European Journal of Pharmaceutical Sciences 53 (2014) 35–44

Contents lists available at ScienceDirect

European Journal of Pharmaceutical Sciences

journal homepage: www.elsevier .com/ locate/e jps

Cell type and transfection reagent-dependent effects on viability,cell content, cell cycle and inflammation of RNAi in humanprimary mesenchymal cells

0928-0987/$ - see front matter � 2013 Elsevier B.V. All rights reserved.http://dx.doi.org/10.1016/j.ejps.2013.12.006

⇑ Corresponding author. Address: Department of Orthopaedics, University Med-ical Center Utrecht, Heidelberglaan 100, PO Box 85090, 3508 AB Utrecht, TheNetherlands. Tel.: +31 088 755 11 33; fax: +31 030 251 06 38.

E-mail address: L.B.Creemers@umcutrecht.nl (L.B. Creemers).

Hsiao-yin Yang a, Lucienne A. Vonk a, Ruud Licht a, Antonetta M.G. van Boxtel a, Joris E.J. Bekkers a,Angela H.M. Kragten a, San Hein b, Oommen P. Varghese c, Kenneth A. Howard b, F. Cumhur Öner a,Wouter J.A. Dhert a,d, Laura B. Creemers a,⇑a Department of Orthopaedics, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht, The Netherlandsb Interdisciplinary Nanoscience Center (iNANO), Department of Molecular Biology and Genetics, Aarhus University, 8000 Aarhus C, Denmarkc Department of Material Chemistry, Uppsala University, Box 538, S-75121 Uppsala, Swedend Faculty of Veterinary Medicine, University of Utrecht, The Netherlands

a r t i c l e i n f o a b s t r a c t

Article history:Received 7 August 2013Received in revised form 9 November 2013Accepted 8 December 2013Available online 15 December 2013

Keywords:siRNATransfectionNon-specific effectsNucleus pulposusChondrocytesMSCs

The application of RNA interference (RNAi) has great therapeutic potential for degenerative diseases ofcartilaginous tissues by means of fine tuning the phenotype of cells used for regeneration. However, pos-sible non-specific effects of transfection per se might be relevant for future clinical application. In the cur-rent study, we selected two synthetic transfection reagents, a cationic lipid-based commercial reagentLipofectamine RNAiMAX and polyethylenimine (PEI), and two naturally-derived transfection reagents,namely the polysaccharides chitosan (98% deacetylation) and hyaluronic acid (20% amidation), for siRNAdelivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes andmesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as anendogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day 3 andday 6 post-transfection. In addition to silencing efficiency, non-specific effects such as cytotoxicity,change in DNA content and differentiation potential of cells were evaluated. Among the four transfectionreagents, the commercial liposome-based agent was the most efficient reagent for siRNA delivery at20 nM siRNA, followed by chitosan. Transfection using cationic liposomes, chitosan and PEI showed somedecrease in viability and DNA content to varying degrees that was dependent on the siRNA dose and celltype evaluated, but independent of GAPDH knockdown. Some effects on DNA content were not accom-panied by concomitant changes in viability. However, changes in expression of marker genes for cell cycleinhibition or progression, such as p21 and PCNA, could not explain the changes in DNA content. Interest-ingly, aspecific upregulation of GAPDH activity was found, which was limited to cartilaginous cells. Inconclusion, non-specific effects should not be overlooked in the application of RNAi for mesenchymal celltransfection and may need to be overcome for its effective therapeutic application.

� 2013 Elsevier B.V. All rights reserved.

1. Introduction

Degenerative diseases of the cartilaginous tissues such as inter-vertebral disc (IVD) degeneration and osteoarthritis (OA) are majorcauses of disability worldwide (Brooks, 2002; Buckwalter, 1995).Current available treatments, such as conservative therapy, spinalfusion and arthroplasty, are only aimed at symptom relief and haveseveral drawbacks. RNA interference (RNAi) (Fire et al., 1998) maybe of great therapeutic potential in cell-based regenerative

medicine. For IVD degeneration, promising targets include cyto-kines and matrix metalloproteinases (MMPs), such as interleu-kin-1 (IL-1) and MMP-2 (Hoyland et al., 2008; Rutges et al.,2008). For OA, in murine models a disintegrin and metalloprotein-ase with thrombospondin motifs (ADAMTS) 5 and MMP-13 havebeen shown to play a crucial role in modulating progression of car-tilage degeneration (Glasson et al., 2005; Wang et al., 2013). Down-regulation of degenerative or inhibitory factors might be achievedusing small interfering RNA (siRNA) that interferes with geneexpression at the post-transcriptional level. In human nucleus pul-posus (NP) cells, RNAi-mediated downregulation of an exogenousreporter gene was shown (Kakutani et al., 2006). In rat chondro-cytes, expression of genes involved in mediating proinflammatory

36 H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44

response and matrix degradation was reduced in vitro when NF-jBp65 was silenced (Chen et al., 2008). In addition to inhibitionof degeneration, RNAi may also be used to modulate cell pheno-type in regenerative approaches. Mesenchymal stem cells (MSCs)applied for regeneration of cartilaginous tissues commonly tendto enter hypertrophic differentiation, governed by RUNX2 expres-sion (Ducy et al., 1997). Inhibition of this gene may prevent thisprocess. Also the application of siRNA silencing growth arrest-spe-cific (GAS) 6 was shown to maintain the chondrogenic phenotypein MSCs (Motomura et al., 2007).

In order to facilitate siRNA delivery, non-viral transfectionmethods have been developed which may provide higher safetycompared to viral transfection methods. Cationic liposome-basedand polycation-based methods, such as polyethylenimine (PEI)transfection reagents, are commonly used in non-viral methodsfor siRNA delivery in vitro due to their high performance in trans-fection efficiency facilitated by interaction with the cellular mem-brane (Gilmore et al., 2004; Grayson et al., 2006; Oh et al., 2002).Despite the recent advances in delivery methods and siRNA, thereare concerns regarding possible off-target effects or non-specificeffects caused by transfection, including cytotoxicity, DNA damage,even induction of innate immunity (Judge et al., 2005; Sioud,2005). Moreover, effects of transfection reagents per se on geneexpression, independent of the genes silenced, have also beenshown in different cell lines (Akhtar and Benter, 2007; Fedorovet al., 2006; Omidi et al., 2003).

Despite transfections shown in human nucleus pulposus cells,chondrocytes and mesenchymal stem cells (MSCs) (Iwata et al.,2006; Kakutani et al., 2006; Zhou et al., 2004), there is little under-standing of possible non-specific effects of transfection in thesecells. In order to apply RNAi successfully in cartilaginous degener-ative diseases, insight into these non-specific effects is ofimportance.

This study evaluated possible non-specific effects of commonlyused transfection reagents, Lipofectamine RNAiMAX (RNAiMAX)and PEI, as well as two naturally-derived transfection reagents,chitosan (98% deacetylation) and hyaluronic acids (20% amidation).Chitosan is a deacetylated derivative of chitin and it possesses ahigh positive charge density, which enables electrostatic interac-tion between chitosan and oligonucleotides (Mumper et al.,1995; Piron and Domard, 1997). Furthermore, the glycosaminogly-can based hyaluronic acid (HA), a component found also in extra-cellular matrix of cartilage (Carney and Muir, 1988; Kjellen andLindahl, 1991), is one of the novel tools for delivering siRNA (Kimet al., 2009; Lee et al., 2007). It can be internalized by binding tothe cell-surface receptors CD44 and hyaluronan-mediated motilityreceptor (RHAMM), which are found in particular on chondrocyte-like cells and MSCs (Dimitroff et al., 2001; Gan et al., 2003; Stevenset al., 2000).

The aim of this study is to determine the effects of transfectionwith different types of reagents on cells involved in regenerationand degeneration of cartilaginous tissues. The variety of transfec-tion reagents chosen as different types of reagents would be morelikely to show differences in effects, thereby providing informa-tion on which family of reagents would be more suitable. In addi-tion, both hyaluronic acid and chitosan display cartilage matrix-like chemistry and may possibly elicit chondrocyte-specific re-sponses. Cells derived from cartilaginous tissues, including nu-cleus pulposus (NP) cells and articular chondrocytes (AC), andMSCs were transfected with siRNA targeting an endogenous mod-el gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH),using four transfection reagents. The specificity of siRNA-medi-ated gene silencing using the four different transfection reagentswas evaluated. Effects of transfection on cell viability, changes incell content and selected gene expression were furtherinvestigated.

2. Material and methods

2.1. Cell isolation and culture

Cells obtained from nucleus pulposus (NP) tissue of humanlumbar intervertebral disc from autopsy were isolated by an 1-henzymatic digestion in 0.2% pronase (Roche, Mannheim, Germany),followed by an overnight enzymatic digestion in 0.05% collagenasetype 2 (Worthington Biochemical, Lakewood, NJ, USA), 0.004%DNase at 37 �C. Undigested debris was removed by a 70 lm-cellstrainer (Becton Dickson, Franklin Lakes, USA). The suspension ofNP cells was then washed in PBS and then centrifuged. Afterwards,the cells were re-suspended in expansion medium consisting ofDMEM (Gibco� Invitrogen, CA, USA) containing 4.5 mg/ml glucose,glutamine, supplemented with 10% fetal bovine serum (FBS) (Hy-Clone� Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mlpenicillin, 100 lg/ml streptomycin (Invitrogen, CA, USA) and sup-plemented with 10 ng/ml basic fibroblast growth factor (bFGF)(R&D Systems, Minneapolis, MN, USA). The cells were cultured at37 �C and 5% CO2. The culture medium was renewed every 3–4 days and cells were used at passage 2.

Articular cartilage was harvested from knee joints derived frompatients undergoing arthroplasty. Articular chondrocytes (ACs)were isolated by a 3-h enzymatic digestion in 0.1% pronase, fol-lowed by an overnight enzymatic digestion in 0.04% collagenasetype 2 at 37 �C. Undigested debris was removed using a 70 lm-cellstrainer. The resulting suspension of cells was washed in PBS andcentrifuged. The cells were suspended in expansion medium andsupplemented with 10 ng/ml bFGF as mentioned above. The cellswere cultured at 37 �C and 5% CO2 and the culture medium was re-newed every 3–4 days. Cells were used at passage 2.

Mononuclear cell fraction of aspirated human bone marrowwas isolated by centrifuging on Ficoll-Paque™ (GE Healthcare, Pis-cataway, NJ, USA). Isolated mesenchymal stem cells (MSCs) weresubsequently plated in growth medium consisting of a-MEM (Gib-co�) supplemented with 0.2 mM L-ascorbic acid 2-phosphate(ASAP) (Sigma, St Louis MO, USA), 10% FBS, 100 U/ml penicillinwith 100 lg/ml streptomycin, and 1 ng/ml bFGF. The cells werecultured at 37 �C and 5% CO2, with renewal of the culture mediumevery 3–4 days and passaged at sub-confluence and cells wereused at passage 3.

2.2. Small interfering RNA (siRNA)

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specificsiRNA and scrambled siRNA (Silencer� GAPDH siRNA and Silencer�

Negative Control #1 siRNA) were purchased from Ambion� (Invit-rogen). siGLO Green Transfection Indicator (siGLO) was obtainedfrom Thermo Scientific Dharmacon (Lafayette, CO, USA).

2.3. Transfection formulations

Lipofectamine RNAiMAX (RNAiMAX) was purchased from Invit-rogen. Several siRNA concentrations ranging from 3.1 to 50 nMwith a constant ratio of reagent to siRNA were tested (data notshown) according to the manufacturer’s instructions and applyingN:P ratios previously described for the cell types used (Iwamotoet al., 2010; Sudo and Minami, 2011; Zhang et al., 2009). Briefly,for the final experiments lipoplexes were prepared by complexa-tion of 1 ll RNAiMAX to 100 pmol siRNA in Opti-MEM� I ReducedSerum Medium (Opti-MEM) (Gibco�) at room temperature for atleast 20 min before addition to the cells at the appropriateconcentrations.

Polyplexes of polyethylenimine (PEI) with MW 25,000 (Sigma)and siRNA were prepared as described previously (Grayson et al.,

H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44 37

2006). A stock solution of PEI (5–10 mg/ml in 10 mM HEPES pH7.2) was prepared and filter-sterilized. The optimal ratio of N:P 5was selected after comparing different N:P ratios ranging from2.5 to 40 in AC cells and MSCs for resulting GAPDH enzyme activity(data not shown) and cytotoxicity (see Supplementary Fig. S1).Complexes were prepared by complexation of 0.98 lg PEI to100 pmol siRNA in Opti-MEM by brief vortexing, followed by anincubation at room temperature for at least 20 min prior to use.

Deacetylated chitosan Protosan UP B 80/20 was obtained fromNovaMatrix™ (FMC BioPolymer, Sandvika, Norway). The productwas further deacetylated to a degree of 98% with MW 250,000 orMW 470,000 (98/250 or 98/470). Polyplexes were prepared byadding siRNA to the chitosan solution (1 mg/ml) in 300 mM acetatebuffer (pH 5.5) at N:P 60. The optimal ratio of N:P 60 was selectedafter comparing different N:P ratios ranging from 40 to 60 in MSCsfor resulting GAPDH enzyme activity (data not shown) and cyto-toxicity (see Supplementary Fig. S2). Chitosan 98/470 was selectedfor this experiment after comparing the silencing effects in AC cellsand MSCs with chitosan 98/250 (data not shown). The suspensionof chitosan/siRNA polyplexes was stored at 4 �C prior to use.

Hyaluronic acid (HA) with MW 59 kDa was purchased fromLifecore Biomedical LLC (Chaska, MN, USA) and further modifiedby amidation reaction using 3,30-diaminodipropylamine in orderto incorporate cationic groups on HA-carboxylate. The amidationreaction was carried out by standard EDC (1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide) coupling chemistry which was em-ployed in the presence of N-hydroxybenzotriazole to obtain 20%of modifications of carboxylic acid groups. The optimal ratio ofN:P 5 was selected after comparing different N:P ratios rangingfrom 1.25 to 80 in AC cells for resulting GAPDH enzyme activity(data not shown) and cytotoxicity (see Supplementary Fig. S3).Polyplexes were prepared by complexation of HA to siRNA at N:P5 in Opti-MEM with gentle shaking at room temperature for 1 hprior to addition to cells at the appropriate concentrations.

2.4. Transfection methods

Cells were plated at a density of 5000 cells per well in 96-wellculture plates in the corresponding culture media without antibi-otics one day prior to transfection. Transfection complexes wereadded at a final concentration of either 20 nM or 200 nM siRNA(n = 6). At day 1 post-transfection, culture media were replacedby media supplemented with antibiotics. At day 3 post-transfec-tion, culture media were replaced with differentiation media. NPand AC cells were cultured in chondrogenic medium consistingof DMEM supplemented with 2% human serum albumin (Sanquin,Amsterdam, the Netherlands), 0.2 mM ASAP, 2% insulin–transfer-rin–selenium (ITS-X) (Gibco�), 10 ng/ml TGF-b (R&D Systems,MN, USA) and antibiotics. MSC cells were further cultured in anosteogenic medium composed of alpha-MEM, 0.2 mM ASAP,2 mM L-Glutamine, 10% FBS, 10 nM dexamethasone (Sigma),10 mM beta-glycerophosphate (Sigma) and antibiotics. Threeexperiments were performed independently. Representative re-sults from one experiment are shown.

2.5. Cellular uptake

Cells were transfected with 20 nM of fluorescent siGLO usingthe four transfection reagents to visualize cellular uptake andlocalization of siRNA. At day 1 post-transfection, nuclei werestained with DAPI (Vectashield, Vector Laboratories, CA, USA) andfluorescent images were taken using an Olympus BX51 microscopeequipped with an epifluorescence set-up and an Olympus DP70camera (Hamburg, Germany), with excitation/emission at 488/530 nm. Verification of the localization of the signal was performedfor some samples using a Carl Zeiss CSLM510 confocal microscope

(Oberkochen, Germany), at excitation/emission wavelengths of494/520 nm.

2.6. RNA isolation and cDNA synthesis

Total RNA was isolated in Trizol� (Invitrogen) according tomanufacturer’s instructions. RNA was dissolved in 12 ll Ultra-Pure™ DNAse/RNAse-Free distilled water (Invitrogen). Total RNA(about 500 ng) was converted to cDNA by iScript cDNA SynthesisKit (Bio-Rad Laboratories, Hercules, CA, USA) using an iCycler Ther-mal Cycler (Bio-Rad Laboratories).

2.7. Gene expression analyses

Expression of the model gene (GAPDH) and the selected markergenes were analyzed by real-time PCR. In MSCs, the markers ofosteogenic or chondrogenic lineage were collagen type 1 alpha 1(COL1A1), runt-related transcription factor 2 (RUNX2), and se-creted phosphoprotein 1 (SPP1). For NP and AC cells, in additionto COL1A1, the chondrogenic marker genes aggrecan (ACAN) andcollagen type 2 alpha 1 (COL2A1) were included.

In all cell types, cyclooxgenase-2 (COX-2), inducible in a proin-flammatory response, and cell cycle markers of p21 and prolifera-tion cell nuclear antigen (PCNA) expression were analyzed to verifyany association with DNA content.

Gene expressions were normalized to two other housekeepinggenes: 18S and tyrosine 3-monooxygenase/tryptophan 5-monoox-ygenase activation protein, zeta polypeptide (YWHAZ). The nor-malization factor was calculated with the formula(18S � YWHAZ)½. Real-time PCR reactions were performed usingSYBR Green Reaction Mix Kit according to manufacturer’s instruc-tions (Roche Applied Science) in a LightCycler 480 (Roche AppliedScience). Details of primers used in real-time PCR are listed inTable 1.

2.8. GAPDH activity

Expression of GAPDH protein was evaluated by measuring itsenzymatic activity. At day 3 and day 6 post-transfection, GAPDHactivity was measured using the KDalert™ GAPDH Assay Kit(Ambion�). After the removal of culture medium, cells were lysedin lysis buffer (100 ll/well) provided in the kit. Aliquots of 10 ll ly-sate were mixed with 90 ll reaction mix. GAPDH activity was mea-sured according to manufacturer’s instructions using kineticfluorescence measurements. Fluorescent signal was measured atexcitation/emission wavelengths of 530/590 nm using a PerseptiveCytofluor II Fluorescent Microplate Reader (PerSeptive Biosystems,Framingham, MA, USA). Data were normalized to DNA content.

2.9. Silencing efficiency on GAPDH gene expression and enzymeactivity

For evaluating silencing efficiency in gene expression and enzy-matic activity, the GAPDH expression (normalized to the housekeeping genes) and the GAPDH activity (normalized to DNA con-tent) in cells transfected with GAPDH siRNA were compared toscrambled siRNA. The comparison was made between cells receiv-ing GAPDH-specific siRNA and scrambled siRNA using the sametransfection reagent, with the latter values set at 100%.

2.10. Viability

Toxicity of transfection reagents was examined by measuringlactate dehydrogenase (LDH) secreted by cells using the Cytotoxic-ity Detection KitPLUS (Roche Applied Science, Mannheim, Germany)following the manufacturer’s instruction. The LDH in culture

Table 1Primer sequences used for real time PCR. ACAN, aggrecan; COL1A1, a1 (I) procollagen; COL2A1, a1 (II) procollagen; COX-2, cyclooxgenase-2; GAPDH, glyceraldehyde-3-phosphatedehydrogenase; PCNA, proliferating cell nuclear antigen; RUNX2, runt-related transcription factor 2; SSP1, secreted phosphoprotein 1; YWHAZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide.

Target gene Oligonucleotide sequence Annealing temperature (�C) Product size (bp)

18S Forward 50 GTAACCCGTTGAACCCCATT 30 57 151Reverse 50 CCATCCAATCGGTAGTAGCG 30

ACAN Forward 50 CAACTACCCGGCCATCC 30 57 160Reverse 50 GATGGCTCTGTAATGGAACAC 30

COL1A1 Forward 50 TCCAACGAGATCGAGATCC 30 57 191Reverse 50 AAGCCGAATTCCTGGTCT 30

COL2A1 Forward 50 AGGGCCAGGATGTCCGGCA 30 56 195Reverse 50 GGGTCCCAGGTTCTCCATCT 30

COX-2 Forward 50 GCCCGACTCCCTTGGGTGTC 30 56 190Reverse 50 TTGGTGAAAGCTGGCCCTCGC 30

GAPDH Forward 50 ATGGGGAAGGTGAAGGTCG 30 60 70Reverse 50 TAAAAGCAGCCCTGGTGACC 30

p21 Forward 50 GCGACTGTGATGCGCTAATG 30 54 384Reverse 50 AGAAGATCAGCCGGCGTTTG 30

PCNA Forward 50 GAAGCACCAAACCAGGAGAA 30 54 193Reverse 50 TCACTCCGTCTTTTGCACAG 30

RUNX2 Forward 50 ATGCTTCATTCGCCTCAC 30 56 156Reverse 50 ACTGCTTGCAGCCTTAAAT 30

SSP1 Forward 50 CATCTCAGAAGCAGAATCTCC 30 56 355Reverse 50 CCATAAACCACACTATCACCTC 30

YWHAZ Forward 50 GATGAAGCCATTGCTGAACTTG 30 56 229Reverse 50 CTATTTGTGGGACAGCATGGA 30

38 H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44

supernatant (LDHsup) was measured at 490 nm with a referencewavelength 655 nm with a Benchmark Microplate reader (Bio-Rad). Total LDH activity (LDHtotal) was derived from measuringLDH of the cellular layer (LDHcell) lysed in KDalert™ Lysis Buffer(Ambion�), and adding this up to LDHsup. Viability of cells was ana-lyzed with the formula: viability (%) = (1 � (LDHsup/LDHtotal)) -� 100%. Viability of cells transfected with either GAPDH siRNA orscrambled siRNA was compared to controls (without siRNA andtransfection reagents).

2.11. DNA content

Cell growth was examined by measuring DNA content with theQuant-iT™ PicoGreen� dsDNA Kit (Invitrogen) at day 3 and day 6post-transfection. In the cell lysates obtained for the GAPDH activ-ity assay, DNA content was measured according to the manufac-turer’s protocol using a FlexStation� 3 Benchtop Multi-ModeMicroplate Reader (Molecular Devices, Downingtown, PA) at Ex/Em 485/538 nm. DNA content in cells transfected with either GAP-DH-specific siRNA or scrambled siRNA was compared to controls(without siRNA and transfection reagents).

2.12. Non-specific effects of transfection

For non-specific effects on GAPDH gene expression or enzymeactivity, comparison was made between cells transfected with siR-NA (GAPDH-specific or scrambled) and controls (without siRNAand transfection reagents), with the latter values set at 100%. Forevaluating non-specific effects on (de)-differentiation, proinflam-matory response and cell proliferation marker genes in cells trans-fected with either GAPDH siRNA or scrambled siRNA using relevanttransfection reagents were compared to controls (without siRNAand transfection reagent), with the latter values set at 100%.

2.13. Statistics

Statistical analysis was performed with SPSS 12.0.1 software(SPSS Inc., Chicago, IL, USA). Statistical significance was considered

when p values were less than 0.05. Differences in silencingefficiencies at RNA and protein levels compared to scrambled siR-NA were determined by unpaired t-tests. Cytotoxicity of transfec-tion reagents was compared to non-transfected controls byunpaired-t-tests. Analysis of variance (ANOVA) with host hoc testand Bonferroni corrections was performed for multiple compari-sons. Results are described as mean ± standard error of mean(SEM). Independent experiments were repeated three times withthree different cell donors. In each experiment, a group size ofsix per condition was included (n = 6). Representative results areshown.

3. Results

3.1. Cellular uptake of siGLO

In NP cells, ACs and MSCs, cellular uptake of fluorescence-la-beled siRNA could be seen with RNAiMAX, chitosan and PEI(Fig. 1). In RNAiMAX-mediated transfection, diffuse fluorescencewas abundantly found throughout both cytosol and nuclear com-partments in all three cell types. Additionally, brighter small gran-ules of fluorescent signals were present, which by confocalmicroscopy were confirmed to be at least partly intracellular (notshown). In chitosan-mediated transfection, brighter granules werefound mainly in the cytosol. In PEI-mediated transfection, somecells were observed with diffuse fluorescence in both cytosol andnucleus, but the majority of cells contained larger granules in thecytosol in all three cell types. When using modified HA, no cellularuptake of fluorescence-labeled siRNA was noticed in any of the celltypes used.

3.2. Silencing of GAPDH gene expression

Gene expression of GAPDH is summarized in Fig. 2. In all threecell types, RNAiMAX mediated transfection seemed to result inhigh silencing of GAPDH expression with both 20 nM and200 nM siRNA, although not always statistically significant. The

Fig. 1. Cellular uptake of fluorescence-labeled siRNA (siGLO) in nucleus pulposus (NP) cells, articular chondrocytes (AC) and mesenchymal stem cells (MSCs). Transfectionwas mediated by Lipofectamine RNAiMAX (RNAiMAX), chitosan, polyethylenimine (PEI) or hyaluronic acid (HA) at 20 nM siRNA. Nuclei were stained with DAPI and siRNAwas labeled with FAM (green). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44 39

silencing appeared to last until day 6 post-transfection. In chitosanand HA mediated transfections, no clear trend of silencing GAPDHwas noted. However, when using PEI for siRNA transfection, geneexpression could not be quantified by real-time PCR, due to thelimited amount of RNA that could be isolated in these conditions;the phenomenon was particularly noticed when using 200 nM siR-NA, for all three cell types.

3.3. Reduction of GAPDH activity

After transfection, GAPDH enzyme activity was also measuredand summarized in Fig. 2. When using RNAiMAX for transfection,significant reduction of GAPDH activity was seen in all cell typeswith both 20 nM and 200 nM siRNA. Furthermore, the proteinactivity seemed to be reduced to a higher extent at the later timepoint, especially in NP cells and ACs.

In chitosan mediated transfection, at day 3 post-transfection re-duced GAPDH activity was significantly noted with 200 nM siRNA;whereas at day 6 post-transfection reduced GAPDH activity, albeitless pronounced, was noted mostly with 20 nM siRNA.

In PEI mediated transfection, significant reduction of GAPDHactivity could be found in NP cells when using 20 nM siRNA at bothday 3 and day 6 post-transfection. Transfection performed withHA did not show significant knockdown.

3.4. Cell viability

In NP cells, 200 nM siRNA transfection with RNAiMAX causedmild cytotoxicity whereas PEI led to severe cytotoxicity at day 1,but viability started to recover after 3 days of transfection(Fig. 3). A similar trend was noticed in chondrocytes. Althoughcytotoxicity was also noticed at day 3 post-transfection usingchitosan at 200 nM, viability was restored afterwards as well. InMSCs, cytotoxicity was only noted with PEI at 200 nM siRNA. Noneof the conditions based on the transfection of 20 nM siRNA yieldedappreciable cytotoxicity.

3.5. DNA content

In NP and AC cells, a decrease in DNA content was noticed withRNAiMAX at 200 nM scrambled or GAPDH siRNA compared to non-transfected controls, in particular at day 6 post-transfection(Fig. 4).

In NP cells, reduced DNA content was also observed with chito-san at 200 nM scrambled or GAPDH siRNA compared to non-trans-fected controls, 3 days after transfection. DNA content withchitosan increased again from day 3 to day 6 with both siRNA con-centrations. A pronounced reduction in DNA content was observedwith PEI at 200 nM siRNA compared to non-transfected controls, atday 3 and day 6 post-transfection; at 20 nM siRNA, a decreasedDNA content was still noticed at day 6 post-transfection.

In AC cultures it was again noticed that when using RNAiMAX,DNA content decreased sharply by day 6 post-transfection. A sim-ilar trend was observed when using chitosan for transfection withthe reduced DNA content restored at day 6 post-transfection, how-ever, with 200 nM siRNA the DNA content remained lower thannon-transfected controls. When using PEI with 200 nM siRNA,the DNA content was still reduced by 6 days after transfection.

Also in MSC cultures, a reduced DNA content was noticed usingchitosan at 200 nM siRNA compared to non-transfected controls, atday 6 post-transfection. The pronounced reduction in DNA contentwith PEI was observed as well. RNAiMAX only affected DNA con-tent when using 200 nM scrambled siRNA in this cell type. No sig-nificant effect on DNA content with HA was found in any cell type.

3.6. Non-specific effects of transfection on GAPDH

In both cartilaginous cell types, GAPDH enzyme activity wassignificantly increased when chitosan was used for transfection,both at day 3 and 6 post-transfection (p < 0.01), with apparentdose-dependency (Fig. 5A). However, this phenomenon was onlyobserved for enzyme activity, not at gene expression level.

3.7. Effects of transfection on matrix-specific genes

In ACs, although not statistically significant, a trend towards up-regulation of COL2A1 gene was found upon RNAiMAX-mediatedtransfection (Fig. 5B), while ACAN and COL1A1 gene expression re-mained at the levels comparable to the non-transfected controls.These genes did not show any trend towards differential regulationin NP cells. No effects of transfection were observed in MSCs onCOL1A1. The expression levels of RUNX2 and SSP1 in MSCs werenot detectable in any of the conditions (data not shown).

Fig. 2. Gene expression of GAPDH and its enzyme activity in NP cells, AC cells and MSCs transfected with reagent RNAiMAX, chitosan, PEI, or HA. GAPDH-specific siRNA orscrambled siRNA were complexed with the four transfection reagents and added at a final concentration of 20 nM siRNA or 200 nM siRNA. Expression of GAPDH and itsenzyme activity in cells at day 3 and day 6 post-transfection were compared to cells transfected with scrambled siRNA (values set to 100%). In all three cell types, efficientgene silencing could be achieved by using RNAiMAX, with prolonged silencing at the protein level until 6 days. Silencing was also found for transfection mediated by chitosannanoparticles. Each bar represents the mean ± SEM (*p < 0.05, **p < 0.001). ‘‘X’’ denotes invalid gene expression or enzyme activity data.

Fig. 3. Cell viability of NP cells, AC cells and MSCs was evaluated at day 1, 3 and 6 post-transfection with four transfection reagents (RNAiMAX, chitosan, PEI, or HA)complexed with either GAPDH-specific siRNA or scrambled siRNA at a final concentration of 20 nM siRNA or 200 nM siRNA. Results are presented as viability of cells relativeto non-transfected controls, which was set to 100%. Each point represents the mean ± SEM (*p < 0.05, **p < 0.001).

40 H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44

3.8. Effects of RNAiMAX- and chitosan-mediated transfection on COX-2and cell cycle markers

Given current data on the introduction of inflammation by siR-NA transfection (Yoo et al., 2006), we also measured the expressionof COX-2 as a general inflammatory marker. The measurement fo-cused on RNAiMAX and chitosan which performed the best fortransfection in the current study among the four transfection

reagents, since PEI caused high cytotoxicity and HA did not showmuch silencing effect. The results showed that no significantinduction of COX-2 expression was induced (Fig. 6A). COX-2 geneexpression remained mostly comparable to non-transfected con-trols, despite some high standard deviations in some conditions.

As p21 inhibits cell proliferation and PCNA functions as a posi-tive regulator in cell cycle progression (el-Deiry et al., 1993; Magaand Hubscher, 2003), assessing its expression might provide

Fig. 4. DNA content of NP cells, AC cells and MSCs was measured at day 3 and day 6 post-transfection. Four transfection reagents (RNAiMAX, chitosan, PEI, or HA) werecomplexed with either GAPDH-specific siRNA or scrambled siRNA at a final concentration of 20 nM siRNA or 200 nM siRNA. Results are presented relatively to non-transfected controls, which were set to 100%. Each point represents the mean ± SEM (*p < 0.05, **p < 0.001).

Fig. 5. Non-specific effects of transfection on GAPDH gene expression and its enzyme activity, and type II collagen (COL2A1) expression. (A) Gene expression of GAPDH and itsenzyme activity in NP cells and AC cells at day 3 and day 6 post-transfection, using chitosan complexed with scrambled siRNA at a final concentration of 20 nM or 200 nMsiRNA. (B) Gene expression of COL2A1 in AC at day 6 post-transfection, using RNAiMAX complexed with 200 nM of either GAPDH-specific or scrambled siRNA. Results arepresented relatively to non-transfected controls, which were set to 100%. The data show mean ± SEM (*p < 0.05, **p < 0.001).

H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44 41

insights to changes in DNA content of cells subjected to transfec-tion, in particular when viability was not affected. In NP cells atday 6 post-transfection a trend of up-regulated p21 gene expres-sion was noticed with RNAiMAX and 200 nM siRNA. Significantp21 up-regulation was however found in ACs with RNAiMAX, sur-prisingly as well as with chitosan (p < 0.05). No significant differ-ence in MSCs was noted (Fig. 6B). On the other hand, in both NPand AC, PCNA was up-regulated at day 3 when using both RNAi-MAX and chitosan for 200 nM siRNA (p < 0.05). Interestingly,expression of PCNA was also up-regulated in MSCs using chitosanfor transfection (p < 0.05) (Fig. 6B).

4. Discussion

Modulation of gene expression of primary mesenchymal cellssuch as chondrocyte-like cells and MSCs holds considerable prom-ise in the elucidation of mechanisms and treatment of degenera-tive diseases of the joints by selective inhibition of degenerativefactors. In this study, we found that by using a conventional lipo-some-based transfection reagent efficient gene silencing could beachieved in cartilaginous cells and MSCs, with prolonged silencingat the protein level for at least 6 days. This finding is in line withother studies, which showed that lipid-based transfection mediaare efficient tools for siRNA transfection in vitro (Gilmore et al.,2004). A higher dose of transfection complexes did not result in ahigher degree of silencing when RNAiMAX was used. Silencing

was also found in transfection mediated by chitosan nanoparticles,albeit at a lower efficiency. In PEI-mediated transfection, reducedprotein activity was only observed in NP cells, but not in othertwo cell types. HA-based transfection was, however, not capableof inducing any meaningful silencing.

However, the effects of transfection with particular reagents(here the commonly used Lipofectamine and PEI, or reagents withchemistry relating to cartilaginous matrix) on cells involved inregeneration and degeneration of cartilaginous tissues are still un-known. In the current study the transfection reagents chosen fromdifferent types indeed showed differences in non-specific effects.The non-specific effects seemed to be transfection reagent- andpartly cell-type dependent. In the chondrocyte-like NP cells andarticular chondrocytes, liposome-mediated transfection seemedto cause a delayed reduction of cell DNA content, possibly throughinhibition of proliferation, although the early increase in toxicityalso could suggest cell death. Alternatively, these effects may havebeen associated with inhibition of proliferation since p21 expres-sion in ACs with 200 nM siRNA was induced and a similar trendcould be found for NP cells. Interestingly both in NP cells andACs, PCNA expression was induced at early time points with200 nM siRNA. Although PCNA is generally known for its role instimulating DNA synthesis (Stillman, 1994), it is also required forDNA repair and associated to chromatin remodeling (Kadyrovet al., 2006; Milutinovic et al., 2002). Therefore, it is speculated thatPCNA was first active in response to possible DNA repair or to DNAreplication, but its effect on cell cycle progression was however

Fig. 6. Non-specific effects of transfection on cyclooxgenase-2 (COX-2) and cell cycle markers. (A) Gene expression of COX-2 in NP cells, AC cells and MSCs at day 3 post-transfection, using RNAiMAX or chitosan complexed with either 20 nM or 200 nM of scrambled siRNA. (B) Gene expression of p21 and PCNA in NP cells, AC cells and MSCs atday 3 and day 6 post-transfection, using RNAiMAX or chitosan complexed with either 20 nM or 200 nM of scrambled siRNA. Results are presented relatively to non-transfected controls, which were set to 100%. The data show mean ± SEM (*p < 0.05, **p < 0.001).

42 H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44

later being dominated by the inhibitory machinery of p21. The de-creased cell content found in chondrocyte-like cells transfected

with chitosan is in line with the inhibition of cell proliferation ofhuman articular chondrocytes found upon contact with

H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44 43

chitosan-coated surfaces (Garcia Cruz et al., 2008). This may havebeen partly related to the high degree of deacetylation and highN:P ratio used here for efficient transfection.

In addition to non-specific effects on viability and changes incell content, effects on genes not associated with cell cycle werealso noted, again in particular with chondrocyte-like cells. Trans-fection with cationic liposomes in articular chondrocytes ap-peared to be accompanied by an increased COL2A1 expression,possibly in a dose-dependent manner. It is unclear how thismay have been brought about, although in general, terminal dif-ferentiation is thought to be accompanied by a halt in prolifera-tion. However, the effects were not strong enough to allow forfirm conclusions. Surprisingly, a clear increase of GAPDH activityby chitosan-mediated transfection of mock or GAPDH specific siR-NA was noticed in cartilaginous cells, although silencing was ob-served as compared with mock siRNA. No significant differencewas observed in MSCs. Such an effect of chitosan may be relatedto the high glucose-dependency of chondrocytes. Glucose mole-cules are the building blocks for proteoglycans, which are theessential components of the extracellular matrix of cartilage tis-sue (Mobasheri et al., 2002). Besides, glucose is a nutrient criticalfor maintaining chondrocyte viability since theses cells obtaintheir energy primarily through glycolysis (Findlay, 2007; Leeand Urban, 1997; Rajpurohit et al., 1996). Chitosan is a heteropol-ysaccharide composed of deacetylated unit D-glucosamine (GlcN)and acetylated unit N-acetyl-D-glucosamine (GlcNAc), linked byb-(1-4)-glycosidic bonds. Chitosan could be hydrolyzed by lyso-zymes, and the hydrolysis rate was found to be controlled bythe degree of deacetylation (Hirano et al., 1989). In addition,the deacetylated unit GlcN was shown to be actively importedinto articular chondrocytes and metabolized through the hexosa-mine pathway (Shikhman et al., 2009). As 98% deacetylated chito-san was used in the current study, a large amount of GlcN mightenter the glycolysis pathway as a form of fructose 6-phosphate(Stryer et al., 2002), which could possibly explain the increasedGAPDH enzymatic activity with this particular formulation. Nev-ertheless, it would be interesting to investigate if the observed ef-fect of chitosan could be reduced using a lower degree ofdeacetylation, lowering the charge density of the particles.

Despite the clear uptake of the fluorescent siRNA in PEI-medi-ated transfection, silencing of GAPDH in most of the cell typeswas not observed with this reagent, except for reduced GAPDHactivity with 20 nM siRNA in NP cells. However, the high cytotox-icity in transfection with 200 nM siRNA using PEI, also reflected inthe low RNA content, precludes any strong conclusion. Possibly thesurviving cells represented a selection from non-transfected cells.Although oxidative stress was previously shown to be induced inlung epithelial cells when using modified PEI for transfection (Bey-erle et al., 2010), COX-2 expression, which is inducible by oxidativestress was not found in the current study.

To facilitate the ability of HA to act as a transfection reagent,grafting of 3,30-diaminodipropylamine on a neutral polymer back-bone was achieved by an amidation reaction, which showedenhancement of siRNA complexation previously (Itaka et al.,2004). This material, however, did not provide efficient transfec-tion in the current study. This may be due to insufficient cationiccharges on the HA to enable efficient complexation. Since HA basedcellular uptake is HA receptor-dependent, this could also limittransfection in some specific cell lines, but this is not likely in car-tilaginous cells and MSCs, which were both shown to express theHA receptor CD44 (Dimitroff et al., 2001; Gan et al., 2003; Stevenset al., 2000). Although signaling mediated by hyaluronan and itsreceptors have been reported to affect cell proliferation or migra-tion in different types of cells (Sherman et al., 1994; Toole, 1997;Wang et al., 1998), these effects were however not observed inthe three cells types in the current study. Nevertheless, for more

efficient siRNA delivery, future design of a HA delivery vector withlarger cationic polymer groups should enable siRNA complexation.

Although the cause of these non-specific effects is largely un-known, lipid-based transfection mediators were shown previouslyto have an effect on global gene expression, early apoptosis andDNA damage in epithelial cells (Omidi et al., 2003). Similarly,changes in gene expression were also caused by polymer-basedtransfection reagents in an epithelial lung cancer cell line (Merkelet al., 2011). Polymer-induced effects such as defense responses,cell proliferation and apoptosis have been suggested to dependon cell type and the characteristics of the transfection reagent-DNA/RNA complex, including the structural architecture of thepolymer (Hollins et al., 2007; Omidi et al., 2005). Also for chitosanand HA, which could be speculated to be more suitable as transfec-tion reagents for cartilaginous cells owing to their similarity to car-tilage and IVD matrix molecules, non-specific effects noted in thecurrent study should not be overlooked.

In the current study we selected chemically very different re-agents rather than several subtypes of the same reagent speciesin order to investigate more pronounced differences. However,we cannot fully exclude that the differential effects between sub-types of cationic lipids could be larger than between different spe-cies of reagents. In addition, it has also been suggested that in vivoother transfection mechanisms may be active. Nevertheless, it isclear that in addition to focusing on therapeutic strategies, atten-tion should also be given to potential side-effects of delivery sys-tems and strategies to overcome them (Ballarin-Gonzalez andHoward, 2012). The current findings also emphasize the impor-tance of including appropriate controls such as non-transfectingconditions to rule out phenotypic changes as a consequence oftransfection per se.

5. Conclusions

Efficient gene silencing mediated by siRNA in primary cartilag-inous cells and MSCs in vitro in the current study was achievedmost successfully by delivering siRNA with a commercially avail-able lipid-based reagent. However, in addition to silencing effi-ciency and cytotoxicity, changes in cellular characteristics causedby non-specific effects of transfection were noted and should beovercome by optimization of the formulation. Cell type specific ef-fects were noted, suggesting that for each different cell type, thenon-specific effects of a particular reagent should again beinvestigated.

Acknowledgements

This research forms part of the Project P2.01 IDiDAS of the re-search program of the BioMedical Materials institute, co-fundedby the Dutch Ministry of Economic Affairs. The contribution ofthe Dutch Arthritis Association is gratefully acknowledged.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.ejps.2013.12.006.

References

Akhtar, S., Benter, I., 2007. Toxicogenomics of non-viral drug delivery systems forRNAi: potential impact on siRNA-mediated gene silencing activity andspecificity. Adv. Drug Deliv. Rev. 59, 164–182.

Ballarin-Gonzalez, B., Howard, K.A., 2012. Polycation-based nanoparticle delivery ofRNAi therapeutics: adverse effects and solutions. Adv. Drug Deliv. Rev. 64,1717–1729.

44 H.-y. Yang et al. / European Journal of Pharmaceutical Sciences 53 (2014) 35–44

Beyerle, A., Merkel, O., Stoeger, T., Kissel, T., 2010. PEGylation affects cytotoxicityand cell-compatibility of poly(ethylene imine) for lung application: structure–function relationships. Toxicol. Appl. Pharmacol. 242, 146–154.

Brooks, P.M., 2002. Impact of osteoarthritis on individuals and society: how muchdisability? Social consequences and health economic implications. Curr. Opin.Rheumatol. 14, 573–577.

Buckwalter, J.A., 1995. Aging and degeneration of the human intervertebral disc.Spine (Phila Pa 1976) 20, 1307–1314.

Carney, S.L., Muir, H., 1988. The structure and function of cartilage proteoglycans.Physiol. Rev. 68, 858–910.

Chen, L.X., Lin, L., Wang, H.J., Wei, X.L., Fu, X., Zhang, J.Y., Yu, C.L., 2008. Suppressionof early experimental osteoarthritis by in vivo delivery of the adenoviral vector-mediated NF-kappaBp65-specific siRNA. Osteoarthritis Cartilage 16, 174–184.

Dimitroff, C.J., Lee, J.Y., Rafii, S., Fuhlbrigge, R.C., Sackstein, R., 2001. CD44 is a majorE-selectin ligand on human hematopoietic progenitor cells. J. Cell Biol. 153,1277–1286.

Ducy, P., Zhang, R., Geoffroy, V., Ridall, A.L., Karsenty, G., 1997. Osf2/Cbfa1: atranscriptional activator of osteoblast differentiation. Cell 89, 747–754.

el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M., Lin, D.,Mercer, W.E., Kinzler, K.W., Vogelstein, B., 1993. WAF1, a potential mediator ofp53 tumor suppression. Cell 75, 817–825.

Fedorov, Y., Anderson, E.M., Birmingham, A., Reynolds, A., Karpilow, J., Robinson, K.,Leake, D., Marshall, W.S., Khvorova, A., 2006. Off-target effects by siRNA caninduce toxic phenotype. RNA 12, 1188–1196.

Findlay, D.M., 2007. Vascular pathology and osteoarthritis. Rheumatology (Oxford)46, 1763–1768.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potentand specific genetic interference by double-stranded RNA in Caenorhabditiselegans. Nature 391, 806–811.

Gan, J.C., Ducheyne, P., Vresilovic, E.J., Swaim, W., Shapiro, I.M., 2003. Intervertebraldisc tissue engineering I: characterization of the nucleus pulposus. Clin. Orthop.Relat. Res., 305–314.

Garcia Cruz, D.M., Gomez Ribelles, J.L., Salmeron Sanchez, M., 2008. Blendingpolysaccharides with biodegradable polymers. I. Properties of chitosan/polycaprolactone blends. J. Biomed. Mater. Res. B Appl. Biomater. 85, 303–313.

Gilmore, I.R., Fox, S.P., Hollins, A.J., Sohail, M., Akhtar, S., 2004. The design andexogenous delivery of siRNA for post-transcriptional gene silencing. J. DrugTarget. 12, 315–340.

Glasson, S.S., Askew, R., Sheppard, B., Carito, B., Blanchet, T., Ma, H.L., Flannery, C.R.,Peluso, D., Kanki, K., Yang, Z., Majumdar, M.K., Morris, E.A., 2005. Deletion ofactive ADAMTS5 prevents cartilage degradation in a murine model ofosteoarthritis. Nature 434, 644–648.

Grayson, A.C., Doody, A.M., Putnam, D., 2006. Biophysical and structuralcharacterization of polyethylenimine-mediated siRNA delivery in vitro.Pharm. Res. 23, 1868–1876.

Hirano, S., Tsuchida, H., Nagao, N., 1989. N-acetylation in chitosan and the rate of itsenzymic hydrolysis. Biomaterials 10, 574–576.

Hollins, A.J., Omidi, Y., Benter, I.F., Akhtar, S., 2007. Toxicogenomics of drug deliverysystems: exploiting delivery system-induced changes in target gene expressionto enhance siRNA activity. J. Drug Target. 15, 83–88.

Hoyland, J.A., Le Maitre, C., Freemont, A.J., 2008. Investigation of the role of IL-1 andTNF in matrix degradation in the intervertebral disc. Rheumatology (Oxford) 47,809–814.

Itaka, K., Kanayama, N., Nishiyama, N., Jang, W.D., Yamasaki, Y., Nakamura, K.,Kawaguchi, H., Kataoka, K., 2004. Supramolecular nanocarrier of siRNA fromPEG-based block catiomer carrying diamine side chain with distinctive pKadirected to enhance intracellular gene silencing. J. Am. Chem. Soc. 126, 13612–13613.

Iwamoto, T., Nakamura, T., Doyle, A., Ishikawa, M., de Vega, S., Fukumoto, S.,Yamada, Y., 2010. Pannexin 3 regulates intracellular ATP/cAMP levels andpromotes chondrocyte differentiation. J. Biol. Chem. 285, 18948–18958.

Iwata, T., Kawamoto, T., Sasabe, E., Miyazaki, K., Fujimoto, K., Noshiro, M., Kurihara,H., Kato, Y., 2006. Effects of overexpression of basic helix-loop-helixtranscription factor Dec1 on osteogenic and adipogenic differentiation ofmesenchymal stem cells. Eur. J. Cell Biol. 85, 423–431.

Judge, A.D., Sood, V., Shaw, J.R., Fang, D., McClintock, K., MacLachlan, I., 2005.Sequence-dependent stimulation of the mammalian innate immune responseby synthetic siRNA. Nat. Biotechnol. 23, 457–462.

Kadyrov, F.A., Dzantiev, L., Constantin, N., Modrich, P., 2006. Endonucleolyticfunction of MutLalpha in human mismatch repair. Cell 126, 297–308.

Kakutani, K., Nishida, K., Uno, K., Takada, T., Shimomura, T., Maeno, K., Kurosaka, M.,Doita, M., 2006. Prolonged down regulation of specific gene expression innucleus pulposus cell mediated by RNA interference in vitro. J. Orthop. Res. 24,1271–1278.

Kim, E.J., Shim, G., Kim, K., Kwon, I.C., Oh, Y.K., Shim, C.K., 2009. Hyaluronic acidcomplexed to biodegradable poly L-arginine for targeted delivery of siRNAs. J.Gene Med. 11, 791–803.

Kjellen, L., Lindahl, U., 1991. Proteoglycans: structures and interactions. Annu. Rev.Biochem. 60, 443–475.

Lee, R.B., Urban, J.P., 1997. Evidence for a negative Pasteur effect in articularcartilage. Biochem. J. 321 (Pt 1), 95–102.

Lee, H., Mok, H., Lee, S., Oh, Y.K., Park, T.G., 2007. Target-specific intracellulardelivery of siRNA using degradable hyaluronic acid nanogels. J. ControlledRelease 119, 245–252.

Maga, G., Hubscher, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancerwith many partners. J. Cell Sci. 116, 3051–3060.

Merkel, O.M., Beyerle, A., Beckmann, B.M., Zheng, M., Hartmann, R.K., Stoger, T.,Kissel, T.H., 2011. Polymer-related off-target effects in non-viral siRNA delivery.Biomaterials 32, 2388–2398.

Milutinovic, S., Zhuang, Q., Szyf, M., 2002. Proliferating cell nuclear antigenassociates with histone deacetylase activity, integrating DNA replication andchromatin modification. J. Biol. Chem. 277, 20974–20978.

Mobasheri, A., Vannucci, S.J., Bondy, C.A., Carter, S.D., Innes, J.F., Arteaga, M.F.,Trujillo, E., Ferraz, I., Shakibaei, M., Martin-Vasallo, P., 2002. Glucose transportand metabolism in chondrocytes: a key to understanding chondrogenesis,skeletal development and cartilage degradation in osteoarthritis. Histol.Histopathol. 17, 1239–1267.

Motomura, H., Niimi, H., Sugimori, K., Ohtsuka, T., Kimura, T., Kitajima, I., 2007.Gas6, a new regulator of chondrogenic differentiation from mesenchymal cells.Biochem. Biophys. Res. Commun. 357, 997–1003.

Mumper, R.J., Wang, J., Claspell, J.M., Rolland, A.P., 1995. Novel polymericcondensing carriers for gene delivery. Proc. Intl. Symp. Controlled Rel. Bioact.Mater. 22, 178–179.

Oh, Y.K., Suh, D., Kim, J.M., Choi, H.G., Shin, K., Ko, J.J., 2002. Polyethylenimine-mediated cellular uptake, nucleus trafficking and expression of cytokineplasmid DNA. Gene Ther. 9, 1627–1632.

Omidi, Y., Hollins, A.J., Benboubetra, M., Drayton, R., Benter, I.F., Akhtar, S., 2003.Toxicogenomics of non-viral vectors for gene therapy: a microarray study oflipofectin- and oligofectamine-induced gene expression changes in humanepithelial cells. J. Drug Target. 11, 311–323.

Omidi, Y., Barar, J., Akhtar, S., 2005. Toxicogenomics of cationic lipid-based vectorsfor gene therapy: impact of microarray technology. Curr. Drug Delivery 2, 429–441.

Piron, E., Domard, A., 1997. Interaction between chitosan and uranyl ions. Part 1.Role of physicochemical parameters. Int. J. Biol. Macromol. 21, 327–335.

Rajpurohit, R., Koch, C.J., Tao, Z., Teixeira, C.M., Shapiro, I.M., 1996. Adaptation ofchondrocytes to low oxygen tension: relationship between hypoxia and cellularmetabolism. J. Cell. Physiol. 168, 424–432.

Rutges, J.P., Kummer, J.A., Oner, F.C., Verbout, A.J., Castelein, R.J., Roestenburg, H.J.,Dhert, W.J., Creemers, L.B., 2008. Increased MMP-2 activity duringintervertebral disc degeneration is correlated to MMP-14 levels. J. Pathol. 214,523–530.

Sherman, L., Sleeman, J., Herrlich, P., Ponta, H., 1994. Hyaluronate receptors: keyplayers in growth, differentiation, migration and tumor progression. Curr. Opin.Cell Biol. 6, 726–733.

Shikhman, A.R., Brinson, D.C., Valbracht, J., Lotz, M.K., 2009. Differential metaboliceffects of glucosamine and N-acetylglucosamine in human articularchondrocytes. Osteoarthritis Cartilage 17, 1022–1028.

Sioud, M., 2005. Induction of inflammatory cytokines and interferon responses bydouble-stranded and single-stranded siRNAs is sequence-dependent andrequires endosomal localization. J. Mol. Biol. 348, 1079–1090.

Stevens, J.W., Kurriger, G.L., Carter, A.S., Maynard, J.A., 2000. CD44 expression in thedeveloping and growing rat intervertebral disc. Dev. Dyn. 219, 381–390.

Stillman, B., 1994. Smart machines at the DNA replication fork. Cell 78, 725–728.Stryer, L., Berg, J.M., Tymoczko, J.L., 2002. Biochemistry, fifth ed. W.H. Freeman,

New York.Sudo, H., Minami, A., 2011. Caspase 3 as a therapeutic target for regulation of

intervertebral disc degeneration in rabbits. Arthritis Rheum. 63, 1648–1657.Toole, B.P., 1997. Hyaluronan in morphogenesis. J. Intern. Med. 242, 35–40.Wang, C., Thor, A.D., Moore 2nd, D.H., Zhao, Y., Kerschmann, R., Stern, R., Watson,

P.H., Turley, E.A., 1998. The overexpression of RHAMM, a hyaluronan-bindingprotein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase and is a significant parameter in breast cancerprogression. Clin. Cancer Res. 4, 567–576.

Wang, M., Sampson, E.R., Jin, H., Li, J., Ke, Q.H., Im, H.J., Chen, D., 2013. MMP13 is acritical target gene during the progression of osteoarthritis. Arthritis Res. Ther.15, R5.

Yoo, J.W., Hong, S.W., Kim, S., Lee, D.K., 2006. Inflammatory cytokine induction bysiRNAs is cell type- and transfection reagent-specific. Biochem. Biophys. Res.Commun. 347, 1053–1058.

Zhang, F., Tsai, S., Kato, K., Yamanouchi, D., Wang, C., Rafii, S., Liu, B., Kent, K.C., 2009.Transforming growth factor-beta promotes recruitment of bone marrow cellsand bone marrow-derived mesenchymal stem cells through stimulation ofMCP-1 production in vascular smooth muscle cells. J. Biol. Chem. 284, 17564–17574.

Zhou, H.W., Lou, S.Q., Zhang, K., 2004. Recovery of function in osteoarthriticchondrocytes induced by p16INK4a-specific siRNA in vitro. Rheumatology(Oxford) 43, 555–568.