cd24, a signal-transducing molecule expressed on human b ......reintroduced into fresh cos-1 cells...

(CANCER RESEARCH 52, 5264-5270. October I. 1992]

CD24, a Signal-transducing Molecule Expressed on Human B Cells, Is a MajorSurface Antigen on Small Cell Lung Carcinomas1

David Jackson,2 Robert Waibel, Erich Weber, John Bell, and Rolf A. Stahel

Molecular Immunology Group, John Radcliffe Hospital, Oxford, UK [D. J., J. B.], and Department of Medicine, Division of Oncology, University Hospital, ZÃ¼rich,Switzerland {R. W., E. W., R. A. S.J

ABSTRACT

Cell lines derived from human small cell carcinoma of the lung express high levels of a surface polypeptide termed the cluster-w4 antigen,which was previously identified as a potential target for toxin-based

immunotherapy of lung cancer. We have cloned a complementary DNAencoding the cluster-Â«-! antigen from COS-1 fibroblasts transfected

with a SW2 small cell carcinoma library, by panning with a mixture ofthe cluster-w4-specific monoclonal antibodies SYVA11, SWA21, andSVVA22. The sequence of the cluster-w4 complementary DNA encodesan unusually short (80-amino acid) protein identical to that recently

reported for the leukocyte activation molecule CD24 except for a singlevaline-alanine substitution due to a single-base polymorphism within

the region of the gene coding for the extracellular domain. Biochemicalanalyses of the cloned cluster-w4 antigen confirmed both the presence of

the phosphatidylinositol tail and the extensive glycosylation reportedfor the CD24 molecule. Furthermore, the cloned cluster-w4 antigen

expressed on COS cells was shown to react with a comprehensive panelof CD24-specific monoclonal antibodies, as assessed by indirect iminii-

nofluorescence staining.Northern blot hybridization indicated the presence of several tran

script sizes for the cluster-w4 antigen that were greatly overexpressed insmall cell carcinoma cell lines, compared with normal hemopoietic cellsand CD24-positive cell lines. Southern blot hybridization of restrictiondigests of genomic DNA identified a complex pattern of bands consistent with either a complex gene structure containing many exons or thepresence of a family of closely related genes.

INTRODUCTION

SCLC3 accounts for >10% of all deaths from cancer in the

United States (1). More than 90% of patients with SCLC diewithin 2 years of the initial diagnosis and, despite improvements in conventional forms of treatment including surgery,radiotherapy, and chemotherapy, the long term survival rate isstill 6 x 10s antigenic

sites/cell) on SCLC cell lines. Secondly, antibodies reactivewith the cluster-w4 antigen exhibit high lytic activity towardstarget cells in the presence of human complement. Thirdly,radioiodinated SWA 11 (7), abrin A chain immunotoxin (8),and ricin A chain immunotoxin4 have a significant antitumor

effect in SCLC xenografts.In this paper we report the cloning and sequencing of a cDNA

encoding the cluster-w4 antigen from an SCLC library expressed in COS cells, by panning with the monoclonal antibodies SWA11, SWA21, and SWA22. Surprisingly, we found thatthe sequence of the cluster-w4 antigen cDNA is identical to thatof the leukocyte activation antigen CD24, with the exception ofa single valine-alanine substitution within the extracellular domain. We also present a detailed biochemical characterizationof the cloned cluster-w4 antigen that confirms its identity withthe CD24 molecule at the protein level.

MATERIALS AND METHODS

Monoclonal Antibodies. The monoclonal antibodies SWA11 (IgG2a),SWA21 (IgG3), and SWA22 (IgG3) specific for the SCLC clus-ter-w4 antigen were prepared by immunizing BALB/c mice withthe SCLC cell line SW2, as described previously (6).

Monoclonal antibodies reactive with the CD24 antigen either werepurchased commercially (CLB-gran/B-Ly, Janssen Biochimica, Beerse,Belgium; OKB-2, Ortho Diagnostic, Raritan, NJ) or were kindly provided by investigators (VIB C5 and VIB E3, Dr. W. Knapp, Institute ofImmunology, University of Vienna, Austria). Antibodies SN 3, LC 66,32D12, ML5, and BAI were obtained through the Fourth InternationalWorkshop on Human Leukocyte Differentiation Antigens. The negative control antibody SEN6 (cluster-1) was developed in our own laboratory.

Tumor Cell Lines and the Preparation of WBC. The SCLC cell linesN417, H526, H249, and DC571 were kindly provided by Dr. D. N.Carney, Mater Misericordiae Hospital (Dublin, Ireland), and the pre-Blymphoblastic leukemia cell line NALM-6 was provided by Dr. V.Goldmacher, Immunogen (Cambridge, MA). All other cell lines employed for screening of antibody reactivity or for Northern blottinganalyses were either generated in our own laboratory or obtained fromAmerican Type Tissue Collection or from sources that have alreadybeen described (6). The cell lines were cultured in RPMI 1640 medium

4 U. Zangenmeister-Wittke, H. P. Lehmann, R. Waibel, E. J. Wawarzynczak,and R. A. Stahel. Selective cytotoxicity of a deglycosylated ricin A chain immunotoxin against human small cell lung cancer in vitro and in vivo, submitted forpublication.

5264

on April 3, 2021. © 1992 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

IDENTITY OF CD24 WITH SCLC CLUSTER-W4 ANTIGEN

supplemented with 10% fetal calf serum and 2 mivii.-glutamine. Mono-

nuclear WBC were obtained by Ficoll separation and granulocytes wereobtained by Percoli separation.

Indirect Immunofluorescent Antibody Staining/Flow Cytometry.Cells (2 x IO5) in 25 M'PBS, pH 7.5, supplemented with bovine serumalbumin (1%) and sodium azide (0.1%), were incubated (4Â°C,1 h) in thepresence of the appropriate monoclonal antibody (10~7 M), washed by

centrifugation, and reincubated with fluorescein isothiocyanate-goatanti-mouse Fab prior to either direct analysis on a Becton Dickinson

FACScan or fluorescence microscopy using a Zeiss Axioskop microscope (Carl Zeiss, Thornwood, NY).

Construction of cDNA Libraries and Expression Cloning of the Clus-ter-w4 Antigen cDNA. cDNA libraries were constructed in the plasmiciexpression vector pCDMS by oligo deoxythymidylate-primed reversetranscription of total cellular RNA (10 Mg)prepared from the small cellcarcinoma line SW2, essentially as described originally by Aruffo andSeed (9). The cDNAs were size selected by density gradient centrifugation (5-20%, w/v, potassium acetate) and ligated into the BstXl cloningsite of pCDMS as described previously (10). The primary SW2 librarycontained 1 x IO6 clones.

For the expression cloning procedure the cDNA libraries were mixedand transfected into COS-1 cell monolayers using DEAE-dextran. After 48 h, transfectants were incubated with a mixture of the SWA11,SWA21, and SWA22 monoclonal antibodies (1/10 dilution of hybri-doma culture supernatants, 30 min, 4Â°C),and cells expressing the clus-

ter-w4 antigen were recovered by panning on goat anti-mouse IgG-

coated dishes. Plasmids were rescued from adherent cells andreintroduced into fresh COS-1 cells (by spheroplast fusion, Escherichiacoli MC1061-P3) for two further rounds of antibody panning (9, 10).

Finally, selected plasmid clones were tested for their ability to directsynthesis of the cluster-w4 antigen by retransfection into COS-1 cellsfollowed by indirect immunofluorescence staining with cluster-w4 monoclonal antibodies (see above).

Northern and Southern Blots. For Northern blot analyses, totalRNA was prepared from cell lines using the one-step acid guanidiniumisothiocyanate extraction method (11) and was electrophoresed on for-maldehyde-agarose gels (1.2% agarose) prior to transfer to nitrocellulose membranes (Hybond-C extra; Amersham, Buckinghamshire, England), according to standard methods (12).

For Southern blot analyses, genomic DNA was prepared from normal human peripheral blood mononuclear cells using the sodium dode-cyl sulfate/proteinase K procedure (12), and 10-Mgsamples were digested overnight (37Â°C)with 50 units of the appropriate restriction

endonuclease (see Fig. 5) prior to electrophoresis (0.8% agarose) andtransfer to nitrocellulose.

Filters were hybridized (overnight, 42Â°C,50% formamide/3x SSC)

with an Xbal fragment containing the full-length cluster-w4 cDNAsequence that had been -12P-radiolabeled by means of random hexanu-

cleotide priming. Blots were washed either at high stringency (30 min,65Â°C,0.2X SSC) or at reduced stringency (30 min, 2x SSC, 37Â°C)prior

to autoradiography.DNA Sequence Determination. Of three independent cluster-w4

cDNA clones, one was sequenced by the dideoxy nucleotide chain termination method (13) both directly in the pCDMS vector and aftersubcloning into the Xbal site of M13 mpl8. Both DNA strands werefully sequenced using synthetic oligonucleotide primers and 7-deaza-guanidine in place of dGTP. In addition, three additional cDNA clonesin M13 mpl8 were sequenced from the SW2 cell line and eight eachfrom the cell lines DC571 (SCLC) and Daudi (B lymphoblastoid).These latter clones were generated by PCR amplification of cDNAsynthesized from total RNA (10 Mg/synthesis) in oligo deoxythymidylate-primed reactions catalyzed by reverse transcriptase. The PCR reactions included the primers (0.2 MM;each of which contains Xbal sites)in the presence of all four deoxynucleotide triphosphates (0.25 MM)dissolved in 10 nui Tris-HCI buffer, pH 8.3, supplemented with 50 ITIMKC1, 1 ITIMMgCl2, and 2.5 units Taq polymerase (Boehringer Mannheim GMBH, Mannheim, Germany). The conditions used were 94Â°Cfor 1 min, 55Â°Cfor 1 min, and 72Â°Cfor 1 min, for 30 cycles (Perkin

Elmer-Cetus DNA thermal cycler). PCR products were again clonedinto the Xbal site of M13 mpl8 for sequencing.

Partial Purification of the Cluster-w4 Antigen from Whole-Cell Ly-sates. The cluster-w4 antigen was isolated in partially purified formfrom cells after lysis in ice-cold PBS, pH 7.5, containing 0.2% A'-dode-cyl-A',A'-dimethylammonio-3-propanesulfonate and each of the pro

tease inhibitors phenylmethylsulfonyl fluoride (1 mM), leupeptin (0.1ITIM),and pepstatin A (50 Mg/ml). Following centrifugation of the celllysate (100,000 x g, l h), the supernatant was decanted and subjected toa single round of heat denaturation (97Â°C,30 min). After further cen

trifugation (100,000 x g, l h) to remove denatured protein, the supernatant, which was enriched for the heat-stable cluster-w4 antigen, wasrecovered and stored at â€”¿�70Â°C.

Detection of Cluster-w4 Antigen by SDS-Polyacrylamide GelElectrophoresis/Western Blotting. Samples of partially purified antigen derived from 5 x IO6cells (see above) were separated on 15% SDS-

polyacrylamide gels. After electrophoresis the gels were incubated sequentially (3 x 20 min) in 8 Murea, 4 Murea, and 2 M urea to inducerefolding of the cluster-w4 antigen prior to transfer onto nitrocellulose,as described previously (14). Blots were incubated with the SWA 11monoclonal antibody (hybridoma supernatant, 12 h) prior to development with alkaline phosphatase-conjugated goat anti-mouse IgG (Bio-Rad, Richmond, CA) in the presence of the chromogenic substrate5-bromo-4-chloro-3-indolyl phosphate and nitrotetrazolium blue chlo

ride.Deglycosylation of the Cluster-w4 Antigen and Removal of the Phos-

phatidylinositol-Lipid Anchor. Partially purified cluster-w4 antigenwas treated with TFMSA to remove both N- and O-linked carbohydrates (15, 16). Briefly, samples of cell lysate containing approximately5 mg of protein were dried thoroughly before deglycosylation in 1 ml ofanisole-TFMSA (33%, v/v), with stirring, for 4 h. The deglycosylatedprotein was precipitated by the addition of 2 volumes of diethyl ether(precooled to -20Â°C) followed by 3 ml of ice-cold 50% (v/v) aqueous

pyridine. After repeated ether extraction, the aqueous phase was dia-lyzed against a solution of pyridine acetate (2 HIM,pH 5.5) and lyo-philized.

For removal of the Pl-lipid anchor, intact SW2 cells were treatedwith Bacillus cereus Pi-specific phospholipase C (Boehringer Mannheim) by incubating a suspension of cells (1 x IO6in 1 ml PBS, pH 7.5)at 37Â°Cfor 1 h with 1 unit of enzyme.

RESULTS

Isolation of cDNA Clones Encoding the Cluster-w4 Antigen.Individual cDNA clones encoding the cluster-w4 antigen wererecovered from a SW2 small cell carcinoma cDNA library inthe pCDM8 vector by antibody panning of transfected COS-1cells with a mixture of the monoclonal antibodies SWA11,SWA21, and SWA22. After three successive rounds of antibodypanning and plasmid retrieval, 12 plasmid clones were recovered for further analysis and three of these contained the same421-base pair cDNA insert. The other nine clones representedpCDMS vector from which the cDNA inserts had been deletedduring the successive rounds of antibody selection. All threecloned cDNAs directed surface expression of cluster-w4 antigen when transfected into COS cells, as assessed by stainingwith the SWAI 1, SWA21, and SWA22 monoclonal antibodiesand indirect immunofluorescence analysis (Fig. 1).

Sequencing of the cluster-w4 cDNA indicated the presence ofan unusually short translational reading frame of 80 aminoacids beginning with the ATG at position 60 and terminatingwith the TAA triplet at position 300 of the nucleotide sequence(Fig. 2). The derived amino acid sequence predicted (a) anamino-terminal hydrophobic region with the characteristics of acleavable leader peptide, (b) a short hydrophilic extracellulardomain containing a high proportion of serine and threonine

5265




Fig. 1. Indirect immunofluorescence staining of COS-I cells transfected withthe SCLC cluster-w4 antigen cDN A. Control COS-1 cells (not shown) and COS-1cells transfected with the cloned cluster-w4 antigen cDNA were stained with themonoclonal antibody SWA II followed by fluorescein isothiocyanate-conjugatedgoat anti-mouse IgG. as described in "Materials and Methods."

residues, and (c) a short and weakly Hydrophobie carboxyl-terminal sequence that is likely to function as a displacablesignal for the addition of a glycosyl-PI membrane anchor (seebelow).

Comparison of the cluster-w4 antigen amino acid sequencewith the protein sequence database revealed approximately75% identity with the murine leukocyte Ml/69-Jlld surfaceantigen (Fig. 2), a short (76-residue) Pi-linked heat-stable gly-coprotein whose expression is differentially regulated duringlymphocyte and monocyte differentiation (17). After the completion of this work, the sequence of the CD24 antigen, a human homologue of the mouse M1/69-J1 Id molecule, was pub

lished (18), and comparison of the sequence with that of thecluster-w4 antigen cDNA revealed that the two molecules wereidentical except for a single T-C base change (position 229)within the coding region that results in a valine-alanine substitution at position 57 of the polypeptide chain (Fig. 2). We havedetected both classes of transcript in the small cell carcinomaline DC571 by means of RNA/PCR, confirming that the T-Csubstitution at position 229 represents a true sequence polymorphism. Interestingly, the CD24-positive B cell line Daudiappears to express only transcripts containing cytidine at position 229.

A second difference between our cluster-w4 antigen cDNAsequence and that recently reported for the CD24 antigen fromK562 cells is the length of the 3' UT sequence. Most of the1.5-kilobase 3' UT region of the published CD24 cDNA se

quence (data not shown) was absent from the cluster-w4 clones,which retained only a 121-base pair segment. Deletion of this 3'

UT region, which contains two polyadenylation signals, is assumed to have occurred during the expression cloning procedure.

The identity between the cluster-w4 and CD24 cDNA sequences was an intriguing and unexpected finding. Like theM1/69-J1 Id antigen, the CD24 molecule is also a lymphocytedifferentiation marker, and evidence suggests that it can regulate cellular proliferation by functioning as a signal transducer.Thus far the expression of CD24 on small cell lung carcinomahas not been reported in the literature.

RNA transcripts hybridizing with the cluster-w4 cDNA weredetected in all of the small cell lung carcinoma cell lines testedincluding SW2, PO5, DC571, H60, H249, N417, OHI, andOH3, the lung adenocarcinoma lines A23 and A549, and thelung squamous cell carcinoma line Hotz (Fig. 3). In each case apredominant transcript of approximately 2.5 kilobases was detected in addition to several smaller and less abundant transcripts (approximately 1.4, 0.8, and 0.5 kilobases) that wereapparent particularly in the SW2 and DC571 cell lines. Thecluster-w4 cDNA obtained by our expression cloning strategy

Fig. 2. Complete sequence of the SCLCcluster-w4 antigen cDNA and comparisonwith those of the human leukocyte CD24 andmouse M1 /69-J11 d surface antigens. A, nucle-otide and derived amino acid sequences for theSCLC cluster-w4 antigen, with residues numbered from the left. The regions encoding thepredicted amino-terminal leader and the dis-placable carboxyl-terminal PI signal sequenceare underlined. Also shown are the two potential /V-glycosylation sites (boxes) and the various potential 0-glycosylation sites (asterisks).Arrow, the single-residue difference betweenthe cluster-w4 sequence and the CD24 antigen.B, amino acid sequences of the SCLC clus-Ier-w4 antigen cDNA, the human leukocyteCD24 antigen cDNA (18), and the mouseMl/69 Jl Id surface antigen cDNA (17).

11

572

29144

53216

77288360

B

SCLCW4CD24

HI/69Jlld

SCLCW4CD24

MI/69Jlld

SCLCW4CD24

MI/69Jlld

GGGCGGTTCTCCAAGCACCCAGCATCCTGCTAGACGCGCCGCGCACCGACGGAGGGGACATGGGCAGAGCA

MVARLGLGLLLLALLLP T Q I Y S S EATGGTGGCCAGGCTCGGGCTGGGGCTGCTGCTGCTGGCACTGCTCCTACCCACGCAGATTTATTCCAGTGAA

T T G T Q S N P T l_NACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTGGCCCCAAATCCAACTAAT

L Q S L S L LGCCACCACCAAGGTGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTCGTGGTCTCACTCTCTCTTCTG

CATCTCTACTCTTAAGAGACTCAGGCCAAGAAACGTCTTCTAAATTTCCCCATCTTCTAAACCCAATCCAAATGGCGTCTGGAAGTCCAATGTGGCAAGGAAAAACAGGTCTTCATCGAATCTACTAATTCCA 421

M G R A MM G R A M

ARAR

LGLG

LGLLLLALLLPTQLGLLLLALLLPTQ

Y S SY S S

Y â€¢¿�â€¢¿�

ETTTGTSSETTTGTSS

..CNQTSV

S S Q S T SS S Q S T S

S G L A PS G L A P

p T NP T N

N P S N

K L QV VTKAAGGALQSTASLF

TRGGGSSLQSTAGLLALSL

L S L L

S L L

LYLY

A TA T

H L T

5266




RNA SI/.C

(Kb)HE4.4

^Â»2.4

*-1.4

^â€¢Â«â€¢**fÂ«QÂ»â€¢ÃŒ4X

Ã«bto

Fig. 4. Analysis of the cluster-w4 gene and related sequences by Southern blothybridization. Samples of human genomic DNA (10 Â»ig)from a single normalindividual were digested with each of the restriction enzymes shown prior toseparation on a 0.8% agarose gel and transfer to nitrocellulose, as described in"Materials and Methods." The filter was probed with the same full-length clus-ter-w4 cDNA as in Fig. 3 and was washed at reduced stringency (2x SSC, 37"C,30 min; see "Materials and Methods") to identify the gene and related genomicsequences. The positions of DNA size markers (///'/Â«/Ill-cut A DNA and Hae\\\-

cut 0X174 DNA) are shown to the left.

5267




Fig. 5. Characterization of the SCLC clus-ter-w4 antigen by Western blotting. Samplesof heat-treated detergent extracts containingpartially purified cluster-w4 antigen fromSCLC cell lines and Iransfected COS-1 cellswere electrophoresed on 15% SDS-polyacry-lamide gels. After transfer to nitrocellulose,the cluster-w4 antigen was detected with themonoclonal antibody SWA11, as described in"Materials and Methods." A, comparison ofthe molecular weights of cluster-w4 antigenfrom the SCLC cell lines OH3 and SW2 withtransfected COS-1 cells (CT). UntransfectedCOS-1 cells (O were included as a negativecontrol. B, molecular weight of the cluster-w4antigen from SW2 cells before (5>f2) and after(degly SW2) deglycosylation with TFMSA(see "Materials and Methods"). The molecularweight calibration markers (M) were phospho-rylase ft (A/r 97,000; M, 110,000 prestainedmarker), bovine serum albumin (M, 66.000;M, 84,000 prestained), ovalbumin (M, 45,000;M, 47,000 prestained), carbonic anhydrase(M, 29,000; M, 33,000 prestained), soybeantrypsin inhibitor (M, 20,000; M, 24,000prestained), and lysozyme (M, 14.000; M,16,000 prestained).

110-

84-

47-

33-

24-

16-

9i

97-

l

M

45-

29- *

20-

14-

OH3 SW2 CT M SW2

Bglycosylation. Treatment with TFMSA to hydrolyze both N-and 0-glycosidic linkages reduced the apparent size of the clus-ter-w4 antigen from SW2 cells to a single species of A/r 14,000(Fig. 5), a molecular weight identical to that reported for thecore polypeptide of CD24, suggesting that both CD24 and thecluster-w4 antigen are glycosylated similarly in B cells andSCLC lines. The reactivity of the deglycosylated cluster-w4antigen with the SWA 11 antibody further indicates that theSWAI 1 epitope is located within the protein core of the antigen, consistent with our observation that detection of the protein on Western blots is critically dependent upon the inclusionof a renaturation step in the presence of urea (see "Materialsand Methods").

Interestingly the cluster-w4 antigen could not be detected onnondenaturing isoelectric focusing gels without prior deglycosylation in TFMSA, suggesting that the antigen forms largemolecular aggregates via its constituent carbohydrate chains.The deglycosylated protein migrated with an apparent isoelectric point of pH 3.6 (data not shown).

Treatment of the SW2 cell line with Pi-specific phospholi-pase C released essentially all of the cluster-w4 antigen duringa 60-min incubation at 37Â°C(Fig. 6), confirming that the

polypeptide is attached to the plasma membrane of SCLC cellsvia a PI-lipid anchor, in common with the CD24 antigen inhuman B cells.

Serological Identity between the Cluster-w4 and CD24 Antigens. In spite of the identity between the cluster-w4 and CD24antigens in terms of both primary sequence and biochemicalproperties, the possibility still remained that the molecules,when expressed on tumor cells and lymphocytes, might differon the basis of post-translational modifications, for example asa result of tissue-specific glycosylation. To investigate this possibility SW2 cells were tested by immunofluorescence for reactivity with a comprehensive panel of CD24 monoclonal antibodies, including several (VIB E3, BAI, CLB-Gran-B-ly, andHB9) (19) that recognize carbohydrate epitopes containingneuraminic acid. As shown by the results in Table 1, all eight ofthe CD24 monoclonal antibodies bound to the cluster-w4 antigen on SW2 cells. Similar results were also obtained when theCD24 panel was screened on transfected COS cells. Conversely,the three cluster-w4 monoclonal antibodies SWA11, SWA21,

ÃœCCD3CTCD

CDÃœ

1B0B

intensityFig. 6. Demonstration of a PI-lipid anchor in the SCLC cluster-w4 antigen.

The figure shows a FACScan analysis of samples from the SCLC cell line SW2both before (A) and after (B) Pi-specific phospholipase C treatment. Cells werestained with the monoclonal antibody SWA 11 and fluorescein isothiocyanate-conjugated anti-mouse IgG, as described in "Materials and Methods."

and SWA22 each bound to the CD24 antigen on the surface ofNALM-6 pre-B lymphoblastic leukemia cells. We concludethat the cluster-w4/CD24 antigens expressed on lymphocytesand on SCLC cell lines are serologically identical.

DISCUSSION

We have described the cloning and characterization of acDNA encoding the SCLC cluster-w4 surface glycoprotein, apotential target antigen for immunotherapy of small cell lungcancer. Our results revealed the unexpected finding that theprimary sequence of the cluster-w4 antigen is identical to that ofthe leukocyte CD24 surface antigen, with the exception of asingle amino acid difference that changes a valine residue to analanine residue within the short, highly glycosylated, extracellular domain. This amino acid difference appears to be theresult of a single T-C base polymorphism in the cluster-w4/

5268




Table 1 Immunofluorescence staining of cluster-w4, CD24, and control cluster-1antibodies on SW2 SCLC cells, NALM-6 pre-B lymphoblaslic leukemia cells,

transacted COS-1T cells, and normal COS-1 cells

Reactivity on cell lines

Antibody SW2 NALM-6 COS-IT COS-1

Cluster-w4SWAM+SWA21+SWA22

+CD24BAI

+VIBC5+23D12+SN3+CLB-gran-B-ly+VIB

E3+ML5+OKB-2

+Control

cluster-1SEN6++

+0++0++0+

+0++0-1-+0++0++0++0++0++0000

CD24 gene, since we have found both variants in cDNAs isolated from another SCLC line, DC571 (data not shown). Thusfar we have not detected any serological differences between theSCLC cluster-w4 antigen and leukocyte CD24 arising from thealanine-valine substitution. Indeed, the cluster-w4 antigen expressed on SCLC cell lines was shown to cross-react with a

comprehensive panel of CD24 monoclonal antibodies, including several that are known to bind carbohydrate epitopes. Furthermore, the cluster-w4 antigen on SCLC carries the samecarbohydrate modifications and glycosyl-PI-lipid anchor asthose recently described for the CD24 antigen on K562 cells.

The functional significance of the single-residue differencebetween CD24 and the cluster-w4 antigen is not clear atpresent, but it is tempting to speculate that it may reflect adisease-related mutation in the normal CD24 gene. We arecurrently assessing the frequency of the T-C substitution inCD24/cluster-w4 antigen transcripts among a range of bothnormal and tumor cells, to explore this possibility.

Although the expression of the CD24 antigen on SCLC hasnot been studied extensively, SCLC tumors are known to express several other leukocyte surface antigens including theCD 10 (CALLA) molecule (20), the CDllb (Mac-1) integrin(21), the neural cell adhesion molecule CD56 (4), the CD57(HNK-1) proteoglycan (21), and the recently described ED6/LD6 glycoproteins of human natural killer cells (22). Indeed,such findings have led to the suggestion that SCLC is a tumorof myeloid origin (21). A more likely explanation is that theexpression of lymphoid/myeloid markers (including the CD24/cluster-w4 antigen) by SCLC, a relatively undifferentiated tu

mor, represents a dysfunction in gene expression (23).Northern blot analyses confirmed a high level of CD24/

cluster-w4 antigen expression in all small cell lung carcinomasand in some lung adenocarcinomas, in agreement with our previous findings based upon quantitative antibody binding experiments. The consequences of a high level of expression of theCD24/cluster-w4 antigen in regard to the pathophysiology oflung tumors are not clear. However, the ability of SCLC tumorcells to respond to lymphocyte growth-regulatory signals mightexplain the rapid dissemination within the lymph nodes andbone marrow that is a characteristic of the secondary mÃ©tastases of small cell lung tumors (21).

The natural ligands of the leukocyte CD24 molecule and itsmurine homologue Ml/69-Jlld have not yet been identified;however, lymphocyte CD24 has been shown to interact with a

protein tyrosine kinase, and cross-linking of the CD24 mole

cule on the cell surface can lead to phosphorylation of cellularproteins (24). Furthermore, cross-linking of the CD24 moleculeon tonsil B cells has been shown to stimulate a transient rise inintracellular free calcium (25), one of the earliest signals in Bcell activation. Interestingly the growth of SCLC tumors, butnot adenocarcinomas (which are mostly cluster-w4 negative), isinhibited by protein kinase antagonists (26). This difference inresponsiveness indicates that distinct growth signaling pathways may operate in these two lung tumor systems.

The cluster-w4/CD24 antigen and its murine homologue, theMl/69-Jlld (17) molecule, represent members of a growingfamily of small Pi-linked membrane glycopeptides. Other examples include the human CDw52 (Campath-1) antigen (27)and the murine B7 antigen (28), both of which are differentiallyexpressed during the maturation of monocytes and lymphocytes. It is interesting that both the cluster-w4 antigen on SCLCtumors and the CDw52 molecule on leukocytes are unusuallyeffective targets for complement-mediated lysis (29). Indeed,antibodies to CDw52 are widely used clinically for the removalof T cells from donor bone marrow, to prevent graft-verms-hostdisease. One possible explanation for this complement sensitivity is that the small size of the Pi-linked glycopeptides allows

the complement components to come into close contact withthe lipid bilayer, resulting in efficient lysis of the cells.

The identity of the cluster-w4 antigen with the leukocyteCD24 antigen might have implications for the therapeutic useof antibody SWA 11-toxin conjugates. The fact that the expression of antigen is higher in SCLC cell lines than in hematopoi-etic cells, as assessed by binding assays (6) and by Northern blotanalyses, suggests that antibody conjugates might exert a differential effect on tumor cells and normal tissues. However, theantigen expression on leukocytes is likely to influence the bio-distribution of the antibody in patients. Laboratory and clinicalstudies designed to examine these questions have already beeninitiated. It is interesting to note that an unconjugated amiCD24 antibody has been proven to be safe and effective (30) fortreatment of severe B cell lymphoproliferative syndrome in patients following bone marrow and organ transplantation.

ACKNOWLEDGMENTS

We appreciate the excellent technical assistance of Thomas Schenker.

REFERENCES

1. Boring. C. C, Squires, T. S., and Tong, T. Cancer statistics. CA Cancer J.Clin., 4/.-7-18, 1991.

2. Souhami, R. I .. and Law. K. Longevity in small cell lung cancer. A report tothe Lung Cancer Subcommittee of the United Kingdom Coordinating Committee for Cancer Research. Br. J. Cancer, 61: 584-589, 1990.

3. Souhami, R. L., Beverly, P. C. L., Bobrow, L. G., and Ledermann, J. A.Antigens of lung cancer: results of the Second International Workshop onLung Cancer Antigens. J. Nail. Cancer Inst., S3: 609-612, 1991.

4. Palei. K.. Moore, S. E.. Dickson. G., RÃ¶ssel.R. J., Beverly, P. C. L., Kems-head, J. T.. and Walsh, F. S. Neural cell adhesion molecule (NCAM) is theantigen recognized by monoclonal antibodies of similar specificity in smallcell lung carcinoma and neuroblastoma. Int. J. Cancer, 44: 573-578, 1989.

5. Strnad. J., Hamilton. A. E.. Beavers, L. S., Camboa, G. C.. Apelgren. L. D.,Taber. L. D., Sportsman. J. R., Bumorl, T. F., Sharp, J. D., and Gadski. R.A. Molecular cloning and characterization of a human adenocarcinoma/epithelial cell surface antigen complementary DNA. Cancer Res., 49: 314-317, 1989.

6. Smith, A., Waibel, R., Westera, G., Martin, A., Zimmermann, A. T., andStahel, R. A. Immunolocalization and imaging of small cell cancer xenograftsby the IgG2a monoclonal antibody SWA11. Br. J. Cancer, 59: 174-178,1989.

7. Smith. A.. Waibel, R., and Stahel, R. A. Selective immunotherapy of small

5269




cell lung cancer xenografts using '"I-labelled SWA11 antibody. Br. J. Cancer, 64: 263-266, 1991.

8. Warzynczak, E. J.. Zangemeister-Wittke, U., Waibel, R., Henry, R. V., Par-nell, G. D., Cumber, A. J.. Jones, M.. and Stahel, R. A. Molecular andbiological properties of an abrin A chain immunotoxin designed for therapyof human small cell lung cancer. Br. J. Cancer, in press, 1992.

9. Aruffo, A., and Seed, B. Molecular cloning of a CD28 cDNA by a high-efficiency COS cell expression system. Proc. Nati. Acad. Sci. USA, 84:8573-8577, 1987.

10. Seed, B.. and Aruffo. A. Molecular cloning of the CD2 antigen, the T-cellerythrocyte receptor, by a rapid immunoselection procedure. Proc. Nati.Acad. Sci. USA, 84: 3365-3369, 1987.

11. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation byacid guanidinium thiocyanatc-phenol-chloroform extraction. Anal. Bio-chem., 162: 156-159, 1989.

12. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual, pp. 202-203. Cold Spring Harbor, NY: Cold Spring HarborLaboratory. 1989.

13. Sanger, F., Nicklen, S., and Coulson, A. DNA sequencing with chain-terminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977.

14. Waibel. R., O'Hara, C. J., and Stahel, R. A. Characterization of an epithelial

and a tumor associated lung small cell carcinoma antigen. Cancer Res.. 47:3766-3770. 1987.

15. Edge, A. S. B., Faltynek, C. R.. Hof, L., Reichert, L. E., and Weber. P.Deglycosylation of glycoproteins by trifluoromethanesulfonic acid. Anal.Biochem.. 118: 131-137, 1981.

16. Hakimuddin. T. S.. and Bahl. O. P. Chemical deglycosylation of glycoproteins. Methods Enzymol.. 138: 341-350, 1987.

17. Kay, R., Takei, F., and Humphries, R. K. Expression cloning of a cDNAencoding Ml/69-Jlld heat-stable antigens. J. Immunol., 145: 1952-1959,1990.

18. Kay. R., Rosten, P. M., and Humphries, R. K. CD24, a signal transducermodulating B cell activation responses, is a very short peptidc with a glyco-sylphosphatidylinosito! membrane anchor. J. Immunol., 147: 1412-1416,1991.

19. Larkin, M., Knapp, W., Stoll, M. S., Mehmet. H., and Feitzi, T. Monoclonalantibodies VIB-E3, IBS and HB9 to the leucocyte/epithelial antigen CD24resemble BA-1 in recognizing sialic acid-dependent epitope(s). Evidence that

VIB-E3 recognizes NeuAc2-6GalNac and NeuAc2-6Gal sequences. Clin.Exp. Immunol., 85: 536-541, 1991.

20. Efremidis, A. P., and Bekesi, J. G. Anti-common acute lymphoblastic leukemia antibody (CALLA) (J5) reactivity by small cell lung cancer (SCLC) cells(Letter). Blood, 67: 252-253, 1986.

21. Ruff, M. R.. and Candace, B. P. Small cell carcinoma of the lung: macroph-age-specific antigens suggest hemopoietic stem cell origin. Science (Washington DC). 225: 1034-1036, 1984.

22. Ferrini, S., Cantoni, C., Ciccone, E., Biassoni, R., Prigione, I., Bottino, C.,Venzano, P., and Moretta, L. A novel surface molecule expressed by long-term cultured T and natural killer cells is involved in cell activation. Eur. J.Immunol., 21: 1981-1987, 1991.

23. Gazdar, A. F., Bunn, P. A., and Minna, J. D. Origin of human small cell lungcancer. Science (Washington DC), 229: 679-680, 1985.

24. Stefanova, I., Horejsi, V., Ansotegui, I. J., Knapp, W., and Stockinger, H.GPI-anchored cell-surface molecules complexed to protein tyrosine kinases.Science (Washington DC). 254: 1016-1019, 1991.

25. Fischer. G. F., Majdic. O., Gadd, S.. and Knapp. W. Signal transduction inlymphocytic and myeloid cells via CD24, a new member of phosphoinositol-anchored membrane molecules. J. Immunol., 144: 638-641, 1990.

26. Zhu, H. G., Tayeh. I., Israel, L., and Castagne, M. Different susceptibility oflung cell lines to inhibitors of tumor promotion and inducers of differentiation. J. Biol. Regul. Homeost. Agents, 5: 52-58, 1991.

27. Xia, M-Q., Tone, M., Packman, L., Hale, G., and Waldmann, H. Characterization of the CAMPATH-1 (CDw52) antigen: biochemical analysis andcDNA cloning reveal an unusually small peptide backbone. Eur. J. Immunol..21: 1677-1684, 1991.

28. Kubota, H., Okazaki. H., Onuma, M., Kano, S., Hattori, M., and Minato, N.Identification and gene cloning of a new phosphatidylinositol-linked antigenexpressed on mature lymphocytes. J. Immunol., Â¡45:3924-3931, 1990.

29. Hale, G., Xia, M-Q.. Tighe, H. P., Dyer, M. J. S., and Waldmann, H. TheCAMPATH-I antigen (CDw52). Tissue Antigens, 35: 118-127, 1990.

30. Fischer. A., Blanche, S., Le-Bidois, J., Bordigoni, P.. Gamier, J. L., Niaudet,P., Morinet, F., Le-Deist, F., Fischer, A. M., and Griscelli. C. Anti-B-cellmonoclonal antibodies in the treatment of severe B-cell lymphoproliferativesyndrome following bone marrow and organ transplantation. N. Engl. J.Med.. 324: 1451-1456, 1991.

5270



1992;52:5264-5270. Cancer Res David Jackson, Robert Waibel, Erich Weber, et al. CarcinomasCells, Is a Major Surface Antigen on Small Cell Lung CD24, a Signal-transducing Molecule Expressed on Human B

Updated version

http://cancerres.aacrjournals.org/content/52/19/5264

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/52/19/5264To request permission to re-use all or part of this article, use this link

http://cancerres.aacrjournals.org/content/52/19/5264http://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/52/19/5264http://cancerres.aacrjournals.org/

cd24, a signal-transducing molecule expressed on human b ......reintroduced into fresh cos-1 cells...

Documents