cancer research · web view2014/10/11 · 6abramson family cancer research institute, perelman...

SUPPLEMENTARY INFORMATION

Common genetic variants in the NEFL gene influence gene expression and neuroblastoma risk

Mario Capasso1,2*, Sharon Diskin3-5, Flora Cimmino1,2 Giovanni Acierno1,2

Francesca Totaro, Giuseppe Petrosino1, Lucia Pezone2, Maura Diamond3,4, Lee McDaniel6 Hakon Hakonarson5,8,9 Achille Iolascon1,2, Marcella Devoto5,9-11, John M Maris 3-6

1Università degli Studi di Napoli Federico II, Dipartimento di Medicina Molecolare e Biotecnologie Mediche, Naples, Italy.

2CEINGE Biotecnolgie Avanzate, Naples, Italy

3Division of Oncology, Children’s Hospital of Philadelphia, Philadelphia, PA, USA

4Center for Childhood Cancer Research, Children’s Hospital of Philadelphia, Philadelphia, PA, USA

5Department of Pediatrics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA

6Abramson Family Cancer Research Institute, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA, USA

7Genomics and Computational Biology, Biomedical Graduate Studies, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA

8The Center for Applied Genomics, Children’s Hospital of Philadelphia, Philadelphia, PA, USA

9Division of Genetics, The Children’s Hospital of Philadelphia, Philadelphia,PA, USA10University of Rome “La Sapienza”, Department of Molecular Medicine,Rome, Italy11Department of Biostatistics and Epidemiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA

1

SUPPLEMENTARY MATERIALS AND METHODS

Patients and control subjects

European Americans. Case subjects were defined as children with a

diagnosis of neuroblastoma or ganglioneuroblastoma and registered through

the Children’s Oncology Group. The blood samples from the patients with

neuroblastoma were identified through the neuroblastoma bio repository of

the Children’s Oncology Group for specimen collection at the time of

diagnosis. The eligibility criterion for genome-wide genotyping was the

availability of 1.5 μg of DNA of high quality from a tumor-free source such as

peripheral blood or bone marrow mononuclear cells that were uninvolved with

a tumor. Control subjects were recruited from the Philadelphia region through

the Children’s Hospital of Philadelphia Health Care Network, including four

primary care clinics and several group practices and outpatient practices that

included well-child visits. Eligibility criteria for control subjects were European

ancestry as determined by self-report or parental report, availability of 1.5 μg

of high- quality DNA from peripheral-blood mononuclear cells, and no serious

underlying medical disorder, including cancer.

Italians. Case subjects were defined as children with a diagnosis of

neuroblastoma or ganglioneuroblastoma and collected through the Italian

Neuroblastoma Group. The eligibility criterion for genotyping was the

availability of DNA. All control subjects were recruited from Italian blood donor

centers. Eligibility criteria for control subjects were Italian origin, availability of

DNA, no serious underlying medical disorder, including cancer.

2

Main clinical and biological characteristics of the patients, including age, stage

of the disease (INSS), and MYCN amplification status, are shown in the table

below. Samples were assigned into two risk groups (not high-risk and high-

risk) based on the COG risk assignment (1).

Neuroblastoma patient characteristics

ItaliansEuropean Americans

N=459 N=2101Variable Number (%) Number (%)Age>=18m 236 (52) *736 (36)<18m 193 (48) 1324 (64)Unknown 27 41INSS Stage4 180 (40) 875 (44)1,2,3,4s 269 (60) 1110 (56)Unknown 10 116MYCNAmplified 94 (22) 342 (18)Not amplified 327 (78) 1566 (82)Unknown 38 193RiskHigh-risk 196 (43) 853 (44)Not High-risk 263 (57) 1091 (56)Unknown - 157*Divided using as cut off age=1

Genome-wide association study of neuroblastoma samples

Genome-wide SNP genotyping. Genotyping for discovery phase (European

Americans) was performed using the Illumina Infinium II HumanHap550 and

Human Quad610 BeadChips according to methods detailed elsewhere (2-4)

and summarized here. DNA samples were surveyed for quality, both by

optical density spectrophotometry and PicoGreen assay (Invitrogen). A total of

750 ng of DNA isolated from blood was used to genotype each sample

according to the manufacturer’s guidelines. On day 1, genomic DNA was

amplified 1,000–1,500fold. On day 2, amplified DNA was fragmented to ~300–

3

600 bp in size and was precipitated and resuspended. Fragments were then

hybridized to the BeadChip arrays. Singlebase extension (SBE) used a single

probe sequence of approximately 50 bp designed to hybridize immediately

adjacent to the SNP query site. Following targeted hybridization to the array,

locusspecific primers for the arrayed SNP (attached to the beads) were

extended with a single hapten-labeled dideoxynucleotide in the SBE reaction.

The haptens were subsequently detected by a multilayer

immunohistochemical sandwich assay. The Illumina BeadArray Reader

scanned each BeadChip at two wavelengths and created an image file. As

BeadChip images were collected, intensity values were determined for all

instances of each bead type, and data files were created that summarized

intensity values for each bead type. These files consisted of intensity data that

were loaded directly into the Illumina GenomeStudio genotype analysis

software. Once normalization was complete, the clustering algorithm was run

to evaluate cluster positions for each locus and assign individual genotypes.

Only samples yielding a genotype call rate of ≥95% were considered for

inclusion in this study.

Quality control and association testing for the discovery cohort. Overlap

of the HumanHap550 v1, HumanHap550 v3 and Quad610 arrays. The

discovery cohort consisted of individuals genotyped on the HumanHap550 v1,

HumanHap550 v3 and the Human Quad610 arrays. Our analysis only

considered markers shared by all three arrays. The HumanHap550 v1 array

contains 555,175 markers, the HumanHap550 v3 array contains 561,288

markers and the Quad610 array contains 620,901 markers. Overall, 535,752

markers are shared by all three arrays and were analyzed in this study.

4

Low genotype call rate (<95%). Call rate was calculated on the basis of the

number of ‘no call’ genotypes, with default genotyping calling algorithm

implemented in Illumina GenomeStudio software. We did not consider any

sample with a call rate of <95% for inclusion in this study. The call rate per

individual was assessed by PLINK software and was confirmed to exceed

95% for all individuals, with an average genotyping rate of 99.85% across

included individuals.

SNP genotyping in Italian cohort. The SNPs rs196830, rs169061,

rs11994014, rs2979704, rs1059111, rs3761 were genotyped by Assay on

7900HT Real-time PCR system (Applied Biosystems). To monitor quality

control, three DNA samples per genotype were genotyped by Sanger

sequencing (3730 DNA analyzer, Applied Biosystems) and included in each

384-well reaction plate; genotype concordance was 100%. To confirm

genotypes, we sequenced 20 samples chosen randomly from cases and

controls; concordance between genotypes was 100%. Primer sequences are

available upon request.

Genotype Imputation

We performed genome-wide genotype imputation in a discovery set of 2,101 cases

and 4,202 controls of European ancestry. Pre-phasing was performed first using

SHAPEIT (5). Rather than preselecting a reference population, we elected to

follow the approach of Howie et al. (6) and use a multipopulation reference

panel with IMPUTE2 (6). Genotypes for markers located on chromosome 8

were extracted and mapped to the hg19 human reference genome using the

LiftOver tool. Multipopulation haplotype data from the 1000 Genomes Project

5

Phase 1 integrated release were downloaded from the 1000 Genomes Project

website. IMPUTE2 was applied with default parameters and Ne = 20,000.

Following imputation, SNPs with MAF of <1% and/or IMPUTE2– info quality

score of <0.8 were removed. To correctly account for uncertainty in the data

resulting from the imputation process, the remaining SNPs were tested for

association with neuroblastoma using the frequentist association test under

the additive model implemented in SNPTEST (7).

In vitro functional analysis

Construction of luciferase reporter gene plasmids. The 3’-UTR sequence

of NEFL was cloned downstream of the firefly luciferase gene. PCR primers

contained recognition sites for XbaI in the forward and the reverse primer

were designed to amplify 3’UTR from the cDNA of a healthy subject

homozygous for the rs2979704-C and rs1059111-A alleles. After cutting the

fragment with XbaI restriction enzyme (Takara) we cloned it into the pRL-TK

vector (Promega). The resulting plasmid containing the rs2979704-C and

rs1059111-A alleles was site-specifically mutated to T alleles using Site-

Directed Mutagenesis Kit (Stratagene). Before cell transfection, the sequence

of each construct was confirmed by direct sequencing.

Transient transfection and luciferase reporter gene assays. HEK293 cells

were transfected with 1 ug pRL-TK constructs with different 3’UTR NEFL

genotypes using Trasfectin (Biorad). Thirty-two nanograms pGL3 control

plasmid (Promega) was cotransfected as a normalizing control. Forty-eight

hours later luciferase activity of the transfected cells was determined using the

Dual-Luciferase Reporter Assay System (Promega) on a TD20/20

6

Luminometer (Turner Designs). For each plasmid construct, nine independent

transfection experiments were carried out, and each was done in triplicate.

Results are reported as relative luciferase activities, which are obtained by

dividing firefly luciferase activity with Renilla luciferase activity.

Luciferase mRNA stability. To evaluate if mRNA stability is dependent from

3’UTR SNP genotype, we performed quantitative (q)RT-PCR procedure.

HEK293 cells were transfected with pRL-TK-CA or pRL-TK-TT constructs and

were treated with 4µg/µl of actinomycin D to block transcription for 1h, 2h and

3h. Luciferase mRNA was evaluated by qRT-PCR and β-actin gene was used

as a reference molecule (8). For qRT-PCR, mRNA was isolated and reverse

transcribed into high-purity cDNA using μMACS One-step cDNA Kit according

to the manufacturer’s instructions (Miltenyi Biotech). 1/50th of the reactions

were added to appropriate wells of the PCR plates. qRT-PCR was performed

by SYBR Green PCR Master Mix (Applied Biosystems) by using Applied

Biosystems Model 7900HT Sequence Detection System. All PCR reactions

were performed in triplicate and using two different oligonucleotides primers

pair. Luciferase primers sequence are: forward

CTGCCTCCAGCTACCTGTGG, reverse TTCCGATCAGATCAGGGATGA.

Samples were amplified on an Applied Biosystems 7900HT Sequence

Detection System using standard cycling conditions and data collected and

analyzed by 2^-Δct method as described in our previous paper (9). β-actin gene

was used as housekeeping gene.

Characteristics of stable clones and cell culture. Full-length NEFL cDNA

was cloned into the expression vector pcDNA3.1 and transfected in human

neuroblastoma SH-SY5Y, SKNAS and IMR32 cells by electroporation.

7

SHSY5Y and SKNAS stably transfected cells were selected in DMEM

medium supplemented with 500 mg/ml geneticin. As negative control,

SHSY5Y and SKNAS cells were transfected with the empty vector. Surviving,

drug-resistant cells were subcloned to obtain single-cell clonal lines. Cells

were maintained in an atmosphere containing 5% CO2 in DMEM medium

supplemented with 10% fetal bovine serum, antibiotics and geneticin to

maintain selection pressure. The presented experiments have been

performed in three diverse clones for each experimental point and the shown

results are representative of the media among the diverse clones.

Quantification of neurite outgrowth. Neurites were defined as processes

equal to or greater than two times the length of the cell body. Neurites in

single, dispersed cells were measured from the cell body to the furthest tip of

the process using LAS/AF program, microscope Leica DMI 4000B, and the

means and standard deviations of the neurite populations were calculated.

Cell proliferation analysis. Ten thousand cells per well were seeded in 96

multiwell plates. Metabolic activity as a surrogate marker for cell proliferation

of treated samples was assessed at diverse time points using the MTT (3-

(4,5-dimethylthiazol-2-yl), 5-diphenyltetrazolium bromide) assay (Sigma-

Aldrich). Each value represents six replicates, and each experiment was

repeated at least two times.

Soft agar’s assay. Anchorage-independent growth of SHSY5Y and SKNAS

cells was examined in a semisolid agar. This assay was made preparing a

solution of 2% agar (DNA grade), melt in microwave, and 2X DMEM with FBS

10%, 2.0 mM L-glutamine, 100 U/ml pen-strep in equal volume with agar

1.5ml of this solution was added in each well of a tissue culture plate (6

8

multiwell) and stored at 4 C° for 2 hours. A volume of 2 ml of 0.35% agar and

DMEM 2X solution containing 200000 cells, were then layered, in duplicate,

over the bottom agar in each well. The plates were incubated in 5% CO2 at

37°C in the presence of 10% FBS/DMEM 2X for 2 weeks. The colonies were

stained with crystal violet 0.005% and numerated based on different sizes

with the aid of microscope Leica.

Cell invasion assay. Cell invasiveness was determined using Matrigel

invasion chamber inserts (24-well format with 8 mm pores, BD Biosciences).

Eighty thousand cells were seeded onto the upper chamber in DMEM medium

containing 2% fetal calf serum. The medium in the lower chamber contained

10% fetal calf serum in DMEM. Cells migrating to the lower membrane

surface were stained with hematoxylin/eosin after 24 h. Cells were counted in

three representative areas per membrane at 40X magnification using a light

microscope. The experiments were carried out in duplicate.

Gene expression of neuroblastoma Cell Lines. Total RNA was extracted

using Trizol reagent (Invitrogen). Reverse transcription was performed

according to manufactures (High Capaciy cDNA Reverse Trascription Script,

Applied Biosistem). Quantitative SYBER green PCR kits (Qiagen) were used

for quantitative PCR. PCR was carried out with the following 5’-3’primers:

TUJ-1 forward: TATGAGGGAGATCGTGCACATC; reverse:

TGACTTCCCAGAACTTGGCC; MAP-2 forward:

TCTCTTCTTCAGCACGGCG, reverse: GGGTAGTGGGTGTTGAGGTACC;

Nestin forward: CGGCTGCGGGCTACTG reverse:

AGCGATCTGGCTCTGTAGGC; TAU forward:

CTGAGGAACCGGGCTCTGA, reverse: CCTCATCCACTAAGGGTGCTGT;

9

β-actin forward: TTGGCAATGAGCGGTTCC, reverse:

CGGATGTCCACGTCACACTTC, REST forward:

TCATTCAGGTGAGAAGCCATT, reverse GCCCATTGTGAACCTGTCTT;

NEFL forward AAGCATAACCAGTGGCTACTCCCA, reverse

TCCTTGGCAGCTTCTTCCTCTTCA. For all of the SYBER Green PCR, C t

values were normalized to β-actin. All of the real-time quantitative reverse-

transcription PCR results are presented as means ± SDs of two to three

replicate experiments.

Antibodies and reagents. Antihuman NEFL, PCNA and Cyclin D1 polyclonal

antibodies (Santa Cruz Biotechnology) was used for western blotting in a

dilution of 1:200. Mouse monoclonal anti-β-actin and Flag antibodies (1:6000;

Sigma-Aldrich) were used as loading control. All reagents and chemicals were

purchased from Sigma-Aldrich.

Western blotting. Cells were washed in cold phosphate-buffered saline

(PBS) and lysed in radio immunoprecipitation assay buffer, supplemented

with protease inhibitors (Roche, Penzberg, Germany). Cell lysates (20 µg)

were electrophoresed on 11% polyacrylamide gel (Invitrogen) and transferred

onto nitrocellulose membranes (Millipore). After 1 h blocking with 5% dry fat

milk in PBS containing 0.02% Tween-20, the membranes were incubated with

the primary antibody overnight at 4 C° and with the secondary antibody for 1h

at room temperature. The bands were visualized with enhanced

chemiluminescence plus reagent (GE Healthcare). The protein band images

were acquired with GelDoc 2000 system (Bio-Rad) and the densitometry

measurement was performed by Quantity One 4.5 tool (Bio-Rad).

10

Statistical analysis. The significant difference between the different

experiments was assessed by two-sided T- test.

Production of Lentiviral particles and Infection of cell lines. To

knockdown NEFL and REST gene expression, pGIPZ Lentiviral shRNAmir

targeting human NEFL and REST were purchased from Open Biosystems

(Thermo Fisher Scientific, Inc.). We used three different shRNA for each

gene. The shRNA against NEFL are: V2LHS64527, V2LHS327805 and

V2LHS327807. The shRNA against REST are: V2LHS57042, V2LHS57044

and V2LHS384221. A non-silencing pGIPZ Lentiviral shRNAmir was used as

control (RHS4346). HEK293T were transfected by 10µg of shRNA plasmid

DNA and 30µl of Trans-Lentiviral packaging Mix (OpenBiosystem) and 25µl

TrasFectin (Bio-Rad) in 10mm plate. The supernatants (10 ml for points) were

harvested after 24 hours, centrifuged at low speed to remove cell debris and

filtered through a 0.45 μm filter. In vitro transduction and determination of

lentivector Titre were performed as already reported (10). After 48 hours of

incubation, the transduced cells were exanimated microscopically for the

presence of TurboGFP expression (70-90%). To obtain 100% GFP positive

cells we added puromycin in the medium for additional 10 days. The reported

data are representative of the experiments performed and confirmed by using

all lentiviral vectors for each gene.

SNP-gene expression correlation analysis in tumor tissues

11

Data source. We quantified mRNA expression in a highly annotated series of

101 prospectively collected diagnostic neuroblastoma primary tumors and the

expression profiles were determined using Affymetrix U95Av2 arrays (11).

These primary tumor samples were selected from the COG (n = 91

prospectively collected) or Children's Hospital of Philadelphia (n = 10)

neuroblastoma tumor banks. The raw data set as CEL files were available

from the GEO database with accession number GSE3960. A small subset

(n=51) of these tumor samples has paired DNA samples from whole blood

that were used in the genotype-expression association analysis. The

genotype data for the polymorphism rs1059111 were imputed by method

described above using the neuroblastoma GWAS dataset pha002845

(http://www.ncbi.nlm.nih.gov/gap). Five imputed genotypes showed a quality

score <0.80 and were thus excluded.

Genotype-expression association. The expression measures for each

probe set in the Affymetrix array is extracted and normalized using well-

established Robust Multi-array Average (RMA) protocols (12) from raw CEL

files. The latest probe set annotation file from Affymetrix’s website

(http://www.affymetrix.com) was used to assign expression value for each

probe set to the corresponding gene. In the two groups stratified by

rs11994014 and rs1059111 genotypes, we then checked for normal

distribution of gene expression data via boxplot graph (13). Three samples

resulted to be outliers and were thus excluded (see Figure below), one shared

between the two genotype stratified groups. The genotype-expression

association for SNPs was performed using two-sided t-test.

Normality test. Box plots of NEFL gene expression data stratified per genotypes (a) before and (b) after removing the outliers (represented as dots).

12

Gene expression of neuroblastoma Cell Lines. RNA was isolated from

neuroblastoma cell lines using the TRIzol reagent (Invitrogen). Two hundred

ng of total RNA was reverse transcribed into cDNA using iScript cDNA

Synthesis Kit (BIORAD). Quantitative RT-PCR (qRT-PCR) using Power SYBR

Green PCR Master Mix (Life technologies) was performed to evaluate the

gene expression of NEFL. Samples were amplified on an Applied Biosystems

7900HT Sequence Detection System using standard cycling conditions and

data collected and analyzed by 2^-Δct method as described in our previous

paper (9). β-actin gene was used as housekeeping gene. The gene

expression data were normalized by using Log-transformation method.

Analysis of gene expression and SNP array data deposited in Cancer

Cell Line Encyclopedia (CCLE). We analyzed the expression level and SNP

genotypes of NEFL gene on 17 neuroblastoma cell lines. The raw data were

13

downloaded from the Cancer Cell Line Encyclopedia (CCLE) portal

(http://www.broadinstitute.org/ccle) (14). The expression measures for each

probe set in the Affymetrix array is extracted and normalized RMA protocols

(12) from raw CEL files. Data from the SNP array 6.0 were analyzed using

the Genotyping Console version 4.1.4 software (Affymetrix) for quality and

genotyping analysis. Genotyping Console is a stand-alone software to create

genotyping calls for the collection of CEL files using Birdseed V2 algorithm.

To investigate the genotype-expression association, we selected two SNPs

rs12545967 and rs2976427 in complete linkage disequilibrium (r2=1) with

rs11994014 and rs1059111, respectively. The genotype-expression

association for SNPs was performed using two-sided t-test.

Analysis of gene expression data of lymphoblastoid cell lines (LCLs)

deposited in SNPexp portal. The influence of SNPs on gene expression was

evaluated using two web tools, SNPexp v1.2

(http://app3.titan.uio.no/biotools/tool.php?app=snpexp) (15) that calculates

correlation between HapMap genotypes and gene expression levels in LCLs

using linear regression. For this analysis, 198 unrelated HapMap3 subjects

were chosen.

14

http://www.broadinstitute.org/ccle

SUPPLEMENTARY TABLES AND FIGURES

Supplementary Table 1. Functional prioritization of SNPs in linkage disequilibrium (r2=0.6) with significant rs4673067 at SCG2 locus

SNP ID Position Role Allele TFBSSplicing

(site)

Splicing (ESE or

ESS)

Splicing (abolish domain)

miRNA (miRanda)

miRNA (Sanger)

Reg Potential Cons Nearby Gene

rs959100 224162196 INTERGENIC A/G -- -- -- -- -- NA 0.00 KCNE4||SCG2rs34477154 224165052 DOWNSTREAM A/T -- -- -- -- -- -- NA 0.01 KCNE4||SCG2rs11679135 224166115 DOWNSTREAM A/T -- -- -- -- -- -- 0 0.04 KCNE4||SCG2rs3754632 224177624 UPSTREAM G/T Y -- -- -- -- -- 0.06 0.00 SCG2||LOC646696rs4673067 224180496 INTERGENIC A/G -- -- -- -- -- -- 0.02 0.00 SCG2||LOC646696

rs11684817 224180755 INTERGENIC A/G -- -- -- -- -- -- 0.11 0.47 SCG2||LOC646696Y=yes

TFBS: factor transcription binding site

RegPotential: Regulatory potential score (ESPERR Regulatory Potential based on 7 Species) downloaded from UCSC genome bioinformatics web site

Cons: Score of conservation in vertebrate Multiz Alignment (17 Species) downloaded from UCSC genome bioinformatics web site

15

Table Supplementary 2. SNPs in LD (r2>0.60) with the SNP rs118727

SNP ProxyDistance

RSquared

DPrime BP GeneVariant

Gene

rs118727 rs118727 0 1 1

24846486

INTERGENIC N/A

rs118727 rs118726 502 1 1

24846988

INTERGENIC N/A

rs118727 rs196842 633 1 1

24845853

INTERGENIC N/A

rs118727 rs196841 635 1 1

24847121

INTERGENIC N/A

rs118727 rs196843 697 1 1

24845789

INTERGENIC N/A

rs118727 rs196840 817 1 1

24847303

INTERGENIC N/A

rs118727 rs1563577 1309 1 1

24845177

INTERGENIC N/A

rs118727 rs196845 1482 1 1

24845004

INTERGENIC N/A

rs118727 rs2445940 3372 1 1

24843114

INTERGENIC N/A

rs118727 rs196826 3703 1 1

24850189

INTERGENIC N/A

rs118727 rs196823 3981 1 1

24850467

INTERGENIC N/A

rs118727 rs196822 3987 1 1

24850473

INTERGENIC N/A

rs118727 rs196849 4348 1 1

24842138

INTERGENIC N/A

rs118727 rs196850 4468 1 1

24842018

INTERGENIC N/A

rs118727 rs2320701 4614 1 1

24851100

INTERGENIC N/A

rs118727 rs2874327 4632 1 1

24851118

INTERGENIC N/A

rs118727 rs196853 6351 1 1

24840135

INTERGENIC N/A

rs118727 rs196854 6601 1 1

24839885

INTERGENIC N/A

rs118727 rs196858 8842 1 1

24837644

INTERGENIC N/A

rs118727 rs62502620 12121 1 1

24858607 N/A N/A

rs118727 rs62502622 14598 1 1

24861084 N/A N/A

rs118727 rs3761 18647 1 1

24865133

3PRIME_UTR

NEFL

rs118727 rs62503767 24014 1 1

24870500 N/A N/A

rs118727 rs62503769 24546 1 1

24871032 N/A N/A

rs118727 rs62503770 31488 1 1

24877974 N/A N/A

rs118727 rs62503772 37304 1 1

24883790 N/A N/A

rs118727 rs62503773 41313 1 1

24887799 N/A N/A

rs118727 rs62503774 42727 1 1

24889213 N/A N/A

16

rs118727 rs62503775 43404 1 1

24889890 N/A N/A

rs118727 rs62503776 43914 1 1

24890400 N/A N/A

rs118727 rs7000122 45012 1 1

24891498

INTERGENIC N/A

rs118727 rs62503777 45170 1 1

24891656 N/A N/A

rs118727

rs116098898 46872 1 1

24893358 N/A N/A

rs118727 rs62503778 47827 1 1

24894313 N/A N/A

rs118727 rs17052934 49750 1 1

24896236

INTERGENIC N/A

rs118727 rs196839 979 0.901 1

24847465

INTERGENIC N/A

rs118727 rs196844 1097 0.901 1

24845389

INTERGENIC N/A

rs118727 rs196837 1355 0.901 1

24847841

INTERGENIC N/A

rs118727 rs196836 1547 0.901 1

24848033

INTERGENIC N/A

rs118727 rs196835 1696 0.901 1

24848182

INTERGENIC N/A

rs118727 rs196834 1945 0.901 1

24848431

INTERGENIC N/A

rs118727 rs196832 2316 0.901 1

24848802

INTERGENIC N/A

rs118727 rs196831 2966 0.901 1

24849452

INTERGENIC N/A

rs118727 rs196830 3057 0.901 1

24849543

INTERGENIC N/A

rs118727 rs196828 3212 0.901 1

24849698

INTERGENIC N/A

rs118727 rs196825 3722 0.901 1

24850208

INTERGENIC N/A

rs118727 rs196824 3745 0.901 1

24850231

INTERGENIC N/A

rs118727 rs196851 5299 0.892 1

24841187

INTERGENIC N/A

rs118727 rs196829 3090 0.818 1

24849576

INTERGENIC N/A

rs118727 rs447826 2271 0.748 1

24848757

INTERGENIC N/A

rs118727 rs447825 2272 0.748 1

24848758

INTERGENIC N/A

rs118727 rs196827 3469 0.748 1

24849955

INTERGENIC N/A

rs118727 rs2320700 4610 0.748 1

24851096

INTERGENIC N/A

rs118727 rs1457265 6743 0.748 1

24839743

INTERGENIC N/A

rs118727 rs196833 2185 0.688 1

24848671

INTERGENIC N/A

rs118727 rs196855 6722 0.686 0.877

24839764

INTERGENIC N/A

rs118727 rs17830962 57272 0.681 1

24903758

INTERGENIC N/A

rs118727 rs17763685 65935 0.681 1

24912421

INTERGENIC N/A

17

rs118727 rs196819 5392 0.636 1

24851878

INTERGENIC N/A

rs118727 rs2975179 8181 0.636 1

24854667

INTERGENIC N/A

rs118727 rs6557786 9171 0.636 1

24855657

INTERGENIC N/A

rs118727 rs6998940 9429 0.636 1

24855915

INTERGENIC N/A

rs118727 rs17830286 26576 0.636 1

24873062 UPSTREAM N/A

18

Table Supplementary 3. SNPs in LD (r2>0.60) with the SNP rs196830SNP Proxy Distance RSquared DPrime BP GeneVariant Geners196830 rs196830 0 1 1 24849543 INTERGENIC N/Ars196830 rs196831 91 1 1 24849452 INTERGENIC N/Ars196830 rs196828 155 1 1 24849698 INTERGENIC N/Ars196830 rs196825 665 1 1 24850208 INTERGENIC N/Ars196830 rs196824 688 1 1 24850231 INTERGENIC N/Ars196830 rs196832 741 1 1 24848802 INTERGENIC N/Ars196830 rs196834 1112 1 1 24848431 INTERGENIC N/Ars196830 rs196835 1361 1 1 24848182 INTERGENIC N/Ars196830 rs196836 1510 1 1 24848033 INTERGENIC N/Ars196830 rs196837 1702 1 1 24847841 INTERGENIC N/Ars196830 rs196839 2078 1 1 24847465 INTERGENIC N/Ars196830 rs196829 33 0.908 1 24849576 INTERGENIC N/Ars196830 rs196826 646 0.901 1 24850189 INTERGENIC N/Ars196830 rs196823 924 0.901 1 24850467 INTERGENIC N/Ars196830 rs196822 930 0.901 1 24850473 INTERGENIC N/Ars196830 rs2320701 1557 0.901 1 24851100 INTERGENIC N/Ars196830 rs2874327 1575 0.901 1 24851118 INTERGENIC N/Ars196830 rs196840 2240 0.901 1 24847303 INTERGENIC N/Ars196830 rs196841 2422 0.901 1 24847121 INTERGENIC N/Ars196830 rs118726 2555 0.901 1 24846988 INTERGENIC N/Ars196830 rs118727 3057 0.901 1 24846486 INTERGENIC N/Ars196830 rs196842 3690 0.901 1 24845853 INTERGENIC N/Ars196830 rs196843 3754 0.901 1 24845789 INTERGENIC N/Ars196830 rs1563577 4366 0.901 1 24845177 INTERGENIC N/Ars196830 rs196845 4539 0.901 1 24845004 INTERGENIC N/Ars196830 rs2445940 6429 0.901 1 24843114 INTERGENIC N/Ars196830 rs196849 7405 0.901 1 24842138 INTERGENIC N/Ars196830 rs196850 7525 0.901 1 24842018 INTERGENIC N/Ars196830 rs62502620 9064 0.901 1 24858607 N/A N/Ars196830 rs196853 9408 0.901 1 24840135 INTERGENIC N/Ars196830 rs196854 9658 0.901 1 24839885 INTERGENIC N/Ars196830 rs62502622 11541 0.901 1 24861084 N/A N/Ars196830 rs196858 11899 0.901 1 24837644 INTERGENIC N/Ars196830 rs3761 15590 0.901 1 24865133 3PRIME_UTR NEFLrs196830 rs62503767 20957 0.901 1 24870500 N/A N/Ars196830 rs62503769 21489 0.901 1 24871032 N/A N/Ars196830 rs62503770 28431 0.901 1 24877974 N/A N/Ars196830 rs62503772 34247 0.901 1 24883790 N/A N/Ars196830 rs62503773 38256 0.901 1 24887799 N/A N/Ars196830 rs62503774 39670 0.901 1 24889213 N/A N/Ars196830 rs62503775 40347 0.901 1 24889890 N/A N/Ars196830 rs62503776 40857 0.901 1 24890400 N/A N/Ars196830 rs7000122 41955 0.901 1 24891498 INTERGENIC N/Ars196830 rs62503777 42113 0.901 1 24891656 N/A N/Ars196830 rs116098898 43815 0.901 1 24893358 N/A N/Ars196830 rs62503778 44770 0.901 1 24894313 N/A N/Ars196830 rs17052934 46693 0.901 1 24896236 INTERGENIC N/Ars196830 rs196827 412 0.831 1 24849955 INTERGENIC N/Ars196830 rs447825 785 0.831 1 24848758 INTERGENIC N/Ars196830 rs447826 786 0.831 1 24848757 INTERGENIC N/Ars196830 rs2320700 1553 0.831 1 24851096 INTERGENIC N/Ars196830 rs196844 4154 0.808 0.899 24845389 INTERGENIC N/Ars196830 rs196851 8356 0.803 1 24841187 INTERGENIC N/Ars196830 rs1457265 9800 0.666 0.896 24839743 INTERGENIC N/Ars196830 rs196855 9779 0.615 0.875 24839764 INTERGENIC N/Ars196830 rs17830962 54215 0.614 1 24903758 INTERGENIC N/A

19

rs196830 rs17763685 62878 0.614 1 24912421 INTERGENIC N/Ars196830 rs7017329 6317 0.611 1 24855860 INTERGENIC N/Ars196830 rs196833 872 0.61 0.894 24848671 INTERGENIC N/A

20

Table Supplementary 4. SNPs in LD (r2>0.60) with the SNP rs169061SNP Proxy Distance RSquared DPrime BP GeneVariant Geners169061 rs169061 0 1 1 24851764 INTERGENIC N/A

21

Table Supplementary 5. SNPs in LD (r2>0.60) with the SNP rs11994014

SNP ProxyDistance

RSquared

DPrime BP GeneVariant

Gene

rs11994014

rs11994014 0 1 1

24858197 INTERGENIC N/A

rs11994014

rs11994760 45 1 1


rs11994014

rs12545967 19367 1 1


rs11994014 rs2976422 19907 0.789 1


rs11994014 rs196874 47348 0.661 0.933


rs11994014 rs2979681 17884 0.639 1


rs11994014 rs2979704 6787 0.627 1

24864984 3PRIME_UTR

NEFL

rs11994014 rs1059111 7808 0.627 1

24866005 3PRIME_UTR

NEFL

rs11994014 rs2976427 17624 0.627 1


rs11994014 rs2976425 19503 0.627 1


rs11994014 rs2975180 21714 0.614 1

24836483

DOWNSTREAM N/A

22

Table Supplementary 6. SNPs in LD (r2>0.60) with the SNP rs17830286SNP Proxy Distance RSquared DPrime BP GeneVariant Geners17830286 rs17830286 0 1 1 24873062 UPSTREAM N/Ars17830286 rs6998940 17147 1 1 24855915 INTERGENIC N/Ars17830286 rs6557786 17405 1 1 24855657 INTERGENIC N/Ars17830286 rs2975179 18395 1 1 24854667 INTERGENIC N/Ars17830286 rs7017329 17202 0.866 1 24855860 INTERGENIC N/Ars17830286 rs196819 21184 0.852 0.923 24851878 INTERGENIC N/Ars17830286 rs196844 27673 0.706 1 24845389 INTERGENIC N/Ars17830286 rs62503769 2030 0.636 1 24871032 N/A N/Ars17830286 rs62503767 2562 0.636 1 24870500 N/A N/Ars17830286 rs62503770 4912 0.636 1 24877974 N/A N/Ars17830286 rs3761 7929 0.636 1 24865133 3PRIME_UTR NEFLrs17830286 rs62503772 10728 0.636 1 24883790 N/A N/Ars17830286 rs62502622 11978 0.636 1 24861084 N/A N/Ars17830286 rs62502620 14455 0.636 1 24858607 N/A N/Ars17830286 rs62503773 14737 0.636 1 24887799 N/A N/Ars17830286 rs62503774 16151 0.636 1 24889213 N/A N/Ars17830286 rs62503775 16828 0.636 1 24889890 N/A N/Ars17830286 rs62503776 17338 0.636 1 24890400 N/A N/Ars17830286 rs7000122 18436 0.636 1 24891498 INTERGENIC N/Ars17830286 rs62503777 18594 0.636 1 24891656 N/A N/A

rs17830286rs116098898 20296 0.636 1 24893358 N/A N/A

rs17830286 rs62503778 21251 0.636 1 24894313 N/A N/Ars17830286 rs2874327 21944 0.636 1 24851118 INTERGENIC N/Ars17830286 rs2320701 21962 0.636 1 24851100 INTERGENIC N/Ars17830286 rs196822 22589 0.636 1 24850473 INTERGENIC N/Ars17830286 rs196823 22595 0.636 1 24850467 INTERGENIC N/Ars17830286 rs196826 22873 0.636 1 24850189 INTERGENIC N/Ars17830286 rs17052934 23174 0.636 1 24896236 INTERGENIC N/Ars17830286 rs196840 25759 0.636 1 24847303 INTERGENIC N/Ars17830286 rs196841 25941 0.636 1 24847121 INTERGENIC N/Ars17830286 rs118726 26074 0.636 1 24846988 INTERGENIC N/Ars17830286 rs118727 26576 0.636 1 24846486 INTERGENIC N/Ars17830286 rs196842 27209 0.636 1 24845853 INTERGENIC N/Ars17830286 rs196843 27273 0.636 1 24845789 INTERGENIC N/Ars17830286 rs1563577 27885 0.636 1 24845177 INTERGENIC N/Ars17830286 rs196845 28058 0.636 1 24845004 INTERGENIC N/Ars17830286 rs2445940 29948 0.636 1 24843114 INTERGENIC N/Ars17830286 rs196849 30924 0.636 1 24842138 INTERGENIC N/Ars17830286 rs196850 31044 0.636 1 24842018 INTERGENIC N/Ars17830286 rs196853 32927 0.636 1 24840135 INTERGENIC N/Ars17830286 rs196854 33177 0.636 1 24839885 INTERGENIC N/Ars17830286 rs196858 35418 0.636 1 24837644 INTERGENIC N/Ars17830286 rs196829 23486 0.632 0.902 24849576 INTERGENIC N/A

23

Supplementary Table 7. Functional prioritization of SNPs in 3'UTR region of NEFL and in linkage disequilibrium (r2=0.6) with significant typed SNPs rs118727, rs196830, rs17830286, rs11994014.

SNP ID Position Role Allele TFBSSplicing

(site)

Splicing (ESE or

ESS)

Splicing (abolish domain)

miRNA (miRanda)

miRNA (Sanger)

Reg Potential Cons

Nearby Gene

rs1059111 24866005 3'UTR A/T Y -- -- -- Y Y 0.36 1 NEFLrs2979704 24864984 3'UTR C/T Y -- -- -- Y -- 0.07 0.96 NEFL

rs3761 24865133 3'UTR A/G Y -- -- -- Y -- 0.21 0.13 NEFL

Y=yesTFBS: factor transcription binding site

RegPotential: Regulatory potential score (ESPERR Regulatory Potential based on 7 Species) downloaded from UCSC genome bioinformatics web site

Cons: Score of conservation in vertebrate Multiz Alignment (17 Species) downloaded from UCSC genome bioinformatics web site

24

Supplementary Table 8. Prediction of mircoRNAs whose binding is affected by the SNPs rs1059111, rs2979704, rs3761 by mrSNP web tool

SNP microRNA Strand *Binding Energy

Difference A1

^A1 Binding Energy

is Binding 1 Valid A2

°A2 Binding Energy

is Binding 2 valid

§Max MFE for miRNA Cons

rs1059111 hsa-miR-4776-5p + 52.5 a 0 False t -52.5 True -52.5 1.00rs1059111 hsa-miR-591 - 40.3 t -40.3 True a 0 False -40.3 1.00rs1059111 hsa-miR-4800-5p - 47.6 t -47.6 True a 0 False -47.6 1.00rs1059111 hsa-miR-4776-5p - 52.5 t -52.5 True a 0 False -52.5 1.00rs1059111 hsa-miR-3619-3p - 53.7 t -53.7 True a 0 False -53.7 1.00

rs2979704 hsa-miR-3145-3p + 27.7 c -38.4 True t -10.7 False -38.4 0.02rs2979704 hsa-miR-3192 + 28.8 c -50.4 True t -21.6 False -50.4 0.01rs2979704 hsa-miR-4646-5p + 32.1 c -19.7 False t -51.8 True -51.8 0.01rs2979704 hsa-miR-4713-5p - 51.8 g -51.8 True a 0 False -51.8 0.65

rs3761 hsa-miR-4775 + 18.5 a -34.0 True g -15.5 False -34.0 0.12rs3761 hsa-miR-4778-5p + 38.8 a 0 False g -38.8 True -38.8 0.24rs3761 hsa-miR-4652-3p + 45.9 a 0 False g -45.9 True -45.9 0.36

rs3761 hsa-miR-3065-5p - 43.3 t -43.3 True c 0 False -43.3 0.01A1: Allele 1; A2: Allele 2.Cons: score of conservation calculated using placentalMammals set of the phastCons46way*energy difference that occurs because of SNPs^binding energy of the first sequence°binding energy of the second sequence§maximum binding energy that can be obtained for the microRNA. This is obtained by calculating binding energy of miRNA with it is perfect complementWeb tool mrSNP: http://mrsnp.osu.edu/#software

25

http://mrsnp.osu.edu/#software

Supplementary Table 9. Prediction of transcriptional factors whose bindingis affected by the SNPs rs1059111, rs2979704, rs3761 by HaploReg V2l

SNP TF Strand *A1 *A2rs1059111 NRSF + 11.9 12.9

Sin3A + -3.4 8.6

rs2979704 Foxa - 9.1 12

rs3761 BRCA1 - 10.5 10Hoxa3 - 5.9 8.2RFX5 + 11.2 0.2

A1: wild type allele, A2: mutated allele*Position weight matrices (PWM) score.Web tool HaploReg V2: http://www.broadinstitute.org/mammals/haploreg/haploreg.php

26

Supplementary Table 10. List of UTR motifs analyzed for the SNPs rs3761, rs2979704, and rs1059111U0001 HSL3 Histone 3'UTR stem-loop structure (HSL3)U0002 IRE Iron Responsive Element (IRE)U0003 SECIS1 Selenocysteine Insertion Sequence - type 1 (SECIS1)U0004 SECIS2 Selenocysteine Insertion Sequence - type 2 (SECIS2)U0005 APP_SCE Amyloid precursor protein mRNA stability control element (APP_SCE)U0006 CPE Cytoplasmic polyadenylation element (CPE)U0007 TGE TGE translational regulation element (TGE)U0008 NANOS_TCE Nanos translation control element (NANOS_TCE)U0009 15-LOX-DICE 15-Lipoxygenase Differentiation Control Element (15-LOX-DICE)U0010 ARE2 AU-rich class-2 Element (ARE2)U0011 TOP Terminal Oligopyrimidine Tract (TOP)U0012 GLUT1 Glusose transporter type-1 3'UTR cis-acting element (GLUT1)U0013 TNF Tumor necrosis factor alpha 3'UTR cis-acting element (TNF)U0014 VIM3 Vimentin 3'UTR cis-acting element (VIM3)U0015 IRES Internal Ribosome Entry Site (IRES)U0016 SXL_BS SXL binding site

27

U0017 UNR-bs UNR binding siteU0018 RPMS12_TCE Ribosomal S12 mitochondrial protein 5'UTR translation control element (RPMS12_TCE)U0019 BRE Bruno 3'UTR responsive element (BRE)U0020 ADH_DRE Alcohol dehydrogenase 3'UTR downregulation control element (ADH_DRE)U0021 BYDV_TE Barley yellow dwarf virus translation control element (BYDV_TE)U0022 PRONEURAL-BOX Proneural Box (PB)U0023 K-BOX K-Box (KB)U0024 BRD-BOX Brd-Box (Brd)U0025 GY-BOX GY-Box (GY)U0026 AR_CURE Androgen receptor CU-rich element (AR_CURE)U0027 G3A Elastin G3A 3'UTR stability motif (G3A)U0028 INS_SCE Insulin 3'UTR stability element (INS_SCE)U0029 ACTIN_ZIP3 Beta-actin 3'UTR zipcode (ACTIN_ZIP3)U0030 GAP-43 Gap-43 Stabilization Element (GAP-43)U0031 CNDLE CaMKII/Ng dendritic localization element (CNDLE)U0033 uORF Upstream Open Reading Frame (uORF)U0032 AG-CRSD alpha-globin 3'UTR C-rich stability determinant (AG-CRSD)

28

U0034 GAIT Gamma interferon activated inhibitor of translation (GAIT element)U0035 MBE Musashi binding element (MBE)U0036 HLE Drosophila hairy mRNA localization element (HLE)U0037 MBP-A2RE11 Myelin Basic Protein Localization Element (MBP-A2RE11)U0038 Protamine-YRS Protamine P1 3'UTR Y-Box recognition site (Protamine-YRS)U0039 G-CSF_SLDE Granulocyte colony-stimulating factor stem-loop destabilizing element (G-CSF_SLDE)U0040 Ren_SRE Renin stability regulatory element (Ren_SRE)U0041 PTH1 PTH 3'UTR proximal cis-acting instability element (PTH1)U0042 PTH2 PTH 3'UTR distal cis-acting instability element (PTH2)U0043 PAS Polyadenylation Signal (PAS)U0044 PABP_ARS PABP mRNA autoregulatoy repression sequenceU0045 ApoB ApoB 5'UTR cis-acting regulatory elementU0046 TPP_riboswitch Thiamin pyrophosphate riboswitch (TPP_riboswitch)U0049 POLB DNA polymerase beta stem loopII regulatory element (POLB)U0050 CAESAR Cis-Acting Element of Structure-Anchored Repression (CAESAR)U0051 U1A_PIE U1A polyadenylation inhibition element (U1A_PIE)

29

Supplementary Table 11. Imputation results of SNPs at SCG2 and NEFL loci (+/- 1Kb) by using 1000 Genomes data

ID chr PositionA1

A2 Cases_MAF Controls_MAF P OR

SCG2

rs2894511 chr2 224174071 A C 0.0559 0.0493 0.1632 0.8747

rs16864975 chr2 224171408 A G 0.0607 0.0578 0.5866 1.0549

NEFL

rs3761chr8 24809216 A G 0.1401 0.1219 0.0036 1.1698

rs62503767 chr8 24814583 C T 0.1401 0.1220 0.0037 1.1734

rs62503769 chr8 24815115 C G 0.1401 0.1220 0.0037 1.1732

rs1059111chr8 24810088 T A 0.1207 0.1313 0.0876 0.9137

rs2979704chr8 24809067 T C 0.1207 0.1313 0.0877 0.9137

rs7831584 chr8 24812319 C T 0.0792 0.0848 0.2703 0.9275

rs76347846 chr8 24811322 G A 0.0791 0.0848 0.2713 0.9276

rs8077 chr8 24808680 T C 0.0791 0.0848 0.2725 0.9278

rs61458737 chr8 24808414 T G 0.0791 0.0848 0.2726 0.9278

rs4644268 chr8 24809125 G C 0.0791 0.0848 0.2726 0.9278

rs2979701 chr8 24808280 C G 0.2608 0.2532 0.3544 0.9611

rs2979687 chr8 24814403 C T 0.3402 0.3385 0.8405 0.9921

rs2979699 chr8 24807927 A T 0.3643 0.3627 0.8615 0.9932

rs2976440 chr8 24808225 A G 0.3643 0.3627 0.8616 0.9932

rs2979697 chr8 24807520 A G 0.3643 0.3627 0.8619 0.9933

rs2976441 chr8 24807785 A G 0.3643 0.3627 0.8621 0.9933

rs2976439 chr8 24809636 G C 0.3643 0.3628 0.8645 0.9934

rs2979688 chr8 24814205 T G 0.3646 0.3632 0.8832 0.9943

rs2976438 chr8 24814747 T G 0.3647 0.3634 0.8895 0.9946

31

A1: minor allele; A2: major allele; OR: Odds Ratio; In bold the SNPs selected for further validation in Italian cohort. MAF: minor allele frequencies

32

Supplementary Table 12. Association of NEFL SNP genotypes withpathologic characteristics of neuroblastoma in European American cohort

rs1059111 TT TA AA Pallele *Ptrend

Stage 4 680 (78.8%) 171 (19.8%) 12 (1.4%) 0.27 0.27Not Stage 4 832 (76.1%) 250 (22.9%) 11 (1.9%)

MYCN Amp 272 (80.5%) 62 (18.3%) 4 (1.2%) 0.13 0.12MYCN not Amp 1176 (76.3%) 346 (22.5%) 19 (1.2%)

High risk 664 (78.7%) 168 (19.9%) 12 (1.4%) 0.49 0.49Not High risk 823 (76.8%) 237 (22.1%) 11 (1.0%)

Age >= 18 m 847 (79.2%) 212 (19.8%) 10 (0.9%) 0.02 0.02Age < 18 m 720 (74.9%) 228 (23.7%) 13 (1.4%)

rs2979704 TT TC CCStage 4 680 (78.8%) 171 (19.8%) 12 (1.4%) 0.27 0.27Not Stage 4 832 (76.1%) 250 (22.9%) 11 (1.0%)



Age >= 18 m 847 (79.2%) 212 (19.8%) 10 (0.9%) 0.02 0.02Age < 18 m 720 (74.9%) 228 (23.7%) 13 (1.4%)

rs11994014 GG GA AAStage 4 572 (65.4%) 278 (45.3%) 25 (3.4%) 0.16 0.14Not Stage 4 684 (61.6%) 396 (35.7%) 30 (2.7%)



Age >= 18 m 718 (66.3%) 336 (31.0%) 29 (2.7%)0.005 0.003

Age < 18 m 582 (59.6%) 366 (37.5%) 29 (3.0%)*P-value obtained by Armitage's trend test

33

Supplementary Table 13. Association of NEFL SNP genotypes withpathologic characteristics of neuroblastoma in Italian cohortrs1059111 TT TA AA Pallele *Ptrend

Stage 4 127 (74.7%) 40 (23.5%) 3 (1.8%) 0.69 0.68Not Stage 4 180 (72.6%) 64 (25.8%) 4 (1.6%)



Age >= 18 m 145 (71.4%) 53 (26.1%) 5 (2.5%) 0.27 0.26Age < 18 m 164 (75.2%) 52 (23.9%) 2 (0.9%)

rs2979704 TT TC CCStage 4 114 (71.7%) 39 (24.5) 6 (3.8%) 0.31 0.33Not Stage 4 181 (76.1%) 50 (21.0%) 7 (2.9%)



Age >= 18 m 136 (71.6%) 44 (23.2%) 10 (5.3%) 0.07 0.09Age < 18 m 161 (76.7%) 46 (21.9%) 3 (1.4%)

rs11994014 GG GA AAStage 4 79 (51.3%) 59 (38.3%) 16 (10.4%) 0.05 0.05Not Stage 4 127 (58.5%) 80 (36.9%) 10 (4.6%)

MYCN Amp 38 (49.4%) 30 (39.0) 9 (11.7%) 0.09 0.09MYCN not Amp 156 (57.1%) 101 (37.0%) 16 (5.9%)


Age >= 18 m 96 (53.0%) 68 (37.6%) 17 (9.4%) 0.15 0.15Age < 18 m 111 (57.5%) 73 (37.8%) 9 (4.7%)*P-value obtained by Armitage's trend test

34

Supplementary Figure 1. Linkage disequilibrium (LD) plot of NEFL gene (chr8: positions 24,845,004 to 24,887,674) by Haploview 4.2 for HapMap CEU subjects.

35

Supplementary Figure 2. REST gene silencing in neuroblastoma cells. The efficiency of gene silencing mediated by lentiviral delivery of hairpin RNA directed against REST (shREST) in SH-SY5Y and SK-N-BE2c cell lines was assessed by western blotting (a-b). The bar graphs show integral optical density (OD) value for each band, normalized respect to β-Actin expression. The results are shown as mean of three experiments and are represented as fold respect to shCTR cells which are infected by lentivirus-mediated delivery of non-silencing hairpin RNA. Induction of NEFL and REST gene expression levels after REST silencing in SH-SY5Y (c) and SK-N-BE2c (d). *P<0.05

36

Supplementary Figure 3. (a) Association between NEFL SNP genotype and gene expression in 16 neuroblastoma cell lines. The gene expression measure of the NB1 cell line was excluded from this analysis as affected the normal distribution of data (data not shown). The analysis was performed using the SNPs rs12545967 and rs2976427 in complete linkage disequilibrium (r2=1) with rs11994014 and rs1059111, respectively. Conventionally, we report the allele code of rs11994014 and rs1059111 in the plot. (b) Association between NEFL SNP genotype and gene expression in 198 LCLs. The analysis for rs1059111 (missing in the dataset) was performed using the SNP rs2979704 in complete linkage disequilibrium (r2=1).

37

Supplementary Figure 4. NEFL gene silencing in neuroblastoma cells with rs1059111 TA genotype. Evaluation of cell growth (a) and invasion (b) after NEFL silencing in SH-SY5Y and SK-N-BE2c cell lines. The efficiency of gene silencing mediated by lentiviral delivery of hairpin RNA directed against NEFL (shNEFL) in SH-SY5Y and SK-N-BE2c cell lines was assessed by western blotting (c). The bar graphs show integral optical density (OD) value for each band, normalized respect to β-Actin expression. The same results were observed for mRNA measurements (data not shown). The results are shown as mean of three experiments and are represented as fold respect to shCTR cells which are infected by lentivirus-mediated delivery of non-silencing hairpin RNA. *P<0.05

38

Supplementary Figure 5. Association between NEFL SNP genotype and neuronal marker genes in neuroblastoma cell lines. Eight cell lines (IMR-32, SK-N-DZ, SK-N-AS, KP-N-SI9s with rs1059111 TT genotype and SIMA, SK-N-BE(2), SH-SY5Y, SK-N-FI with rs1059111 TA protective genotype) with the extremes of NEFL mRNA expression were selected based on the analysis shows in the Supplementary Figure 2a. The analysis was performed using the SNPs rs2976427 in complete linkage disequilibrium (r2=1) with and rs1059111. Conventionally, we report the allele code of rs1059111 in the plot.

39

References1. Breslow N, McCann B. Statistical estimation of prognosis for children with neuroblastoma. Cancer Res. 1971;31:2098-103.2. Capasso M, Devoto M, Hou C, Asgharzadeh S, Glessner JT, Attiyeh EF, et al. Common variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat Genet. 2009;41:718-23.3. Gunderson KL, Steemers FJ, Lee G, Mendoza LG, Chee MS. A genome-wide scalable SNP genotyping assay using microarray technology. Nat Genet. 2005;37:549-54.4. Steemers FJ, Chang W, Lee G, Barker DL, Shen R, Gunderson KL. Whole-genome genotyping with the single-base extension assay. Nat Methods. 2006;3:31-3.5. Delaneau O, Zagury JF, Marchini J. Improved whole-chromosome phasing for disease and population genetic studies. Nat Methods. 2013;10:5-6.6. Howie BN, Donnelly P, Marchini J. A flexible and accurate genotype imputation method for the next generation of genome-wide association studies. PLoS Genet. 2009;5:e1000529.7. Marchini J, Howie B, Myers S, McVean G, Donnelly P. A new multipoint method for genome-wide association studies by imputation of genotypes. Nat Genet. 2007;39:906-13.8. Leclerc GJ, Leclerc GM, Barredo JC. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines. Cancer Cell Int. 2002;2:1.9. Capasso M, Avvisati RA, Piscopo C, Laforgia N, Raimondi F, de Angelis F, et al. Cytokine gene polymorphisms in Italian preterm infants: association between interleukin-10 -1082 G/A polymorphism and respiratory distress syndrome. Pediatr Res. 2007;61:313-7.10. Zhang B, Metharom P, Jullie H, Ellem KA, Cleghorn G, West MJ, et al. The significance of controlled conditions in lentiviral vector titration and in the use of multiplicity of infection (MOI) for predicting gene transfer events. Genet Vaccines Ther. 2004;2:6.11. Wang Q, Diskin S, Rappaport E, Attiyeh E, Mosse Y, Shue D, et al. Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number. Cancer Res. 2006;66:6050-62.12. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003;4:249-64.13. Tukey JW. Exploratory data analysis. Reading, Mass.: Addison-Wesley Pub. Co.; 1977.14. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S, et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature. 2012;483:603-7.15. Holm K, Melum E, Franke A, Karlsen TH. SNPexp - A web tool for calculating and visualizing correlation between HapMap genotypes and gene expression levels. BMC Bioinformatics. 2010;11:600.

40

cancer research · web view2014/10/11 · 6abramson family cancer research institute, perelman...

Documents