catabolism of serine by pediococcus acidilactici and pediococcus pentosaceus
TRANSCRIPT
![Page 1: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/1.jpg)
1
Catabolism of Serine by Pediococcus 1
acidilactici and Pediococcus pentosaceus 2
Stefan Irmler1, Tharmatha Bavan, Andrea Oberli, Alexandra Roetschi, René 3
Badertscher, Barbara Guggenbühl, Hélène Berthoud 4
5
Agroscope Liebefeld Posieux Research Station ALP, Bern, Switzerland 6
7
8
9
keywords: serine, threonine, serine dehydratase, Pediococcus pentosaceus, 10
Pediococcus acidilactici 11
12
13
Abstract 14
The ability to produce diacetyl from pyruvate and L-serine was studied in various 15
strains of Pediococcus pentosaceus and Pediococcus acidilactici isolated from 16
cheese. After being incubated on both substrates, only P. pentosaceus produced 17
significant amounts of diacetyl. This property correlated with measurable serine 18
dehydratase activity in cell-free extracts. A gene encoding the serine dehydratase 19
(dsdA) was identified in P. pentosaceus, and strains that showed no serine 20
1 Corresponding author: Dr. Stefan Irmler Agroscope Liebefeld-Posieux Research Station ALP Schwarzenburgstrasse 161, CH-3003 Bern, Switzerland Tel.: +41 (31) 323 81 55; Fax: +41 (31) 323 82 27 E-mail address: [email protected]
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.03085-12 AEM Accepts, published online ahead of print on 14 December 2012
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/2.jpg)
2
dehydratase activity carried mutations that rendered the gene product inactive. A 21
functional dsdA was cloned from P. pentosaceus FAM19132 and expressed in 22
Escherichia coli. The purified recombinant enzyme catalyzed the formation of 23
pyruvate from L- and D-serine and was active at low pH and elevated NaCl 24
concentrations, environmental conditions usually present in cheese. Analysis of the 25
amino acid profiles of culture supernatants from dsdA+ and dsdA- strains of P. 26
pentosaceus did not show differences in serine levels. In contrast, P. acidilactici 27
degraded serine. Moreover, this species also catabolized threonine and produced 28
alanine and α-aminobutyrate. 29
1 Introduction 30
Pediococcus pentosaceus and Pediococcus acidilactici are homofermentative Gram-31
positive cocci that produce D- and L-lactate from carbohydrates. These bacteria are 32
found regularly in the non-starter population of raw milk cheeses at the end of the 33
ripening process. Thus, Pediococcus spp. were isolated from Cheddar, ewes’ milk 34
cheeses, Comté, AOC Salers, Puone di Moena, and various raw milk cheeses 35
traditionally produced in Switzerland such as Gruyère, Emmental, Appenzeller, and 36
Tilsit (1-8). 37
Although several reports have indicated that pediococci alone or combined with 38
lactobacilli can accelerate cheese ripening and enhance flavor development, 39
respectively (9-13), knowledge about metabolic activities affecting the maturation of 40
cheese is limited. Studies on physiological and biochemical activities of Pediococcus 41
spp. have mainly focused on carbohydrate metabolism and proteolytic and lipolytic 42
activities (14-16). Researchers have also reported that pediococci racemize L-lactate 43
to D-lactate under anaerobic conditions and that pediococci can oxidize lactate to 44
acetate and carbon dioxide under aerobic conditions (17). However, information on 45
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/3.jpg)
3
the enzymatic degradation of amino acids, important precursors for flavor 46
compounds, is sparse. 47
Diacetyl contributes to desirable flavor in fermented dairy products. A pathway well-48
known for producing diacetyl is through degrading citrate (18). In this pathway, 49
pyruvate is formed as an intermediary compound that is then converted via α-50
acetolactate to diacetyl. Although pediococci do not appear to utilize citrate, diacetyl 51
formed by this species has been reported (19, 20). Pyruvate, which is derived from 52
the metabolism of carbohydrates or amino acids, is likely used for synthesizing 53
diacetyl. 54
In this study, the ability of various strains of P. acidilactici and of P. pentosaceus 55
isolated from cheese to produce diacetyl from pyruvate and serine was analyzed. 56
Furthermore, serine dehydratase activity that releases pyruvate from serine was 57
investigated in detail in these strains. The deamination of serine is of interest since 58
this compound is released by proteolysis during cheese ripening and is a potential 59
precursor for flavor compounds. 60
2 Material and Methods 61
2.1 Bacterial strain, media, and growth conditions 62
The strains used in this study are listed in Table 1. Pediococci which had been 63
identified with 16S rRNA gene sequence analyses were stored at -80 °C in sterile 64
reconstituted skim milk powder (10%, w/v). The bacteria were cultivated at 30 °C in 65
MRS broth (21) or in a basal broth that had been used to study serine metabolism in 66
Lactobacillus plantarum (22). For our study, the basal broth (pH 7.0) was slightly 67
modified and consisted of KH2PO4 9 g L-1, yeast extract 5 g L-1, casein hydrolysate 1 68
g L-1, MgSO4 x 7H2O 0.1 g L-1, MnCl2 x 4H2O 0.1 g L-1, galactose 2 g L-1, and 5 mM 69
L-serine. 70
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/4.jpg)
4
Strains of Escherichia coli were grown at 37 °C in LB broth (23) supplemented with 71
ampicillin (100 µg mL-1), when necessary. 72
2.2 Determination of diacetyl and acetoin formation 73
Pediococci were grown in 50 mL of MRS broth for 16 h at 30 °C. Cells were then 74
sedimented at 3000g for 10 min, washed twice with 50 mM potassium phosphate (pH 75
5.5), and finally suspended in 1 mL of the same buffer. The cell suspension (0.5 mL) 76
was incubated with either 10 mM pyruvate or 10 mM L-serine in 70 mM potassium 77
phosphate (pH 5.5) containing 1X RPMI 1640 Vitamins Solution (Sigma-Aldrich, 78
Switzerland) and 50 µM pyridoxal 5’-phosphate (PLP) at a final volume of 5 mL in 79
sealed tubes at 30 °C for 24 h. 80
Diacetyl and acetoin were determined with gas chromatography with flame ionization 81
detection (GC/FID). Therefore, solid sodium chloride was added until the sample was 82
saturated. After the sample was heated at 95 °C for 45 min, 1 mL of the headspace 83
was injected into the GC. The GC was equipped with a capillary column HP-ULTRA 84
2 cross-linked 5 % phenyl methyl silicone (50 m x 0.32 mm x 0.52 µm). The transfer 85
to the capillary column was performed in split mode (1:8), and helium served as the 86
carrier gas. The temperature program was the following: initial 50 °C (7 min) and then 87
ramp with 40 °C min-1 to 270 °C. Additional operating conditions of the GC were 88
injector temperature of 150 °C and detector temperature of 320 °C. 89
2.3 Preparation of cell-free extract 90
Pediococcus ssp. were grown for 16 h at 30 °C in 50 mL of MRS broth or basal broth. 91
The cells were then harvested by centrifugation (3000g, 10 min, 25 °C), washed 92
twice with 20 mM sodium phosphate (pH 7.4), and finally suspended in 1 mL of the 93
same buffer. After approximately 0.6 g of glass beads (212-300 µm) were added, the 94
cells were disrupted in the Omni Bead Ruptor 24 (Omni International, USA) by 95
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/5.jpg)
5
vigorous shaking (one 45-s mixing sequence at a speed of 6 m s−1). The extract was 96
cleared with centrifugation (17900g, 10 min, 4 °C). 97
2.4 Protein determination 98
The protein content of the extracts was determined with bicinchoninic acid (BCA) 99
using the micro BCA reagent protocol as described by Smith et al. (24). Bovine 100
serum albumin was used to prepare a standard curve. 101
2.5 Enzyme assay 102
Serine dehydratase activity was determined as follows: cell-free extract (50 µL) or 103
recombinant enzyme (0.2 µg) was added to 25 mM sodium phosphate (pH 7.4), 104
50 µM PLP, and various concentrations of L-serine or D-serine, respectively, in a 105
final volume of 200 µL. Cell-free extract was incubated for 30 min and recombinant 106
enzyme for 10 min at 30 °C. The assay was stopped by adding 20 µL of 5 M 107
perchloric acid (Fluka, Switzerland). The solution was centrifuged (17900g, 10 min) 108
and 50 µL of the supernatant was separated by HPLC using an Aminex HPX-87H 109
column (300 x 7.8 mm) and 3.8 mM H2SO4 as the mobile phase. The operating 110
conditions were as follows: column temperature = 65 °C, flow = 0.6 mL min-1, 111
detection at 210 nm. Chromatographic identification of pyruvate was performed by 112
comparing the retention times to those of a pyruvate standard. The amount of 113
pyruvate formed was calculated by referring to a standard curve prepared with 114
various concentrations of sodium pyruvate and normalized for protein content. 115
The Km and vmax values of recombinant enzyme for L-serine and D-serine were 116
determined with variable concentrations of L-serine (0.25 - 10 mM) and D-serine 117
(0.05 - 10 mM), respectively. Km and vmax were calculated from Hanes-Woolf plots 118
(the ratio of the substrate and velocity as a function of the substrate) and represent 119
the mean of triplicates. 120
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/6.jpg)
6
2.6 Isolation of DNA 121
Genomic DNA from Pediococcus ssp. was extracted by robot extraction (BioRobot 122
EZ1, EZ1 DNA Tissue kit; Qiagen, Switzerland) from 1 mL of culture grown overnight 123
at 30 °C. Before being extracted, cells were treated with 0.05 N NaOH for 15 min at 124
room temperature followed by TES buffer (0.1 M Tris-HCl [pH 8.0], 10 mM EDTA, 25 125
% sucrose) supplemented with lysozyme (1 mg mL-1) for 1 h at 37 °C. 126
E. coli plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen) 127
according to the manufacturer’s instructions. 128
2.7 DNA sequencing 129
The amplification products obtained with the primer pair PEPE_1745F/ PEPE_1745R 130
(Talbe 1) from the genomic DNA of P. pentosaceus strains were sequenced using 131
the BigDye Terminator Cycle Sequencing kit and the ABI Prism 310 Genetic 132
Analyser (Applied Biosystems, Switzerland). 133
2.8 Construction of plasmids 134
DsdA was amplified with the primer pair PEPE_1745F/ PEPE_1745R from genomic 135
DNA of P. pentosaceus FAM19132 and P. pentosaceus FAM19080 by PCR. The 136
PCR product was cloned into the pEXP5-CT/TOPO expression vector (Invitrogen, 137
Switzerland) according to the manufacturer's instructions. The cloning was such that 138
the expressed protein had eight extra amino acids including a polyhistidine tag at the 139
C-terminus (KGHHHHH). The plasmids containing dsdA in the proper orientation 140
were confirmed by sequencing and called, depending on the origin of the dsdA gene, 141
pEXP5-CT/dsdA[19132] and pEXP5-CT/dsdA[19080]. Restriction, ligation, and 142
calcium-chloride-mediated transformation of E. coli cells were performed using 143
standard procedures (23). 144
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/7.jpg)
7
2.9 Expression and purification of His-tagged proteins 145
E. coli BL21(DE3) transformed with pEXP5-CT/dsdA[19132] and pEXP5-146
CT/dsdA[19080] was grown in 200 mL LB broth containing ampicillin (100 µg mL-1) at 147
37 °C on a shaker. When the optical density at 600 nm reached 0.5, expression of 148
recombinant dsdA was induced by adding 1 mM isopropyl β-D-1-149
thiogalactopyranoside (final concentration). Expression was performed at 27 °C. After 150
4 h of incubation on a shaker, the bacterial cells were harvested by centrifugation, 151
washed twice with 20 mM sodium phosphate (pH 7.4), and then frozen at -20 °C. 152
Cells were disrupted as described above, and the recombinant proteins were purified 153
with Protino Ni-TED 2000 packed columns (Macherey-Nagel, Switzerland) according 154
to the manufacturer’s instructions. The elution fractions were pooled and immediately 155
applied to PD-10 columns (GE Healthcare, Switzerland) that had been equilibrated 156
with 20 mM sodium phosphate (pH 7.4) to remove imidazole. The eluted protein 157
fraction was concentrated with Ultracel 30K (Millipore, Ireland) and analyzed with 158
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by 159
colloidal Coomassie staining. The concentration of the purified protein was 160
determined as described above. 161
2.10 Size exclusion chromatography 162
To determine the molecular size under non-denaturing conditions, the purified 163
recombinant proteins were analyzed with size exclusion chromatography on a 164
Superdex 200 HR 10/30 column (GE Healthcare) with 25 mM sodium phosphate 165
buffer (pH 7.4) containing 150 mM NaCl at a flow rate of 0.5 mL min-1. The column 166
was calibrated with a mixture of proteins of known molecular weight (Gel Filtration 167
Standard, Bio-Rad, Switzerland). 168
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/8.jpg)
8
2.11 Two-dimensional thin-layer chromatography 169
Pediococcus ssp. pre-cultured in MRS broth were grown in 50 mL of MRS broth or 170
50 mL of a basal broth at 30 °C. To study amino acid metabolism, 1 µL of the culture 171
supernatants was applied spotwise onto HPTLC cellulose plates (Merck, Germany) 172
and separated with two-dimensional thin-layer chromatography (2D-TLC). The plates 173
were developed in the first dimension with n-butanol – acetone – diethylamine - water 174
(10 + 10 + 2 + 5, v/v/v/v) and in the second dimension with 2-propanol – formic acid - 175
water (40 + 2 + 10, v/v/v). To visualize the amino acids, plates were immersed into 176
0.1 % ninhydrin solution (dissolved in acetone) and heated at 110 °C for 5 min. 177
3 Results 178
3.1 Formation of diacetyl and acetoin 179
The formation of diacetyl and acetoin was studied in resting cell suspensions of nine 180
strains of P. pentosaceus and 10 strains of P. acidilactici (Table 1). Therefore, cells 181
were collected 16 h after inoculation, washed and incubated in phosphate buffer 182
containing pyruvate at pH 5.3. After 24 h incubation at 30 °C, all studied strains of P. 183
pentosaceus produced diacetyl and acetoin (Figure 1A). Only very low levels or no 184
formation of these two flavor compounds were detected in the samples containing 185
the strains of P. acidilactici (data not shown). When the Pediococcus ssp. were 186
incubated in phosphate buffer containing L-serine, diacetyl and acetoin were found in 187
the headspace of the strains of P. pentosaceus (Figure 1B). Four strains, namely, P. 188
pentosaceus FAM17622, P. pentosaceus FAM19080, P. pentosaceus FAM19144, 189
and P. pentosaceus FAM20650, did not produce diacetyl or produced only very low 190
levels. No flavor formation from serine was observed with the strains of P. acidilactici 191
(data not shown). 192
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/9.jpg)
9
3.2 Serine dehydratase activity 193
First, serine dehydratase activity was determined in P. pentosaceus FAM19132 194
which produced diacetyl when incubated with serine. Therefore, cell-free extract was 195
prepared from cells that were collected 12, 24, 48, 72 and 96 h after inoculation of 196
MRS broth. The release of pyruvate from serine was only detected in the samples 197
taken at 12 and 24 h. This showed the presence of a serine dehydratase whose 198
activity was apparently down-regulated in resting cells. 199
Then, cell-free extracts of all Pediococcus ssp. which had been grown for 16 h in 200
MRS were incubated with L-serine. All P. pentosaceus strains except P. pentosaceus 201
FAM17622, P. pentosaceus FAM19080, P. pentosaceus FAM19144, and P. 202
pentosaceus FAM20650 exhibited serine dehydratase activity (Fig. 1B). On the 203
contrary, no formation of pyruvate was found in the extracts from the P. acidilactici 204
strains (data not shown). 205
3.3 Sequence analysis of dsdA 206
The genome data of P. pentosaceus ATCC 25745 (acc. no. CP000422) and the 207
entire genome shotgun sequences of P. acidilactici DSM 20284 (acc. no. 208
AEEG01000001-AEEG01000012) were analyzed for the presence of genes 209
encoding a serine dehydratase. Indeed, the gene PEPE_1745 from P. pentosaceus 210
ATCC 25745 encodes a putative D-serine ammonia-lyase. The translated sequence 211
of this gene showed 49 % identity to the well-studied PLP-dependent D-serine 212
dehydratase (DsdA) from E. coli (acc. no. P00926). A homologous gene was not 213
found in P. acidilactici DSM 20284. 214
Based on the nucleotide sequence of PEPE_1745, the primer pair PEPE_1745F/ 215
PEPE_1745R was designed and used to amplify and sequence the gene from all 216
studied strains of P. pentosaceus. Regarding the four P. pentosaceus strains that did 217
not exhibit serine dehydratase activity, a 1-bp deletion and a 19-bp deletion were 218
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/10.jpg)
10
found in P. pentosaceus FAM17622 and P. pentosaceus FAM19144, respectively. 219
Both mutations introduced frameshift mutations (Figure 2). In P. pentosaceus 220
FAM20650, a transition from C to T was detected at position 151 leading to a 221
nonsense mutation. By comparing the sequence obtained from FAM19080 with 222
PEPE_1745, two missense mutations were identified that substituted a threonine 223
residue with an alanine residue at position 67 and a proline residue with a leucine 224
residue at position 278 in the translated sequence. 225
3.4 Purification and properties of DsdA 226
The genes homologous to PEPE_1745 were cloned from FAM19132 and FAM19080 227
in frame with a C-terminal polyhistidine tag and named dsdA[19132] and 228
dsdA[19080], respectively. Both proteins were expressed in soluble form in E. coli 229
BL21(DE3) and purified to apparent homogeneity with one-step nickel-affinity 230
chromatography (Figure 3). Both proteins migrated with 52 kDa in SDS-231
polyacrylamide gels (expected 48.5 kDa). The apparent size determined by size 232
exclusion chromatography under non-denaturing conditions was 120 kDa for each 233
protein (data not shown). 234
The purified recombinant proteins were assayed for serine dehydratase activity. 235
Although no enzyme activity was detected for DsdA[19080], DsdA[19132] clearly 236
exhibited serine dehydratase activity. This protein formed pyruvate from L-serine and 237
D-serine. No formation of a keto acid was detected when L-threonine was used as 238
substrate. The activity of recombinant DsdA[19132] was studied as a function of L-239
serine and D-serine at 30 °C and pH 7.4. The enzyme followed Michaelis-Menten 240
kinetics, and Km = 7.5 ± 0.3 mM (vmax = 880.7 ± 71.3 7 µmol min-1 mg-1) for L-serine 241
and Km = 0.5 ± 0.1 mM (vmax = 71.3 ± 4.7 µmol min-1 mg-1) for D-serine were 242
calculated. 243
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/11.jpg)
11
Sodium phosphate buffer with various pHs and 15 mM L-serine were used to study 244
the pH dependence. DsdA[19132] exhibited optimal activity between pH 6.5 and 7.4 245
and had about 70 % residual activity at pH 5.5. Furthermore, the influence of NaCl (1 246
%, 2 %, and 4 %) was studied. Whereas degradation of L-serine was slightly 247
inhibited by increasing the amounts of NaCl, the degradation of D-serine was 248
enhanced (data not shown). To study thermal stability, the enzyme was incubated for 249
1 h at 43 °C, 48 °C, 57 °C, and 70 °C. The enzyme treated with the three latter 250
temperatures showed strongly decreased serine dehydratase activity (data not 251
shown). 252
3.5 Serine degradation 253
To study the bacterial metabolism of serine, the amino acids of culture supernatants 254
were separated with 2D-TLC after 1-, 2- and 3-days fermentation. The amino acid 255
patterns from P. pentosaceus FAM19132, P. pentosaceus FAM19144, and P. 256
acidilactici FAM18098 were compared. No changes in the amino acid profiles were 257
detected when the strains were grown in MRS broth (data not shown). Significant 258
changes were found between the two strains of P. pentosaceus and P. acidilactici 259
FAM18098 when they were cultured in basal broth. The latter strain completely 260
metabolized serine and threonine, and increased alanine and α-aminobutyrate levels 261
were detected (Figure 4B). In contrast, the serine, threonine, and alanine levels in the 262
culture supernatants of both strains of P. pentosaceus were not different from the 263
basal broth, and formation of α-aminobutyrate was not observed (Figure 4C-D). 264
Moreover, all three pediococci increased the level of ornithine. Further analysis 265
revealed that all studied strains of pediococci produced ornithine, but only the P. 266
acidilactici strains degraded threonine and serine (data not shown). 267
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/12.jpg)
12
4 Discussion 268
Non-starter lactic acid bacteria (NSLAB) constitute a significant part of the microbial 269
ecosystem in cheese and influence its maturation and quality (25). Interest in using 270
NSLAB as adjunct cultures in manufacturing cheese to accelerate and enhance 271
flavor formation and to control the adventitious microbiota is increasing. To select 272
appropriate strains, understanding the metabolic activities of the various species 273
present in the NSLAB flora is crucial. 274
Proteolysis and degradation of amino acids are a major biochemical event during 275
cheese ripening (26). P. acidilactici and P. pentosaceus are often detected in cheese 276
at the end of the ripening process, and their presence suggests a role during cheese 277
ripening. These species have proteolytic activities (14, 27, 28), but to our knowledge, 278
reports on amino acid use are sparse. Amino acid degradation involves 279
decarboxylases, aminotransferases, deaminases, lyases, and dehydratases (29). 280
Most of the studies on amino acid metabolism by NSLAB have focused on 281
transaminases and lyases. The catabolism of serine by dehydratases is of special 282
interest since these enzymes are active in an anaerobic environment and produce 283
pyruvate, which can be converted not only into lactic acid but also into acetic acid, 284
ethanol, diacetyl, and acetaldehyde. These compounds are aroma active and 285
contribute to the typical flavor of a range of fermented products. 286
We had observed that the studied strains of Pediococcus ssp. isolated from cheese 287
did not metabolize citrate (data not shown). Inspired by reports that Pediococcus ssp. 288
produce diacetyl, we first analyzed whether the strains can use pyruvate, an 289
intermediary metabolite in citrate degradation and a precursor of diacetyl formation. 290
Interestingly, all studied P. pentosaceus strains clearly produced diacetyl, a not 291
distinctive property of the P. acidilactici strains. When serine was used as precursor, 292
again various P. pentosaceus strains produced diacetyl, indicating that serine 293
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/13.jpg)
13
dehydratase activity is present that converts serine to pyruvate. In fact, serine 294
dehydratase activity was measured in the cell-free extracts of strains that produced 295
significant amounts of diacetyl from serine. This indicated that this enzyme might be 296
used as a marker for selecting flavor-producing strains. 297
With the advent of next-generation sequencing technologies, more and more 298
genome data on lactic acid bacteria are published. These data can be searched for 299
genes putatively involved in amino acid degradation. In this study, we used the 300
information to search for serine dehydratases present in pediococci and found that 301
PEPE_1745 from P. pentosaceus ATCC 25745 encodes a putative DsdA. 302
Interestingly, by sequencing and aligning the nucleotide sequences of the dsdA gene 303
from the P. pentosaceus strains (see Figure S1 in the supplemental material), 304
mutations that clearly affect the functionality of the enzyme were identified in the 305
strains that did not exhibit serine dehydratase activity. In P. pentosaceus FAM17622, 306
P. pentosaceus FAM19144, and P. pentosaceus FAM20650, mutations lead to 307
truncated, non-functional enzymes. In P. pentosaceus FAM19080, the open reading 308
frame of the gene seems to be complete. However, an alignment of DsdA[19080] 309
with all DsdA sequences from the studied P. pentosaceus strains and DsdA from E. 310
coli showed that at position 67 a threonine residue is substituted with an alanine 311
residue and at position 278 a proline residue is substituted with a leucine residue. 312
The latter amino acid substitution lies next to the so-called tetraglycine loop (residues 313
G279, G281, G282, and G283 in DsdA from E. coli), which is conserved in PLP-314
dependent enzymes and is involved in the binding of PLP (30). Therefore, we think 315
that the binding of PLP is impaired in DsdA from P. pentosaceus FAM19080. This 316
also explains why serine dehydratase activity was not detected in this strain. By 317
cloning dsdA from P. pentosaceus FAM19080 and analyzing its gene product, we 318
confirmed that the enzyme actually is inactive. We suggest that the serine 319
dehydratase activity detectable in P. pentosaceus is provoked by DsdA activity and is 320
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/14.jpg)
14
involved in forming diacetyl from serine (Fig. 5). P. acidilactici and P. pentosaceus 321
are difficult to separate using physiological tests (15); thus, the presence of serine 322
dehydratase activity may be used as a marker for distinguishing both species. 323
To evaluate whether DsdA from P. pentosaceus is active in a cheese environment 324
and plays a role in flavor formation, the recombinant gene product from P. 325
pentosaceus FAM19132 was characterized. The recombinant enzyme used L-serine 326
and D-serine, but showed a higher affinity for D-serine. However, L-serine was 327
decomposed more rapidly than D-serine. L-Threonine was not accepted as 328
substrate. The low pH and elevated salt concentrations present in cheese did not 329
have a major impact on the activity. Interestingly, salt seemed to regulate the rate of 330
dehydratation of L-serine and D-serine. That bacterial D-serine dehydratase uses D- 331
and L-serine has been reported for E. coli, Salmonella typhimurium and Klebsiella 332
pneumonia (31, 32, 33). In contrast to the DsdA from P. pentosaceus, these 333
enzymes showed more activity toward D-serine and eluted as monomers during size 334
exclusion chromatography. Since the recombinant DsdA[19080] and DsdA[19132] 335
eluted with an apparent molecular weight of 120 kDa, we assume that these proteins 336
formed a dimer. The discrepancy between apparent and calculated molecular weight 337
is most likely explained by a non-globular shape of the protein. The same property 338
was observed for DsdA from Klebsiella which showed a molecular weight of 40 and 339
46 kDa in SDS-polyacrylamide gel and size exclusion chromatography, respectively. 340
The comparable elution behavior of both recombinant proteins indicates that the 341
amino acid substitutions in DsdA[19080] did not affect the protein confirmation. 342
Although the biochemical properties of DsdA can be well studied, the physiological 343
role remains to be clarified. The strains of P. pentosaceus with and without serine 344
dehydratase activity grew in MRS broth and the serine dehydratase activity was 345
detectable in the cell-free extracts of growing dsdA+ strains, no significant differences 346
in serine levels were found in the culture supernatants. This observation indicates 347
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/15.jpg)
15
that dsdA is expressed during growth in MRS but is not required for growth. In E. coli 348
dsdA is involved in the detoxification of D-serine, which is toxic to strains of E. coli 349
lacking dsdA. In these strains L-serine and pantothenate synthesis were inhibited by 350
D-serine (34). Moreover, dsdA may also be involved in the generation of energy in P. 351
pentosaceus, since the protein efficiently converted L-serine to pyruvate. Pyruvate is 352
not only a precursor for diacetyl and acetoin but can also be metabolized to acetate 353
by the action of pyruvate oxidase and acetate kinase. The presence of this pathway 354
in pediococci has been reported (35) and a gene encoding a pyruvate oxidase 355
(PEPE_0639) and two genes encoding acetate kinase (PEPE_0336 and 356
PEPE_1822) are present in the genome of P. pentosaceus ATCC 25745. We plan to 357
perform growth studies in chemical defined medium to understand whether D- serine 358
is a growth inhibitor and L-serine can serve as energy source for P. pentosaceus. 359
Since physiological assays with MRS broth do not always reflect the metabolism 360
taking place in a cheese environment, we also analyzed amino acid metabolism in a 361
basal broth previously used for studying serine metabolism of L. plantarum B3089 362
(22). Lactose was replaced by galactose to avoid glucose repression. Amino acid 363
analysis showed that ornithine was formed by P. acidilactici and P. pentosaceus. 364
This is explained by an active arginine deiminase pathway that converts arginine via 365
citrulline to ornithine and is present in both species (15). Regarding the serine and 366
threonine levels, again no differences were observed between the dsdA+ and dsdA- 367
strains of P. pentosaceus. Surprisingly, P. acidilactici FAM18098 degraded serine 368
and threonine and produced significant amounts of alanine and α-aminobutyrate. 369
This metabolism was also observed in all of the other studied P. acidilactici strains 370
(data not shown) indicating that this biochemical activity is generally present in this 371
species. We propose the following pathway: first, serine and threonine are 372
deaminated by a threonine dehydratase to pyruvate and α-ketobutyrate (Fig. 5). That 373
threonine dehydratases catalyze the deamination of both amino acids was shown for 374
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/16.jpg)
16
E. coli (36). Second, pyruvate and α-ketobutyrate are either aminated by the action of 375
an alanine dehydrogenase or transaminated by the action of an aminotransferase. 376
Evidence for the proposed pathway is found in the genome data of P. acidilactici 377
DSM 20284. There, two neighboring genes named HMPREF0623_0054 and 378
HMPREF0623_0055 encode a putative alanine dehydrogenase and threonine 379
dehydratase, respectively. The organization of these genes implies that both genes 380
may form a transcriptional unit and may be involved in the amino acid conversion 381
mentioned above. However, homologous genes (named PEPE_0166 and 382
PEPE_1067) are also present in P. pentosaceus ATCC25745. Gene expression 383
analysis and biochemical characterization of these genes and their gene products 384
are necessary, to understand if these genes are in fact involved in forming alanine 385
and α-aminobutyrate and why this activity is not detected in P. pentosaceus. 386
The use of P. acidilactici and P. pentosaceus as adjunct cultures in cheese making 387
opens up interesting perspectives for controlling cheese quality and flavor formation. 388
On the one hand, these species have proteolytic activity that can accelerate 389
proteolysis and therefore the maturation of cheese (14). On the other hand, 390
investigations of the amino acid metabolism show the presence of the arginine 391
deiminase pathway. This pathway produces gas and ammonia that can affect pH and 392
eye formation in cheese. Furthermore, the presence of an active serine dehydratase 393
can lead to the production of flavor compounds such as diacetyl and acetate, which 394
contribute to the desirable aroma of various dairy products. However, the role of the 395
serine dehydratase from P. pentosaceus during cheese ripening has to be 396
investigated in the cheese matrix. The observation that P. acidilactici produces 397
alanine, a compound known to confer sweetness to dairy products (37), is promising 398
since these species could be used as natural sweeteners of dairy products. In 399
general, the acceleration of ripening by adding pediococci during cheese 400
manufacturing has been already described (10, 12, 13). However, in these reports 401
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/17.jpg)
17
the composition of amino acids and volatiles has not been analyzed in detail. We 402
plan to perform cheese trials with the strains presented in this report to study their 403
influence on amino acid metabolism and flavor formation in cheese. Understanding 404
the metabolic activity of pediococci in more detail is of interest not only for the dairy 405
industry since these species are already used as starter cultures for various types of 406
sausages and are known to produce undesirable flavor compounds during the 407
manufacture of pickles, wine, and beer (38). 408
5 Acknowledgments 409
We thank Monika Haueter for providing technical assistance. 410
6 References 411
1. Bouton Y, Guyot P, Grappin R. 1998. Preliminary characterization of 412
microflora of Comté cheese. J. Appl. Microbiol. 85:123-131. 413
2. Callon C, Millet L, Montel MC. 2004. Diversity of lactic acid bacteria isolated 414
from AOC Salers cheese. J. Dairy Res. 71:231-244. 415
3. Coppola R, Nanni M, Iorizzo M, Sorrentino A, Sorrentino E, Grazia L. 1997. 416
Survey of lactic acid bacteria isolated during the advanced stages of the 417
ripening of Parmigiano Reggiano cheese. J. Dairy Res. 64:305-310. 418
4. Franciosi E, Settanni L, Carlin S, Cavazza A, Poznanski E. 2008. A factory-419
scale application of secondary adjunct cultures selected from lactic acid bacteria 420
during Puzzone di Moena cheese ripening. J. Dairy Sci. 91:2981-2991. 421
5. Fryer TF, Sharpe ME. 1966. Pediococci in Cheddar cheese. J. Dairy Res. 422
33:325-331. 423
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/18.jpg)
18
6. Isolini D, Fröhlich-Wyder MT. 2003. Pediokokken kommen auch in Schweizer 424
Rohmilchkäsesorten vor. Schweizerische Milchzeitung 129:7. 425
7. Nunez M, Medina M, Gaya P. 1989. Ewes' milk cheese: technology, 426
microbiology and chemistry. J. Dairy Res. 56:303-321. 427
8. Tzanetakis N, Litopoulou-Tzanetaki E. 1992. Changes in numbers and kinds 428
of lactic acid bacteria in Feta and Teleme, two Greek cheeses from ewes' milk. 429
J. Dairy Sci. 75:1389-1393. 430
9. Barouei J, Karbassi A, Ghoddusi HB, Mortazavi A, Ramezani R, Moussavi 431
M. 2011. Impact of native Lactobacillus paracasei subsp paracasei and 432
Pediococcus spp. as adjunct cultures on sensory quality of Iranian white brined 433
cheese. Int. J. Dairy Technol. 64:526-535. 434
10. Bhowmik T, Riesterer R, van Boekel MAJS, Marth EH. 1990. Characteristics 435
of low-fat Cheddar cheese made with added Micrococcus or Pediococcus 436
species. Milk Sci. Int. 45:230-235. 437
11. Goodwins, J., Mornet, A., and Manoury, E. November 2008. Aromatization of 438
a milk product using at least one bacteria producing a bacteriocin and belonging 439
to the pediococcus genus. US Patent 2008/0292749 A1. 440
12. Tzanetakis N, Litopouloutzanetaki E, Vafopouloumastrojiannaki A. 1991. 441
Effect of Pediococcus pentosaceus on microbiology and chemistry of Teleme 442
cheese. LWT-Food Sci. Technol. 24:173-176. 443
13. Vafopoulou-Mastrojiannaki A, Litopoulou-Tzanetaki E, Tzanetakis N. 1990. 444
Effect of Pediococcus pentosaceus on ripening changes of Feta cheese. 445
Microbiol. Alim. Nutr. 8:53-62. 446
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/19.jpg)
19
14. Bhowmik T, Marth EH. 1990. Role of Micrococcus and Pediococcus species in 447
cheese ripening: a review. J. Dairy Sci. 73:859-866. 448
15. Holzapfel WH, Franz CMAP, Ludwig W, Back W, Dicks LMT. 2006. The 449
genera Pediococcus and Tetragenococcus. Prokaryotes 4:229-266. 450
16. Tzanetakis N, Litopoulou-Tzanetaki E. 1989. Biochemical activities of 451
Pediococcus pentosaceus isolates of dairy origin. J. Dairy Sci. 72:859-863. 452
17. Thomas TD, McKay LL, Morris HA. 1985. Lactate metabolism by pediococci 453
isolated from cheese. Appl. Environ. Microbiol. 49:908-913. 454
18. McSweeney, P. L. H. and P. F. Fox. 2004. Metabolism of residual lactose and 455
of lactate and citrate, p. 361-372. In P. F. Fox, P. L. H. McSweeney, T. M. 456
Cogan, and T. P. Guinee (eds.), Cheese: Chemistry, Physics and Microbiology. 457
Elsevier, London. 458
19. Litopoulou-Tzanetaki E, Vafopoulou-Mastrojiannaki A, Tzanetakis N. 1989. 459
Biotechnologically important metabolic activities of Pediococcus isolates from 460
milk and cheese. Microbiol. Alim. Nutr. 7:113-122. 461
20. Pasteris SE, Strasser de Saad AM. 2005. Aerobic glycerol catabolism by 462
Pediococcus pentosaceus isolated from wine. Food Microbiol. 22:399-407. 463
21. de Man JC, Rogosa M, Sharpe ME. 1960. A medium for the cultivation of 464
lactobacilli. J. Appl. Bacteriol. 131:82-91. 465
22. Liu SQ, Holland R, McJarrow P, Crow VL. 2003. Serine metabolism in 466
Lactobacillus plantarum. Int. J. Food Microbiol. 89:265-273. 467
23. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a 468
laboratory manual. Cold Spring Harbor Laboratory Press, New York. 469
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/20.jpg)
20
24. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano 470
MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC. 1985. Measurement of 471
protein using bicinchoninic acid. Anal. Biochem. 150:76-85. 472
25. Beresford, T. and A. Williams. 2004. The microbiology of cheese ripening, p. 473
287-317. In P. F. Fox, P. L. H. McSweeney, T. M. Cogan, and T. P. Guinee 474
(eds.), Cheese: Chemistry, Physics & Microbiology, Volume 1. Elsevier 475
Academic Press, London. 476
26. McSweeney PLH. 2004. Biochemistry of cheese ripening. Int. J. Dairy Technol. 477
57:127-144. 478
27. El Soda M, Ezzat N, El Howby T, Zeiday I. 1994. The peptide hydrolase 479
system of pediococci: cell-bound enzymatic activities. Microbiol. Alim. Nutr. 480
12:145-154. 481
28. Vafopoulou-Mastrojiannaki A, Litopoulou-Tzanetaki E, Tzanetakis N. 1994. 482
Proteinase, peptidase and esterase activity of crude cell-free extracts of 483
Pediococcus pentosaceus isolated from cheese. LWT-Food Sci. Technol. 484
27:342-346. 485
29. Ardö Y. 2006. Flavour formation by amino acid catabolism. Biotechnol. Adv. 486
24:238-242. 487
30. Urusova DV, Isupov MN, Antonyuk S, Kachalova GS, Obmolova G, Vagin 488
AA, Lebedev AA, Burenkov GP, Dauter Z, Bartunik HD, Lamzin VS, Melik-489
Adamyan WR, Mueller TD, Schnackerz KD. 2012. Crystal structure of D-490
serine dehydratase from Escherichia coli. Biochim. Biophys. Acta Protein 491
Proteomics 1824:422-432. 492
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/21.jpg)
21
31. Bharath SR, Shveta Bisht S, Savithri HS, and Murthy MRN. 2011. Crystal 493
structures of open and closed forms of D-serine deaminase from Salmonella 494
typhimurium - implications on substrate specificity and catalysis. FEBS J. 278: 495
2879-2891. 496
32. Kikuchi S, Ishimoto M. 1978. A D-serine dehydratase acting also on L-serine 497
from Klebsiella pneumoniae. J. Biochem. 84:1133-1138. 498
33. Labow R, Robinson WG. 1966. Crystalline D-serine dehydrase. J. Biol. Chem. 499
241:1239-1243. 500
34. Cosloy SD and McFall E. 1973. Metabolism of D-serine in Escherichia coli K-501
12: mechanism of growth inhibition. J.Bacteriol. 114:685-694. 502
35. Thomas, T.D., McKay, L.L., and Morris, H.A. 1985. Lactate metabolism by 503
pediococci isolated from cheese. Appl.Environ.Microbiol. 49:908-913. 504
36. Umbarger HE, Brown B. 1957. Threonine deamination in Escherichia coli II. 505
Evidence for two L-threonine deaminases. J. Bacteriol. 73:105-112. 506
37. van der Kaaij, J., Zink, R., and Mollet, B. June 2003. Use of L-alanine as a 507
sweetener. European Patent EP1154698. 508
38. Carr FJ, Chill D, Maida N. 2002. The lactic acid bacteria: A literature survey. 509
Crit. Rev. Microbiol. 28:281-370. 510
511
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/22.jpg)
22
7 Figures 512
Figure 1 Formation of diacetyl and acetoin from pyruvate (A.) and L-serine (B.) by various strains of P. 513
pentosaceus. A plus sign in parentheses in the right-hand diagram illustrates that the cell-free extract 514
of the strain exhibited serine dehydratase activity; the cell-free extracts of strains lacking serine 515
dehydratase activity are shown with a negative sign. 516
517
Figure 2 Schematic illustration of PEPE_1745 showing the mutation sites found in P. pentosaceus 518
FAM17622, P. pentosaceus FAM19144, P. pentosaceus FAM19080, and P. pentosaceus FAM20650 519
that affect function. Additionally, the binding sites of the primers PEPE_1745F and PEPE_1745R used 520
for cloning and sequencing are shown. 521
522
Figure 3 SDS-PAGE analysis of the purification of DsdA[19132] and DsdA[19080] by nickel-affinity 523
chromatography. 1: Cell-free extract of E. coli after expression, 2: unbound proteins, 3: protein fraction 524
obtained after nickel-affinity chromatography, 4: purified protein after removal of imidazole 525
526
Figure 4 Amino acid patterns of basal broth (A.) fermented with P. acidilactici FAM18098 (B.), P. 527
pentosaceus FAM19132 (C.) and P. pentosaceus FAM19144 (D.) for 3 days. The amino acids were 528
separated with 2D-TLC and visualized with ninhydrin. Thr: threonine; Ser: serine; Ala: alanine; Abu: α-529
aminobutyrate; Orn: ornithine 530
531
Figure 5 Proposed pathways for the degradation of serine (and threonine) in P. pentosaceus and P. 532
acidilactici. The synthesis of alanine from pyruvate by P. acidilactici can occur by the action of an 533
alanine dehydrogenase (amination) or an aminotransferase (transamination). dsdA: D-serine 534
dehydratase, als: α-acetolactate synthase, ald: α -acetolactae decarboxylase, bdh: acetoin reductase ( 535
2,3-butanediol dehydrogenase), tdh: threonine dehydratase. 536
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 28: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/28.jpg)
1
Tables 1
Table 1 Strains, plasmids, primers, and peptides used in this study 2
Strain Genotype, relevant properties Source or reference
E. coli
BL21 (DE3) F- ompT hsdSB (rB- mB-) gal dcm (DE3) Invitrogen
P. pentosaceus
FAM13073 Tilsit
FAM17622 dsdA- (deletion at pos. 107) Gruyère
FAM18813 Tête de moine
FAM19080 dsdA- (amino acid substitutions: T67A,
P278L a)
Gruyère
FAM19132 Gruyère
FAM19144 dsdA- (deletion from pos. 90 to 108) Sbrinz
FAM19169 Tilsit
FAM20650 dsdA- (nonsense-mutation at pos.151:
C>T)
Emmental
DSM 20336 type strain German Collection of Microorganisms and
Cell Cultures
P. acidilactici
FAM13473 Emmental
FAM13881 Emmental
FAM17411 Gruyère
FAM17418 Gruyère
FAM17422 Gruyère
FAM18098 Gruyère
FAM18987 Tête de moine
FAM19460 Emmental
FAM20559 Gruyère
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from
![Page 29: Catabolism of Serine by Pediococcus acidilactici and Pediococcus pentosaceus](https://reader031.vdocuments.us/reader031/viewer/2022020705/61fb86372e268c58cd5f313f/html5/thumbnails/29.jpg)
2
DSM 20284 type strain German Collection of Microorganisms and
Cell Cultures
Plasmid
pEXP5-CT/TOPO E. coli cloning vector, ampr Invitrogen
pEXP5-
CT/dsdA[19132]
plasmid expressing dsdA from Fam19132,
ampr
This study
pEXP5-
CT/dsdA[19080]
plasmid expressing dsdA from Fam19080,
ampr
This study
Primer Sequence (5’ to 3’) Used for
PEPE_1745F ATGATTGATGTTGATGCTCTA cloning and sequencing of dsdA
PEPE_1745R TTTAACTTGATGTCCTTCAG cloning and sequencing of dsdA
a compared to PEPE_1745 from P. pentosaceus ATCC 25745 3
on April 9, 2019 by guest
http://aem.asm
.org/D
ownloaded from