VAX1 to regulate transcription (Fig. 5D, left).However, elimination of enhancer 2 (E2) restored induction oftranscription by VAX1 on both the �2438 and �2168 bp report-ers, suggesting that E3 contains sites that affect VAX1-mediatedtranscription. Further, the effect of VAX1 on the �1380 bp re-porter was reduced to the extent that it did not reach significance(Student’s t test, p 0.1032). This suggests that enhancer 1 (E1)is necessary for VAX1 enhanced transcription of GnRH in GN11cells. In GT1-7 cells, VAX1 repression of GnRH transcription wasmaintained on all of the truncated reporters, except the �1380 bp(Fig. 5D, right), although with slightly different efficiencies (Fig.

4

(Figure legend continued.) empty vector. Statistical analysis by Student’s t test comparedwith control. *p 0.05, **p 0.01. C, GN11 and GT1-7 cells were cotransfected with aluciferase reporter driven by the 5 kb promoter region of the rat GnRH gene and increasingconcentrations of Vax1. All samples were transfected with equal amounts of DNA by using theempty CMV vector. Statistical analysis by one-way ANOVA followed by Tukey post hoc. *p 0.05, ***p 0.001. D, Cotransfection with 5� truncations of the GnRH 5 kb promoter drivingluciferase with (black) or without (white) 10 ng of Vax1. Luciferase data are expressed as fold-induction compared with pGL3. The percentage change between cotransfection with 0 versus10 ng of Vax1 on the reporters is indicated on the graph. Statistical analysis by two-way ANOVAfollowed by Dunnett’s multiple comparison. *p 0.05, **p 0.01, ***p 0.001. E, Vax1regulation of the RSV enhancer/promoter (RSV E/P) driving luciferase with or without the GnRHenhancer 1 (GnRH E, �1863 to �1571 bp) or GnRH promoter (GnRH P �173 to �112 bp).Data are expressed as fold-induction compared with empty vector for each reporter. Statisticalanalysis by Student’s t test. ***p 0.001. Luciferase transfection studies represent n 3–5performed in triplicate.

Figure 6. VAX1 regulates GnRH transcription through direct binding to ATTA sites in the GnRH-E1 and proximal promoter (P). A, Deletion of potential ATTA binding sites of VAX1 within the GnRHenhancer1/promoter (GnRH-E/P or E/P). B, Cotransfection of the indicated luciferase reporters with (black) or without (white) 10 ng of Vax1 in GN11 and GT1-7 cells. Data are expressed asfold-induction compared with GnRH E/P. Statistical analysis by two-way ANOVA followed by Bonferroni. ***p 0.001 compared with control. C, COS-1 cells were transiently transfected with aVax1-flag expression vector or its empty vector, CMV, and harvested 24 h post-transfection. Western blot shows detection of VAX1-flag, GAPDH (glyceraldehyde-3phosphate dehydrogenase), andTBP in the nucleus (Nucl) versus the cytoplasm (Cytopl). D, Probe sequences used for EMSA covering the ATTA sites found to be involved in VAX1 regulation of Gnrh1 transcription (sites indicated inA). The underlined ATTA elements were converted to GCCG in the mutant probes (Cold mut). E, EMSA performed using nuclear extracts from COS-1 cells transfected with Vax1-flag plasmid or controlexpression vector. Black arrowhead indicates super shift, gray arrowhead indicates origin of supershifted band. Wild-type (Cold WT) and mutant (Cold mut) probes were used at 100-fold higherconcentration than labeled WT probe.

3514 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1

5D, right). These data indicate that VAX1 requires GnRH-E1 tomodulate GnRH transcription in both cell lines. To determinewhether VAX1 regulates transcription through both E1 and P orE1 alone, we tested the capacity of VAX1 to mediate transcriptionof the GnRH-E1 or GnRH-P separately using the Rous sarcomavirus promoter (RSVp) or RSV enhancer (RSVe) to help drivetranscription (Fig. 5E). In both GN11 and GT1-7 cells, the sepa-ration of GnRH-E1 from the GnRH-P abolished the regulationof VAX1 on transcription (Fig. 5E). Therefore, VAX1 requiresboth the GnRH enhancer 1 and promoter to regulate Gnrh1transcription.

We have previously shown that ATTA sites within E1 and Pof the GnRH regulatory region are involved in induction byhomeodomain proteins SIX6 and DLX, and repression byMSX, of GnRH transcription (Givens et al., 2005; Larder et al.,2011). Based on these data, we hypothesized that VAX1 waslikely to regulate GnRH transcription through these samesites. Cotransfection of GN11 and GT1-7 cells with Vax1 andGnRH-luciferase reporters with or without ATTA deletions inP and E1 (Fig. 6A), confirmed that VAX1 required the twopairs of ATTA binding sites in E1 and P to regulate GnRHtranscription in both cell lines (Fig. 6B). To identify to whichof the four ATTA sites in the GnRH-E1/P (Fig. 6A) VAX1directly binds, we performed EMSAs with radioactively la-beled probes (Fig. 6D). COS-1 cells transiently transfectedwith a Vax1-flag overexpression vector contained high levelsof VAX1-flag protein (Fig. 6C), which was exclusively local-ized in the nuclear fraction of the cell lysate. This exclusivenuclear localization of VAX1 in COS-1 cells, contrasts withwhat others have described for VAX1 (Kim et al., 2014). Nu-clear extracts from COS-1 cells transiently transfected withVax1-flag formed a complex (Fig. 6E, gray arrowhead) thatwas supershifted (Fig. 6E, black arrowhead) in presence of aflag antibody (lanes 3, 15, and 21). In contrast to addition ofexcess unlabeled mutant probe (ATTA sequence mutated toGCCG; Fig. 6D, underlined sequence and lanes 6, 12, 18, and24, Cold mut, gray arrow), addition of excess WT probe de-creased complex formation and competed away VAX1 bind-ing to the probe (Cold WT, lanes 5, 11, 17, and 23, gray arrow).

VAX1 competes with homeodomain SIX6 for ATTA sites inthe Gnrh1 promoterThe transfection studies identified VAX1 as a strong positive reg-ulator of the Gnrh1 promoter in GN11, and a repressor in GT1-7(Figs. 5, 6). VAX1-regulated transcription was mediated by bind-ing to four sites in the proximal Gnrh1 promoter: �41, �53,�1622, and �1635 bp (Fig. 6E). Some of these sites are known tobe bound by other homeodomain proteins regulating the Gnrh1promoter, such as SIX6 (Larder et al., 2011). Like VAX1, SIX6 isnot expressed in GN11, and highly expressed in GT1-7, where it isa strong activator of the Gnrh1 promoter (Larder et al., 2011). Wehypothesized that VAX1 was an activator in both GN11 andGT1-7. However, if VAX1 has a higher affinity than SIX6 for theGnrh1 promoter but is a weaker activator, then that would enableVAX1 to displace SIX6 (a strong activator), thus making it appearas if VAX1 was a repressor. To test this hypothesis, we investi-gated whether VAX1 could compete with SIX6 for binding to theGnrh1 promoter. As both SIX6 (Larder et al., 2011) and VAX1bind in the Gnrh1 promoter and E1 (Fig. 6), we studied the effectsof VAX1 and SIX6 on the GnRH E1-P-luciferase reporter. InGN11 cells, VAX1 and SIX6 alone each increased transcription(Fig. 7A, GN11). Cotransfection of Vax1 and Six6 revealed a levelof transcription comparable to Vax1 alone (Fig. 7A, GT1-7), in-dicating that the effect observed was principally mediated byVAX1 and not SIX6. In GT1-7 cells, VAX1 repressed, whereasSIX6 activated, transcription (Fig. 7A, right). Cotransfection ofVax1 and Six6 led to a level of transcription close to that of Vax1alone, suggesting that the effect observed was mediated by VAX1.To further support that VAX1 is a positive regulator of the Gnrh1promoter in mature GnRH neurons, we used an ATTA multimerdriving luciferase. In GN11 cells, VAX1 increased transcription atall concentrations studied (Fig. 7B, GN11). Interestingly, VAX1proved to be a weak positive activator of the ATTA multimer inGT1-7 cells (Fig. 7B, GT1-7). To evaluate whether VAX1 andSIX6 do indeed compete for binding to ATTA sites, we evaluatedtranscriptional activity by performing SIX6 and VAX1 cotrans-fections with increasing concentrations of one or the othertranscription factor. As expected, SIX6 strongly increased tran-scription of the ATTA multimer in both cell lines, whereas VAX1

Figure 7. VAX1 and SIX6 compete for regulation of the Gnrh1 promoter. A, GN11 and GT1-7 cells were cotransfected with or without Six6 (as noted on figure or 200 ng) or Vax1 (as noted on figureor 20 ng). Transcriptional activity was evaluated using the GnRH-E/P-luciferase reporter or (B–D) using the 5� ctcATTAat-TK-luciferase multimer reporter. Statistical analysis was by two-wayANOVA followed by post hoc Bonferroni. Fold-changes are compared with control (0 ng Vax1, 0 ng Six6) or as indicated by bar. *p 0.05, **p 0.01, ***p 0.001. Student’s t test compared withcontrol. #p 0.05. Horizontal line indicates control level. All experiments were performed in triplicate and repeated three to six times.

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3515

was a strong activator in GN11 and weak activator in GT1-7 (Fig.7C, GN11, D, GT1-7). In the presence of increasing concentra-tions of SIX6, Vax1-induced (20 ng) ATTA transcription levelswere comparable to VAX1 alone in both GN11 and GT1-7 (Fig.7C,D, left). Interestingly, increasing concentrations of Vax1 werenot able to consistently reduce SIX6-induced (200 ng) transcrip-tion (Fig. 7C,D, right), indicating that VAX1 is a positive regula-tor of the Gnrh1 promoter, and competes with the binding ofSIX6 to ATTA sites to regulate Gnrh1 transcription thus resultingin reduced Gnrh1 transcription by replacing a stronger activator(SIX6) with a weaker one (VAX1).

DiscussionVAX1 expression in GnRH neurons determines their fateThe physiology of fertility is particularly complex due to thenumerous organs, hormones and timing required for its mainte-nance (Beaver et al., 2002; Boden and Kennaway, 2005, 2006;Williams et al., 2007). Infertility originating at the level of GnRHneurons frequently arises from a disruption of their matura-tion or migration during development (Pitteloud et al., 2006;Schwarting et al., 2007). Homeodomain transcription factors areknown to be modulators of GnRH neuron maturation and mu-tations in, for example, Six6, Vax1, or Otx2, cause various degreesof infertility due to abnormal GnRH neuron development (Diac-zok et al., 2011; Larder et al., 2011, 2013; Hoffmann et al., 2014).

In the current study, we determined the role of VAX1 inGnRH neurons and in fertility. We demonstrate Vax1 expressionin GnRH neurons and find that during early GnRH neuron de-velopment (E13.5), the absence of VAX1 (Vax1 KO) does notimpact GnRH neuron generation, but has a crucial role in themaintenance of GnRH expression at E17.5. Interestingly, theVax1 HET mouse at E17.5 had an �50% reduction in GnRHneurons, showing that Vax1 dosage is crucial in GnRH neurondevelopment, and that the decrease in GnRH neurons inadulthood (Hoffmann et al., 2014) originates between E13.5and E17.5.

To understand the role of VAX1 within GnRH neurons indevelopment, we generated Vax1flox mice and crossed them withGnRHcre mice. Deletion of Vax1 in GnRH neurons (cKO) re-sulted in a 99% reduction of GnRH-expressing neurons in adult-hood, without affecting GnRH neuron numbers at E15.5. Incontrast to the death of GnRH neurons observed by lineage trac-ing in mice with Otx2 deleted in GnRH neurons (Diaczok et al.,2011) or in the Six6 KO mouse (unpublished), lineage tracing inVax1flox/flox:GnRHcre:Rosa LacZ mice revealed that GnRH neu-rons remained alive, and had migrated correctly to the hypothal-amus, but no longer expressed GnRH, involving VAX1 in thematuration of GnRH neurons, and the maintenance of expres-sion of GnRH into adulthood. The absence of GnRH expressionled to delayed puberty, hypogonadism, extremely low circulatinggonadotropin levels, and complete infertility in both sexes. Inagreement with our findings in the Vax1 HET mouse (Hoffmannet al., 2014), the cHET had a very modest subfertility phenotype.The cHET mice were comparable to WT in all fertility studies,with the exception that cHET females had slightly reduced circu-lating LH and cHET to cHET matings were subfertile. This sug-gests that dosage of Vax1 within GnRH neurons is important forGnRH neuron development and that the cHET mouse repro-duces most of the phenotypes seen in the global Vax1 HET (Hoff-mann et al., 2014). However, as not all of the data were equivalentto the Vax1 HET, it is likely that Vax1 expressed by other celltypes along the migratory route or in the preoptic area of thehypothalamus might also influence the reproductive axis. Alter-

natively, Vax1 could be important for the function of anteroven-tral periventricular nucleus kisspeptin neurons (see below;Hoffmann et al., 2014).

In the brain, kisspeptin and GnRH neurons are key for pro-gression through puberty and maintenance of fertility (Kauff-man, 2010; Kim et al., 2013). Kisspeptin neurons localized in theanteroventral periventricular nucleus stimulate GnRH neuronsto release GnRH by acting on the KISS1 receptor. Absence ofkisspeptin or the KISS1 receptor, leads to complete infertility dueto lack of GnRH neuron stimulation of gonadotropes (Lapatto etal., 2007; Clarkson et al., 2008; Pielecka-Fortuna et al., 2008; Kiri-lov et al., 2013). It has previously been shown that kisspeptinstimulation of GnRH neurons in vitro leads to an opening ofGnrh1 chromatin structure, increasing recruitment of the tran-scription factor OTX2, an activator of Gnrh1 transcription (No-vaira et al., 2015).

To confirm that the reproductive incompetence of cKO micearises at the level of GnRH neurons, we challenged both sexeswith injections of GnRH or kisspeptin. The capacity of GnRH,but not kisspeptin, to elicit an increase in circulating LH, con-firmed that low gonadotropin levels in the cKO mice was not dueto a lack of responsiveness of the pituitary to GnRH, butthe complete absence of GnRH input to this structure. As theGnRHcre targets GnRH neurons (Wolfe et al., 2008), and we ob-serve a �99% reduction of GnRH neuron staining, this studyconfirms that the absence of GnRH expression in hypothalamicneurons in the cKO mice is the origin of infertility.

Maintenance of GnRH expression depends on competitionbetween binding by VAX1 and SIX6 to the Gnrh1 promoterThe 5 kb Gnrh1 promoter region is well characterized and hasbeen shown to contain three evolutionarily conserved enhancerregions: E3 (�3952 to �3895 bp), E2 (�3135 to �2631 bp), andE1 (�1863 to �1571 bp; Whyte et al., 1995; Iyer et al., 2010), inaddition to the conserved proximal promoter (173 bp to �1).The specific neuronal expression of GnRH in vivo only requiresthe proximal GnRH, E1 and P (Lawson et al., 2002). Conse-quently, the coordinated binding of transcription factors toGnRH-E1 and GnRH-P is tightly associated with specificity ofGnrh1 transcription, as confirmed by our study. The 5 kb regionupstream of the Gnrh1 transcriptional start site contains numer-ous potential binding sites for homeodomain proteins (Larderand Mellon, 2009; Larder et al., 2011; Novaira et al., 2012). Toinvestigate the role of VAX1 on the Gnrh1 promoter and enhanc-ers, we studied transcriptional regulation in the two GnRH celllines, GN11 and GT1-7. The developmental stage of GnRH neu-rons at E13.5 is thought to closely mimic the maturation stage ofGN11 cells, whereas GT1-7 cells reflect a more mature, postmi-gratory GnRH neuron. Our data suggest that Vax1 expression isactivated during the migration of GnRH neurons between E13.5and E17.5 and is required for maintaining expression of GnRH inthis neuronal population after E15.5. We found that VAX1 is arepressor of the 5 kb GnRH promoter in GT1-7 cells, but aninducer in GN11 cells. The differential regulation of the 5 kbGnRH promoter was not due to the use of different binding sitesby VAX1 in the two cell lines. Due to our inability to validate anycommercially available VAX1 antibodies for EMSA or ChIP as-says, we used COS-1 cells transient transfected with VAX1-flag todetermine whether VAX1 directly interacts with the identifiedATTA sites of the Gnrh1 promoter and enhancer. Using this ap-proach, we identified a strong interaction of VAX1 on the �1622and �1635 bp sites in E1 and on the �41 site in P, and a weakinteraction at �53. These sites have previously been described to

3516 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1

be bound by homeodomain transcription factors such as SIX6(Larder et al., 2011), MSX1/2 and DLX1/2/5 (Givens et al., 2005).The expression levels of these transcription factors, along withVAX1, are different between GN11 and GT1-7 cells. We hypoth-esized that a specific balance of transcription factors, their spe-cific promoter occupancy, activational capacity, and bindingaffinities would determine whether an induction or repression ofGnrh1 transcription occurred (Givens et al., 2005; Rave-Harel etal., 2005; Larder et al., 2011). We found that the repression ofGnrh1 transcription in GT1-7 cells by VAX1, in fact, reflects thecapacity of VAX1 to displace a strong activator from the pro-moter, such as SIX6. Replacing a strong activator (SIX6) with aweak activator (VAX1) would result in a decrease in transcrip-tion. Our data identified VAX1 as a weak activator on an ATTA-multimer, showing that VAX1 is an activator of transcription inboth GN11 and GT1-7. Competition studies between VAX1 andSIX6 on the ATTA-multimer revealed a complex interplay be-tween these two transcription factors. Depending on the specificconcentration of each transcription factor, ATTA-luciferasetranscriptional levels changed. This suggests that a specific bal-ance of SIX6 and VAX1 elicits different transcriptional activitiesof the Gnrh1 promoter, a concept also supported by the dosedependence on Vax1 in vivo. These two transcription factorsmost likely compete with other homeodomain transcription fac-tors, highlighting the complexity of Gnrh1 transcription regula-tion. Overall, we found that VAX1 is an activator of the Gnrh1promoter, but depending on the concentration and localizationof other homeodomain transcription factors, such as SIX6, itsoverall effect on Gnrh1 transcription is to increase or decreasetranscription levels. The strong activation of the Gnrh1 promoterin GN11 cells also indicates that VAX1 is important for increasingGnrh1 expression during GnRH neuron maturation, whichmight be the origin of the loss of GnRH expression in the adultcKO mouse. Another possibility is that deletion of Vax1 fromGnRH neurons during development leads to an imbalance oftranscription factors regulating the Gnrh1 promoter, as well asother genes important for GnRH neuron maturation, leading toan almost complete absence of GnRH-expressing neurons inadulthood.

In conclusion, our findings identify a critical role for VAX1 inGnRH neuron maturation, where it is required for the mainte-nance of GnRH expression through direct binding to the Gnrh1promoter. Lack of VAX1 in embryonic development disruptscontinuation of GnRH expression after E15.5, and leads to hypo-gonadism and complete infertility.

ReferencesBeaver LM, Gvakharia BO, Vollintine TS, Hege DM, Stanewsky R, Giebulto-

wicz JM (2002) Loss of circadian clock function decreases reproductivefitness in males of Drosophila melanogaster. Proc Natl Acad Sci U S A99:2134 –2139. CrossRef Medline

Bertuzzi S, Hindges R, Mui SH, O’Leary DD, Lemke G (1999) The home-odomain protein vax1 is required for axon guidance and major tractformation in the developing forebrain. Genes Dev 13:3092–3105.CrossRef Medline

Bharti K, Gasper M, Bertuzzi S, Arnheiter H (2011) Lack of the ventralanterior homeodomain transcription factor VAX1 leads to induction of asecond pituitary. Development 138:873– 878. CrossRef Medline

Bianco SD, Kaiser UB (2009) The genetic and molecular basis of idiopathichypogonadotropic hypogonadism. Nat Rev Endocrinol 5:569 –576.CrossRef Medline

Boden MJ, Kennaway DJ (2005) Reproduction in the arrhythmic Bmal1knockout mouse. Reprod Fertil Dev 17:126. CrossRef

Boden MJ, Kennaway DJ (2006) Circadian rhythms and reproduction. Re-production 132:379 –392. CrossRef Medline

Chan YM, de Guillebon A, Lang-Muritano M, Plummer L, Cerrato F, TsiarasS, Gaspert A, Lavoie HB, Wu CH, Crowley WF Jr, Amory JK, Pitteloud N,Seminara SB (2009) GNRH1 mutations in patients with idiopathichypogonadotropic hypogonadism. Proc Natl Acad Sci U S A 106:11703–11708. CrossRef Medline

Clarkson J, d’Anglemont de Tassigny X, Moreno AS, Colledge WH, HerbisonAE (2008) Kisspeptin-GPR54 signaling is essential for preovulatorygonadotropin-releasing hormone neuron activation and the luteinizinghormone surge. J Neurosci 28:8691– 8697. CrossRef Medline

Diaczok D, DiVall S, Matsuo I, Wondisford FE, Wolfe AM, Radovick S(2011) Deletion of Otx2 in GnRH neurons results in a mouse modelof hypogonadotropic hypogonadism. Mol Endocrinol 25:833– 846.CrossRef Medline

Dode C, Teixeira L, Levilliers J, Fouveaut C, Bouchard P, Kottler ML, Lespi-nasse J, Lienhardt-Roussie A, Mathieu M, Moerman A, Morgan G, MuratA, Toublanc JE, Wolczynski S, Delpech M, Petit C, Young J, Harde-lin JP (2006) Kallmann syndrome: mutations in the genes encodingprokineticin-2 and prokineticin receptor-2. PLoS Genet 2:e175. CrossRefMedline

Gibson MJ, Kasowski H, Dobrjansky A (1994) Continuous gonadotropin-releasing hormone infusion stimulates dramatic gonadal development inhypogonadal female mice. Biol Reprod 50:680 – 685. CrossRef Medline

Gill JC, Wadas B, Chen P, Portillo W, Reyna A, Jorgensen E, Mani S, Schwart-ing GA, Moenter SM, Tobet S, Kaiser UB (2008) The gonadotropin-releasing hormone (GnRH) neuronal population is normal in size anddistribution in GnRH-deficient and GnRH receptor-mutant hypogo-nadal mice. Endocrinology 149:4596 – 4604. CrossRef Medline

Givens ML, Rave-Harel N, Goonewardena VD, Kurotani R, Berdy SE, SwanCH, Rubenstein JL, Robert B, Mellon PL (2005) Developmental regula-tion of gonadotropin-releasing hormone gene expression by the MSX andDLX homeodomain protein families. J Biol Chem 280:19156 –19165.CrossRef Medline

Hallonet M, Hollemann T, Wehr R, Jenkins NA, Copeland NG, Pieler T,Gruss P (1998) Vax1 is a novel homeobox-containing gene expressed inthe developing anterior ventral forebrain. Development 125:2599 –2610.Medline

Hallonet M, Hollemann T, Pieler T, Gruss P (1999) Vax1, a novelhomeobox-containing gene, directs development of the basal forebrainand visual system. Genes Dev 13:3106 –3114. CrossRef Medline

Herbison AE, Porteous R, Pape JR, Mora JM, Hurst PR (2008) Gon-adotropin-releasing hormone (GnRH) neuron requirements for puberty,ovulation and fertility. Endocrinology 149:597– 604. CrossRef Medline

Hoffmann HM, Tamrazian A, Xie H, Perez-Millan MI, Kauffman AS, MellonPL (2014) Heterozygous deletion of ventral anterior homeobox (Vax1)causes subfertility in mice. Endocrinology 155:4043– 4053. CrossRefMedline

Iyer AK, Miller NL, Yip K, Tran BH, Mellon PL (2010) Enhancers of GnRHtranscription embedded in an upstream gene use homeodomain proteinsto specify hypothalamic expression. Mol Endocrinol 24:1949 –1964.CrossRef Medline

Kauffman AS (2010) Coming of age in the kisspeptin era: sex differences,development, and puberty. Mol Cell Endocrinol 324:51– 63. CrossRefMedline

Kim J, Tolson KP, Dhamija S, Kauffman AS (2013) Developmental GnRHsignaling is not required for sexual differentiation of kisspeptin neuronsbut is needed for maximal Kiss1 gene expression in adult females. Endo-crinology 154:3273–3283. CrossRef Medline

Kim N, Min KW, Kang KH, Lee EJ, Kim HT, Moon K, Choi J, Le D, Lee SH,Kim JW (2014) Regulation of retinal axon growth by secreted Vax1 ho-meodomain protein. Elife 3:e02671. CrossRef Medline

Kirilov M, Clarkson J, Liu X, Roa J, Campos P, Porteous R, Schutz G, Herbi-son AE (2013) Dependence of fertility on kisspeptin-Gpr54 signaling atthe GnRH neuron. Nat Commun 4:2492. Medline

Korenbrot CC, Huhtaniemi IT, Weiner RI (1977) Preputial separation as anexternal sign of pubertal development in the male rat. Biol Reprod 17:298 –303. CrossRef Medline

Lapatto R, Pallais JC, Zhang D, Chan YM, Mahan A, Cerrato F, Le WW,Hoffman GE, Seminara SB (2007) Kiss1 �/� mice exhibit more variablehypogonadism than Gpr54 �/� mice. Endocrinology 148:4927– 4936.CrossRef Medline

Larder R, Mellon PL (2009) Otx2 induction of the gonadotropin-releasing

Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1 J. Neurosci., March 23, 2016 • 36(12):3506 –3518 • 3517

hormone promoter is modulated by direct interactions with Grg co-repressors. J Biol Chem 284:16966 –16978. CrossRef Medline

Larder R, Clark DD, Miller NL, Mellon PL (2011) Hypothalamic dysregu-lation and infertility in mice lacking the homeodomain protein Six6.J Neurosci 31:426 – 438. CrossRef Medline

Larder R, Kimura I, Meadows J, Clark DD, Mayo S, Mellon PL (2013) Genedosage of Otx2 is important for fertility in male mice. Mol Cell Endocrinol377:16 –22. CrossRef Medline

Lawson MA, Macconell LA, Kim J, Powl BT, Nelson SB, Mellon PL (2002)Neuron-specific expression in vivo by defined transcription regulatoryelements of the GnRH gene. Endocrinology 143:1404 –1412. CrossRefMedline

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression datausing real-time quantitative PCR and the 2 ���CT method. Methods 25:402– 408. CrossRef Medline

Livne I, Gibson MJ, Silverman AJ (1993) Gonadotropin-releasing hormone(GnRH) neurons in the hypogonadal mouse elaborate normal projec-tions despite their biosynthetic deficiency. Neurosci Lett 151:229 –233.CrossRef Medline

Mason AJ, Hayflick JS, Zoeller RT, Young WS 3rd, Phillips HS, Nikolics K,Seeburg PH (1986) A deletion truncating the gonadotropin-releasinghormone gene is responsible for hypogonadism in the hpg mouse. Science234:1366 –1371. CrossRef Medline

Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI(1990) Immortalization of hypothalamic GnRH neurons by geneticallytargeted tumorigenesis. Neuron 5:1–10. CrossRef Medline

Nelson SB, Lawson MA, Kelley CG, Mellon PL (2000) Neuron-specific ex-pression of the rat gonadotropin-releasing hormone gene is conferred byinteractions of a defined promoter element with the enhancer in GT1-7cells. Mol Endocrinol 14:1509 –1522. CrossRef Medline

Novaira HJ, Fadoju D, Diaczok D, Radovick S (2012) Genetic mechanismsmediating kisspeptin regulation of GnRH gene expression. J Neurosci32:17391–17400. CrossRef Medline

Novaira HJ, Sonko ML, Radovick S (2015) Kisspeptin induces dynamicchromatin modifications to control GnRH gene expression. Mol Neuro-biol. Advance online publication. Retrieved Nov. 15, 2015. CrossRefMedline

Pielecka-Fortuna J, Chu Z, Moenter SM (2008) Kisspeptin acts directly andindirectly to increase gonadotropin-releasing hormone neuron activityand its effects are modulated by estradiol. Endocrinology 149:1979 –1986.CrossRef Medline

Pitteloud N, Acierno JS Jr, Meysing A, Eliseenkova AV, Ma J, Ibrahimi OA,Metzger DL, Hayes FJ, Dwyer AA, Hughes VA, Yialamas M, Hall JE, GrantE, Mohammadi M, Crowley WF Jr (2006) Mutations in fibroblastgrowth factor receptor 1 cause both Kallmann syndrome and normosmicidiopathic hypogonadotropic hypogonadism. Proc Natl Acad Sci U S A103:6281– 6286. CrossRef Medline

Pitteloud N, Quinton R, Pearce S, Raivio T, Acierno J, Dwyer A, Plummer L,Hughes V, Seminara S, Cheng YZ, Li WP, Maccoll G, Eliseenkova AV,Olsen SK, Ibrahimi OA, Hayes FJ, Boepple P, Hall JE, Bouloux P, Mo-hammadi M, et al. (2007a) Digenic mutations account for variable phe-notypes in idiopathic hypogonadotropic hypogonadism. J Clin Invest117:457– 463. CrossRef Medline

Pitteloud N, Zhang C, Pignatelli D, Li JD, Raivio T, Cole LW, Plummer L,Jacobson-Dickman EE, Mellon PL, Zhou QY, Crowley WF Jr (2007b)Loss-of-function mutation in the prokineticin 2 gene causes Kallmann

syndrome and normosmic idiopathic hypogonadotropic hypogonadism.Proc Natl Acad Sci U S A 104:17447–17452. CrossRef Medline

Radovick S, Wray S, Lee E, Nicols DK, Nakayama Y, Weintraub BD, WestphalH, Cutler GB Jr, Wondisford FE (1991) Migratory arrest of gon-adotropin-releasing hormone neurons in transgenic mice. Proc Natl AcadSci U S A 88:3402–3406. CrossRef Medline

Rave-Harel N, Miller NL, Givens ML, Mellon PL (2005) The Groucho-related gene family regulates the gonadotropin-releasing hormone genethrough interaction with the homeodomain proteins MSX1 and OCT1.J Biol Chem 280:30975–30983. CrossRef Medline

Rodríguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, StewartAF, Dymecki SM (2000) High-efficiency deleter mice show that FLPe isan alternative to Cre-loxP. Nat Genet 25:139 –140. CrossRef Medline

Schinckel AP, Johnson RK, Kittok RJ (1984) Relationships among measuresof testicular development and endocrine function in boars. J Anim Sci58:1255–1261. Medline

Schwanzel-Fukuda M, Pfaff DW (1989) Origin of luteinizing hormone-releasing hormone neurons. Nature 338:161–164. CrossRef Medline

Schwarting GA, Wierman ME, Tobet SA (2007) Gonadotropin-releasinghormone neuronal migration. Semin Reprod Med 25:305–312. CrossRefMedline

Soriano P (1999) Generalized lacZ expression with the ROSA26 cre reporterstrain. Nat Genet 21:70 –71. CrossRef Medline

Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, Costan-tini F (2001) Cre reporter strains produced by targeted insertion ofEYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1:4. CrossRefMedline

Take-uchi M, Clarke JD, Wilson SW (2003) Hedgehog signalling maintainsthe optic stalk-retinal interface through the regulation of Vax gene activ-ity. Development 130:955–968. CrossRef Medline

Tsai PS, Gill JC (2006) Mechanisms of disease: insights into X-linked andautosomal-dominant Kallmann syndrome. Nat Clin Pract EndocrinolMetab 2:160 –171. CrossRef Medline

Valdes-Socin H, Rubio Almanza M, Tome Fernandez-Ladreda M, DebrayFG, Bours V, Beckers A (2014) Reproduction, smell, and neurodevelop-mental disorders: genetic defects in different hypogonadotropic hypogo-nadal syndromes. Front Endocrinol (Lausanne) 5:109. CrossRef

Whyte DB, Lawson MA, Belsham DD, Eraly SA, Bond CT, Adelman JP,Mellon PL (1995) A neuron-specific enhancer targets expression of thegonadotropin-releasing hormone gene to hypothalamic neurosecretoryneurons. Mol Endocrinol 9:467– 477. CrossRef Medline

Wierman ME, Kiseljak-Vassiliades K, Tobet S (2011) Gonadotropin-releasing hormone (GnRH) neuron migration: initiation, maintenanceand cessation as critical steps to ensure normal reproductive function.Front Neuroendocrinol 32:43–52. CrossRef Medline

Williams NI, Berga SL, Cameron JL (2007) Synergism between psychosocialand metabolic stressors: impact on reproductive function in cynomol-gus monkeys. Am J Physiol Endocrinol Metab 293:E270 –276. CrossRefMedline

Wolfe A, Divall S, Singh SP, Nikrodhanond AA, Baria AT, Le WW, HoffmanGE, Radovick S (2008) Temporal and spatial regulation of CRE recom-binase expression in gonadotrophin-releasing hormone neurones in themouse. J Neuroendocrinol 20:909 –916. CrossRef Medline

Yoon H, Enquist LW, Dulac C (2005) Olfactory inputs to hypothal-amic neurons controlling reproduction and fertility. Cell 123:669 – 682.CrossRef Medline

3518 • J. Neurosci., March 23, 2016 • 36(12):3506 –3518 Hoffmann et al. • GnRH Neuron Maturation and Fertility Require VAX1