cancer genes and genomics - molecular cancer researchras and c-myc expression and the transformation...

Cancer Genes and Genomics

Role of Ribosomal Protein RPS2 in Controlling let-7a Expressionin Human Prostate Cancer

Min Wang, Youji Hu, Michael D. Amatangelo, and Mark E. Stearns

AbstractWe discovered that an inverse relationship exists in the expression of ras/c-myc and ribosomal protein RPS2

with pre-let-7a-1/let-7a/let-7f miRNA and prostate tumor cell malignancy. Nonmalignant IBC-10a cellsexpressed low levels of ras/RPS2 and elevated pre-let-7a-1/let-7a/let-7f miRNA, whereas the reverse occurredin malignant PCa-20a and PC-3ML cells. Stable transfection of IBC-10a cells with pBABE.ras and pBABE.RPS2induced ras, c-myc, and RPS2 expression, whereas the levels of let-7a/let-7f miRNA dropped to near zero.Conversely, in pBABE.pre-let-7a-1 transfected PCa-20a and PC-3ML clones, let-7a/let-7f increased whereas ras,RPS2, and c-myc dropped greater than 5-fold. Electrophoretic mobility shift assays, antibody "supershift" assaysand immunoprecipitation assays revealed that RPS2 specifically binds pre-let-7a-1 to block RNA processing.Immunoflourescent studies and Northern blots confirmed that RPS2 complexes with pre-let-7a-1 (i.e., inepisomal structures) to block processing to let-7a/let-7f, indicating RPS2 may prevent let-7a miRNA expression toindirectly promote oncogene expression. Functional studies further showed that the colony-forming ability (CFA)and invasive activities of IBC-10a cells were significantly enhanced in pBABE-ras.IBC-10a and pBABE-RPS2-IBC-10a clones. Conversely, with the "knockdown" of ras and RPS2 in malignant PC-3ML cells (i.e., in pLKO.TRC.shRNA.ras.PC3-ML, pLKO.TRC.shRNA.RPS2.PC-3ML transfected cells), there was both a loss of thesefunctions and a loss of tumorigenesis in SCID mice. Likewise, with the overexpression of let-7a/let-7f in pBABE.pre-let-7a-1.PC-3ML clones (and PCa-20a clones), CFAs, invasive activities in vitro, and tumorigenesis in vivowere significantly reduced. These results show for the first time that RPS2 blocks pre-let-7a-1 processing to enableras and c-myc expression and the transformation of primary tumor cells. Mol Cancer Res; 9(1); 36–50. �2011AACR.

Introduction

Mechanisms controlling the progression of early-stagecancers to a highly malignant and invasive phenotype arepoorly understood. A growing body of evidence has docu-mented dysregulation of miRNA expression in cancer,suggesting miRNAs may play a key role in tumor progres-sion (1). One intriguing possibility is that miRNAs play akey role in controlling oncogene expression, but work inthis arena has been sporadic and mechanisms controllinggene expression have not been explored. The most well-studied miRNAs are those of the let-7 family, which possesspotent tumor suppressor (2–5) and antigrowth activity in a

variety of models (2–5). Sampson et al. (2) have shown thatpre-let-7a-1 and let-7a inhibit Myc translation in a c-myc–transfected rat fibroblast line. Likewise, Lieberman andcolleagues (3) found that let-7a blocks ras translation inbreast cancer cells to reduce the extent of tumor growth inmice. Johnson and colleagues (4) also observed that let-7downregulated ras and that let-7 was poorly expressed inlung cancer tissue compared with normal adjacent tissue in21 lung cancer patients they examined. Although there is aclear inverse relationship between the level of let-7 expres-sion and cancer, little is understood as to exactly how let-7,or other microRNA, expression is regulated during tumorprogression.In attempts to understand how let-7 expression might be

regulated, studies of embryonic stem cells and cancer cellshave shown that LIN28 binds to the stem-loop region of let-7a precursors and inhibits pre-let-7a-1 RNA processing (5,6). The implication is that specific proteins/factors mightcontrol miRNA expression to enable oncogene-dependentcell transformation.Recently, we have found that RPS2, a 32-kDa riboso-

mal protein, is overexpressed in prostate cancer and thatRPS2 promotes malignancy of human prostate PC-3MLcells in SCID mouse tumor modeling studies (7, 8). More

Authors' Affiliation: Department of Pathology, Drexel University Collegeof Medicine, Philadelphia, Pennsylvania

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author: Mark E. Stearns, Department of Pathology,Drexel University College of Medicine, MS 435, 15th & Vine Streets,Philadelphia, PA 19102. Phone: 215-762-1597; Fax: 1-215-843-6471.E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-10-0158

�2010 American Association for Cancer Research.

MolecularCancer

Research

Mol Cancer Res; 9(1) January 201136

RETRACTED Marc

h 20,

2012

Research. on August 29, 2021. © 2011 American Association for Cancermcr.aacrjournals.org Downloaded from

Published OnlineFirst December 8, 2010; DOI: 10.1158/1541-7786.MCR-10-0158





http://mcr.aacrjournals.org/



important, gel shift assays showed that RPS2 binds the"break-point-cluster" sequence "GTAGGTAC" associatedwith heavy- and light-chain IgG recombination with highspecificity (7, 8). Blast analysis of the Sanger miRNAdatabase further revealed that a potential binding site forRPS2 (i.e., UAGGGUCAC) was expressed in the loopdomain of pre-let-7a-1 RNA and let-7a miRNA. We,therefore, postulate that one important extraribosomalfunction of RPS2 might be to block processing of pre-let-7a-1 RNA and thereby promote oncogene expressionand malignancy.It is noteworthy that a number of ribosomal proteins have

been identified that are overexpressed in cancer that seem tohave extraribosomal functions in promoting tumorigenesis.For example, several reports have shown that RPS3a andL19 possess oncogenic activities (9). The overexpression ofRPS2 has been reported in human squamous cell carci-noma, breast tumor samples (10), and prostate cancer (7).RPS2 is also overexpressed in cells transformed by ras, SV-40, polyoma virus, Rous sarcoma virus, Abelson murineleukemia virus, and chemical carcinogen (11–13). Likewise,L37RP/p40, RPP-1, RPS3a, and RPS2 are upregulated inthe cells and tumors expressing the tumor suppressor genep53 (14). The L37RP/p40 protein has been identified as aprecursor of the 67-kDa laminin receptor whose enhancedexpression is associated with tumor invasion and metastaticpotential (15, 16). Thus, one possibility is that the ability ofRPS2, L37RP/p40, or RPS3a expression to induce trans-formation may require the cooperative effect of additionaloncogene signals.The focus of this article has been to examine whether

RPS2 blocks processing of pre-let-7a-1 to enable upregula-tion of ras expression and the transformation of primaryprostate cell lines to a malignant phenotype. In addition, wehave examined whether let-7a mediated downregulation ofras (and indirectly RPS2) can inhibit the malignant phe-notype of primary prostate cells and PC-3ML cells in SCIDmouse tumor modeling studies.

Materials and Methods

Cell culturesHuman prostate PC-3ML clones were isolated from PC-

3 cells by our laboratory (17). PC-3ML cells were grown inDMEM plus 10% FBS. Cells were used at �80% con-fluence for experimental assays. IBC-10a and PCa-20a cellswere primary intermediate basal cell lines derived fromhuman prostate cancer by our laboratory (18). The IBC-10a cells were immortalized by transfections with LXSN-hTERT retroviral vector (courtesy of Johng Rhim, Centerfor Prostate Disease Research, USUHS, Bethesda, MD),using methods previously described (19). IBC-10a andPCa-20a cells were found to be CK5 and CK18 positiveand are classified as intermediate basal cells (18). Theprimary cell lines were all grown in serum-free completekeratinocyte media (SF-KM; BD Biosciences) according toestablished protocols in our laboratory (18).

Colony-forming assaysIn brief, cells were seeded in soft agar in 60-mm dishes at

1 � 105 cells/well in 12-well tissue culture dishes (FisherScientific) according to published methods of our laboratory(18). We measured the CFA in the presence of completemedia plus 10% FBS. The numbers of colonies formed(>100 mm diameter) were counted after 20 days.

Invasion assaysMatrigel-coated Transwell Chambers (BD Biosciences)

were used for invasion assays. Cells were plated in the topchamber and the chemoattractant was added to the bottomcompartment. The percent invasion was measured by usingtrypsin-EDTA to collect the cells from the bottom com-partment for propidium iodide labeling and counting in aGuava Flow Cytometer (Millipore).

Tumor xenografts in CB17-SCID miceSingle-cell suspensions of PCa-20a and PC-3ML cells or

the transfected variants (1 � 106 cells) were injectedintraperitoneally in 5- to 6-week-old CB17-SCID mice(Taconic Labs). Each group had 5 mice, and tumor volumeswere determined according to the formula (L � l2)/2 bymeasurement of tumor length (L) and width (l) with acaliper. All experiments were carried out with IACUCprotocol approval. The mice were injected with tumor cellsand sacrificed at the animal care facility in accordance withour institution's policy.

miRNA extractionTotal RNA was purified using the mirVana PARIS Kit-

Amnion Isolation Kit purchased from Ambion (AppliedBiosystems) according to the manufacturer's instructions.RNA concentration was measured using the Quant-iTRiboGreen RNA Assay Kit from Molecular Probes. Thepurity of the RNA was analyzed using 1 mL of total RNA ona nanoRNA LabChip by using the Agilent 2100 bioanalyzerfrom Agilent Research Labs.

Blast analysisBlasts of the Sanger miRNA database revealed that the 9-

base RPS2 binding sequence (UAGGGUCAC) was presentin hairpin loop sequence of pre-let-7a-1, but not in pre-let-7g, or mature let-7a and let-7f miRNA.

Northern blottingApproximately 20 mg per lane was used for Northern

blotting as described previously (20). Antisense, 32P-ATPend-labeled DNA oligonucleotides [20 nucleotides (nt);Dupont Nucleotides, Inc.], which recognize pre-let-7a-1,let-7a, let-7f, let-7g miRNA, and 5S RNA, were used forNorthern blots according tomethods of Sambrook et al. (21).

PCRPrimers for PCR amplification were purchased from

Promega Inc. and included the following: pre-let-7a-1,50-TTTCTATCAGACCGCCTGGATGCAGACTTT-30(reverse) and 5’-GATTCCTTTTCACCATTCACCCTG-

Role of Ribosomal Protein RPS2

www.aacrjournals.org Mol Cancer Res; 9(1) January 2011 37

RETRACTED Marc

h 20,

2012




GATGTT-30 (forward); pre-let-7g, 50-GGATCCCCT-GTCTCAAGTGCATCCTG -30 (forward) and 50-CTCG-AGCAGAGATGAGCAGGGTGACG -30 (reverse). PCRproducts containing the genomic sequences of pre-miRNAswere cloned into pGEM-T easy (IDT Inc.) and verified withsequencing by the Molecular Sequencing Lab (University ofPennsylvania, Philadelphia, PA). The pre-miRNAs were alsosubcloned into pBABE. vector (Promega Inc.), using eitherEcoRI (pre-let-7a-1) restriction site digests.

Quantitative PCR and mutagenesisThe pcDNA3-pre-Let-7 RNA plasmid was courtesy of

Dr. J. Lieberman (Harvard University, Boston, MA; ref. 3).Levels of pre-let-7a-1, pre-let-7g, and mature let-7a to let-7imiRNA were measured by quantitative PCR using com-mercially available TaqMan probes (Applied BiosystemsInc.) per the manufacturer's instructions with U6 RNAused as internal standards for normalization. Site-directedmutagenesis was used to generate mutant pre-let-7asequences according to published methods (21). LIN-28and RPS2 were amplified using the following primers: LIN-28 :59- tacgaattcACCATGGACTACAAAGACGATGAC-GACAAGGGCTCGGTGTCCAACCA-39. RPS2: 50-ATGGCGGATGACGCCGGTGCAGCGGGG-30. Thesequences were verified by sequencing (Molecular Sequen-cing Lab, Univ. Penn).

pLKO-TRC-shRNA-puromycin constructsThe pLKO-TRC-shRNA-puromycin vector was pur-

chased from Addgene. The rRPS2 and ras sequences(�30 nt) were identified by Blast analysis and cloned inthe pLKO-TRC-shRNA-puro vector according to standardmethods of Sambrook et al. (21). Bacterial clones expressingthe vectors were selected with amphicilin. Cells were trans-fected with the different constructs and stable clones wereselected in the presence of 2 mg/mL of puromycin for20 days according to Sambrook et al. (21). Transfectedclones were maintained in 0.2 mg/mL of puromycin. ThepBABE vector was purchased from Addgene (22). Ampho-teric packaging cells, Phoenix A, were stably transfectedwith pBABE-RPS2 or pBABE-ras vectors with Polybrene(10 mg/mL) and clones were selected with puromycin (2 mg/mL). Cells were transfected with the pBABE-RPS2 orpBABE-ras or pBABE.empty vector and stable clones wereselected in the presence of 2 mg/mL of puromycin accordingto Sambrook et al. (21). Transfected clones were maintainedin 0.2 mg/mL of puromycin. Site-directed mutagenesis (21)was utilized to produce DRPS2-nterminal, and DRPS2.leucine zipper constructs, which were cloned in pBABEvectors for transfection studies.

Cloning of pBABE constructsThe Pre-let-7a-1 oligonucleotide was obtained from

Promega and Age1/EcoR1 sites were inserted by PCR.The pre-let-7a-1 oligonucleotide was cloned in thepBABE vector according to Sambrook et al. (21). Theclones were normally evaluated within �5 to 50 days oftransfection. Lentiviruses were generated by cotransfecting

293T cells with 10 mg of encoding plasmid and 5 mg eachof gag/pol (pLP1), rev (pLP2), and VSV-G env (pLP/VSV-G) plasmids by using Lipofectamine 2000 (Invitro-gen Corp.). Growth media was exchanged the followingday and lentivirus-containing supernatant was harvested48 hours later.

Recombinant RPS2A pGEXR-GST:rRPS2 fusion protein was cloned in

BL21 (DES) pLysS E. coli. Recombinant rRPS2 proteinwas isolated from supernatants of E. coli transfected accord-ing to published methods (8). In brief, the MagneGSTProtein Purification System (V8603; Promega) was used forpartial purification of rRPS2 from E. coli extracts pretreatedwith 100 nmol/L DNase I for 1 hour. rRPS2 was isolatedutilizing a glutathione-Sepharose 4B column and elution ofthe protein with thrombin protease (0.2 units) according toPromega Inc. A highly purified rRPS2 fraction was preparedby subsequently eluting the partially purified rRPS2 proteinon a Sepharose 4B column in the presence of thrombinprotease (0.2 units) with increased concentrations of NaCl.SDS-PAGE and Western blotting verified that the rRPS2was 99% pure.

Western blotting and immunolabelingWestern blots were according to methods published by

our laboratory (8, 18). In brief, cells were harvested byscraping into ice-cold PBS and lysed using RIPA buffer (150mmol/L sodium chloride, 1% Triton X-100, 1% sodiumdeoxycholate, 0.1% SDS, 50 mmol/L Tris-HCl, pH 7.5,and 2 mmol/L EDTA) supplemented with Protease Inhi-bitor Cocktail kit (#78410; Thermo) and phosphatase(#78420) inhibitor cocktails (Pierce). Unless stated other-wise, lanes were loaded with 10 mg of protein. Antibodystaining was carried out with a chemiluminescence detec-tion system (SuperSignal West Pico, #34080; Thermo).Following separation by denaturing gel electrophoresis,proteins were transferred to Immobilon transfer membranes(IPVH09120; Millipore), which were probed using primaryantibodies and anti-b-actin as a control (Sigma-AldrichChemical Co.), followed by incubation with horseradishperoxidase (HRP)–labeled 2o antibodies to detect immunecomplexes. Each antibody was characterized by Westernblotting of crude extracts from HEK 293 cells to verify thatit recognizes the correct antigen as described previously(23). Membranes were stripped at room temperature for 20minutes with Restore Western Blot Stripping Buffer(#21059; Thermo) and reblotted with new antibodies.Immunolabeling was according to standard methods utiliz-ing cold methanol–acetone to fix the cells and primaryRPS2 monoclonal antibodies plus Alexaflour 488-nm FITCIgG secondary antibodies (Promega Inc.; ref. 18).

Electrophoresis mobility shift assaysElectrophoresis mobility shift assays (EMSA) were con-

ducted using �1 � 105 dpm of 32P-ATP–labeled oligo-nucleotide (i.e., 31 nt), pre-let-7a-1 RNA and the maturelet-7a-1 miRNA probe, together with the indicated

Wang et al.

Mol Cancer Res; 9(1) January 2011 Molecular Cancer Research38

RETRACTED Marc

h 20,

2012




amounts of competitor RNA and recombinant RPS2 thatwas prepared as described previously (8). Binding reactionswere conducted in 20 ml of total volume with 30 mg of yeasttRNA. Binding buffer contained 100 mmol/L NaCl,50 mmol/L Tris (pH 7.6), 5% glycerol, 20 units ofRnaseOUT, and 10 mmol/L b-mercaptoethanol. Boundcomplexes were resolved on native 5% polyacrylamide gels.Band intensities of scanned gels were quantified usingAdobe PhotoShop software. The data were fitted to ahyperbolic function of the nonlinear curve fitting methodof GraphPad Prism. The total amount of probe in eachbinding reaction was normalized against the unbound probe[in the absence of recombinant RPS2 protein (rRPS2)] andused to calculate the fraction bound by rRPS2. Dissociationconstants of pre-let-7a-1 and the mature let-7a terminalloop were derived from a fit to the equation: Fraction bound¼ bmax[rRPS2]/(Kd þ [rRPS2]), where bmax represents theobserved maximum fraction of probe bound, [rRPS2]represents protein concentration, and Kd is the dissociationconstant.

Immunoprecipitation assaysImmunoprecipitation assays (IP) were according to meth-

ods modified by our laboratory (8) from Sambrook et al.(21). In brief, Protein A-Sepharose beads were washed 3times in "Hi DTT" immunoprecipitation (IP) buffer(20 mmol/L HEPES, pH 7.6, 2 mmol/L MgCl2, 150mmol/L NaCl, 10 mmol/L DTT, 1 mmol/L phenylmethyl-sulfonylfluoride (PMSF), 0.5% NP-40), followed by 5washes in IP buffer (20 mmol/L HEPES, pH 7.6, 2mmol/L MgCl2, 150 mmol/L NaCl, 1 mmol/L DTT,1 mmol/L PMSF, 0.5% NP-40). For IP, 15 mL of anti-RPS2 or anti-LIN28B antibody (Abgent) was prebound to30 mL of Protein A-Sepharose beads (Sigma-Aldrich) for1 hour at 25�C in IP buffer, followed by extensive washingwith buffer Dþ 0.5%NP-40. 100 mL of P19 nuclear lysate(5mg/mL) was diluted 2-fold in buffer Dþ 2mL of RNasinand rotated overnight at 4�Cwith either the antibody–beadsmixture or beads alone as a MOCK. Protein-bound beadswere washed extensively with cold TNN buffer; proteinswere eluted by boiling SDS protein loading buffer and wereseparated on a 12%SDS-PAGE gel, which was subsequentlyfixed and dried down for SDS-PAGE.Quantitative RT-PCR(qRT-PCR) was carried out on the antibody–bead mixtures.

Statistical analysisThe results are presented as means � SD. Significant

changes were assessed by Student's t test. A value of P < 0.05was accepted as the level of significance.

Source of reagentsMonoclonal antibodies were raised against human RPS2

peptides (20 amino acids) from the N-terminal and C-terminal domains (Strategic Diagnostics Inc.) by our labora-tory (8). Mouse anti-human ras (RM3371; ECM Bios-ciences). Goat anti-mouse IgG (H þ L)-HRP (#31430;Thermo) and mouse anti-human b-actin antibodies(Sigma-Aldrich). Polyclonal RPS6 (ab12864; AbCam)

and polyclonal LIN28B (Abgent) antibodies were charac-terized by Western blotting with crude extracts fromHEK293 cells.

Results

Evidence that RPS2 binds to the stem-loop region ofpre-Let-7a-1 RNAWe have previously shown that the 32-kDa RPS2

(termed PCADM-1) was overexpressed in prostate cancercell lines and tumors (7), suggesting it might play a role intumor progression. We further discovered that rRPS2specifically binds the break-point-cluster region sequence(i.e., GTAGGTAC; ref. 8), which is important for heavy-light chain IgG recombination (24). In addition, Blastsearches of miRNA data banks revealed that the loopdomain of pre-let-7a-1 RNA consisted of a sequence(i.e., UAGGGUCAC) that could potentially bind RPS2.We, therefore, hypothesized that RPS2 might function toblock pre-let-7a-1 processing in malignant tumor cells.To test this possibility, we have utilized EMSAs to

determine whether purified recombinant rRPS2 specificallybinds the UAGGGUCAC domain in RNA oligonucleo-tides and pre-let-7a-1. Figure 1A shows that a band shift wasobserved with increased amounts of rRPS2 (i.e., 1–4 mg ofrRPS2) incubated in the presence of a constant amount of a32P-ATP RNA consisting of the let-7a miRNA coupledwith the UAGGGUCAC sequence (i.e., 31 nt; see legend,Fig. 1E). Cold competition assays with increased amountsof the unlabeled RNA oligonucleotide (i.e., 3–12 nmol/L)blocked rRPS2 binding to the 32P-ATP–labeled 31-nt RNAprobe (Fig. 1B). rRPS2 was also found to bind pre-let-7a-1RNA (Fig. 1C), and cold competition assays with increasedamounts of unlabeled oligonucleotide (31 nt) blockedrRPS2 binding of pre-let-7a-1 RNA (Fig. 1D). In addition,EMSAs with 3 different pre-let-7a-1 RNA sequences con-taining base substitutions in the UAGGGUCAC domainshowed that the mutant miRNA sequences failed to bindrRPS2 (Fig. 1E, see sequence in Figure legend). Likewise,preincubation of rRPS2 with oligonucleotides containingthe mutant miRNA sequences failed to block rRPS2 bind-ing to radiolabeled pre-let-7a-1 RNA (Fig. 1F), indicatingthat rRPS2 specifically binds the UAGGGUCAC domainlocated in the stem-loop region of pre-let-7a-1 RNA.From the binding assays in Figure 1C, we determinedthe Kd of rRPS2 binding to pre-let-7a-1 to be�2.45 mmol/L (Fig. 1G). EMSAs further showed thatradiolabeled pre-let-7g RNA, or mature let-7a, let-7b,let-7d, let-7f, and let-7g miRNAs (i.e., 21 nt), which didnot contain a UAGGGUCAC domain, failed to bindrRPS2 under similar conditions in which 32PvATP miRNA(100,000 dpm) was incubated with increased amounts ofrRPS2 (1–5 mg; data not shown).To validate further whether native RPS2 specifically

binds pre-let-7a-1, we carried out antibody supershift assayswith monoclonal RPS2 antibodies. SDS-PAGE (Supple-mentary Fig. S1A, lanes 2–5) and Western blots of thecolumn fractions eluted with NaCl confirmed that rRPS2



RETRACTED Marc

h 20,

2012




protein purified from bacteriophage supernatants was spe-cifically recognized by monoclonal RPS2 antibodies (Sup-plementary Fig. S1B, lanes 2–5). EMSAs subsequentlyshowed that native RPS2 isolated in crude nuclear proteinextracts from malignant PC-3ML cells can bind the 32P-ATP–radiolabeled pre-let-7a-1 RNA and the amount ofbinding increased with the amount of crude protein extractfrom PC-3ML cells (Supplementary Fig. S2A). Antibodysupershift assays further showed that RPS2 antibodiesbound the radiolabeled RPS2-pre-let-7a-1 RNA complexand caused a band shift to the top of the gel (SupplementaryFig. S2B, lanes 1–3). Likewise, antibody supershifts showedthat native RPS2 binds the 31-nt sequence containing theUAGGGUCAC domain to induce a band shift (arrow) ongels (Supplementary Fig. S2C, lanes 1–3). Note, rRPS2 andnative RPS2 did not bind let-7a miRNA (21 nt; data notshown). Controls with secondary IgG antibodies failed toinduce a band shift (Supplementary Fig. S2B and C, lane 4).Taken together, the data indicate that rRPS2 and nativeRPS2 specifically bind pre-let-7a-1 RNA.

Does RPS2 block processing of pre-let-7a-1 to maturelet-7a/let-7f?We postulated that RPS2 might block pre-let-7a-1 pro-

cessing to mature let-7a and let-7f and thereby prevent let-7a inhibition of ras and c-myc expression in tumor cells. Totest this possibility, we have utilized 3 different epithelial celllines including primary human prostate IBC-10a and PCa-20a cells derived from Gleason score 6 and 7 tumors, as wellas malignant PC-3ML cells derived from a bone metastases(8). We have utilized these 3 cell lines for 2 reasons. First,Western blots showed that IBC-10a cells expressed littleRPS2, c-myc, and ras (Fig. 2A, lanes 1–2) whereas PC-3MLand PCa-20a cells (Fig. 2A, lanes 3–4) both expressedelevated levels of these genes (Fig. 2A). Densitometric scansconfirmed that the ratio of RPS2, ras, and c-myc to actinwas: 1, 1, and 0.8, respectively, in PC-3ML cells; 1, 1, and0.7, respectively, in PCa-20a cells; and 0.4, 0.2, and 0.2,respectively, in IBC-10a cells.Second, qRT-PCR showed that IBC-10a cells expressed

elevated let-7a and let-7f miRNAs whereas both of these

F E D C B A

1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 5 6

0

0.2

0.4

0.6

0.8

1

20151050

Kd = 2.45 µmol/L

R2 = 0.975

rRPS2 (µmol/L)

Fra

ctio

n bo

und

G

Figure 1. EMSAs. A, recombinant RPS2 selectively binds a 31-nt RNA sequence containing the UAGGGUCAC domain (E). EMSAs conducted with 1nmol/L 32P-ATP–labeled RNA (�100,000 dpm) and increased amounts of purified rRPS2 at (lanes 1–4) 1, 2, 3, and 4 mg of rRPS2, respectively. B, coldcompetition assays with increased amounts of the unlabeled RNA at (lanes 1–4) 3, 6, 9, and 12 nmol/L, respectively. EMSAs conducted with 1 nmol/L32P-ATP–labeled RNA (�100,000 dpm) and 4 mg of purified rRPS2. All incubations and cold competition assays were carried out for 10 minutes at 37�Cimmediately prior to electrophoresis of samples. Arrow, band shift. C, EMSAs conducted with 1 nmol/L-32P-ATP–labeled pre-let-7a-1 RNA (�100,000 dpm)and (lanes 1–4) 1, 2, 3, and 4 mg of rRPS2, respectively. D, cold competition assay with 1 nmol/L 32P-ATP–labeled pre-let-7a-1 RNA (�100,000 dpm) and 4 mgof rRPS2 in the presence of increased amounts of unlabeled 31-nt RNA containing the UAGGGUCACdomain at (lanes 1–4) 3, 6, 9, and 12 nmol/L, respectively.E, EMSAs with (lane 1) pre-let-7a-1 RNA (lanes 2–4) pre-let-7a-1 RNA with mutations at M1, M2, and M3, respectively. EMSAs were with 1 nmol/L 32P-ATP–labeled pre-let-7a-1 and rRPS2 (4 mg). The sequence with M1, M2, andM3 base substitution mutation sites in pre-let-7a-1 is shown below along with the 31-ntsequence consisting of the 21-nt mature let-7a-1 miRNA (underlined) linked with the UAGGGUCAC domain. c a c pre-let-7a-1:UGAGGUAGUAGGUUGUAUAGUUU—UAGGGU—CACACCCACCA–CUGGGAGAUAACUAUACACAAUCU M1 M2 M3 31 nt RNA: UGAGGUAGUAGGUUGUAUAGUUUAGGUCACG F, cold competition assays with 1 nmol/L 32P-ATP–labeled let-7a-1 miRNA (�100,000 dpm) and 4 mg of rRPS2 incubated in the presence of 3different unlabeled mutant let-7a-1 miRNAs, including: (lanes 1–2) M1, (lanes 3–4) M2, and (lanes 5–6) M3, respectively. Unlabeled mutant let-7a-1 miRNAswere used at (lanes 1, 3, and 5) 10 nmol/L and (lanes 2, 4, and 6) 20 nmol/L, respectively. E, specific base substitutions of M1, M2, and M3. G, quantitation ofbinding. Band intensities were quantified from 3 independent experiments by densitometric scans to generate the rRPS2 binding data represented as thefraction of bound pre-let-7a-1 RNA. Kd ¼ 2.45 � 0.23 mmol/L.

Wang et al.


RETRACTED Marc

h 20,

2012




miRNAs were barely expressed in PCa-20a and PC-3MLcells (Fig. 2B). Also note that IBC-10a cells expressedmature let-7b/7c/7d/7e/7g/7h/7i miRNAs at levels�2-foldhigher than PCa-20a or PC-3ML cells (Fig. 2B). Finally, all3 cell lines expressed equivalent levels of pre-let-7a-1andpre-let-7g, indicating that the levels of pre-let-7 RNA maynot account for differences in the levels of mature let-7recorded among the 3 cell lines.To test whether the overexpression of RPS2 blocked

processing of pre-let-7a-1 and the production of let-7a/let-7f miRNA, we stably transfected IBC-10a cells withpBABE.RPS2 (and selected the stable clones in puromycinfor 10 day). Western blots showed that RPS2, ras, and c-myc were overexpressed in pBABE.RPS2 transfected IBC-10a variants compared with the parent cells and pBABE.empty clones (compare Fig. 2A, lanes 1–2, and Fig. 2C, lane2). That is, densitometric scans showed that the ratio of ras,RPS2, and c-myc to actin was normally 0.1, 0.2, and 0.2,respectively, in IBC-10a parent cells, but the ratiosincreased to 4.3, 3.8, and 1.4, respectively, in pBABE.

RPS2 variants. qRT-PCR analysis showed that let-7a/let-7fmiRNA levels were reduced to near zero in the pBABE.RPS2.IBC-10a variants compared with the parent cells orpBABE.empty clones (Fig. 2D). There was little change inthe expression of other let-7 miRNAs, however (cf. Fig. 2Dwith Fig. 2B). Also, the levels of pre-let-7a and pre-let-7gRNA were equivalent among the parent, pBABE.empty,and pBABE.RPS2 variants (Fig. 2D), suggesting that thisdid not account for the differences in mature let-7a/let-7fexpression. We, therefore, postulated that RPS2 may func-tion to block pre-let-7a-1 processing.

Evidence that RPS2 complexes with pre-let-7a inepisome-like structuresWe utilized immunolabeling to determine whether RPS2

might complex with pre-let-7a to form episomal-like struc-tures in the nuclear compartment. Figure 3A shows thatRPS2 is normally localized in the cytoplasm and to a lesserextent in nuclear compartments of pBABE.empty PCa-20acells, although it is detectable in the nuclear compartments

Figure 2. Western blot and qRT-PCR analysis of gene expressionprofiles in prostate cell lines. A,Western blots of crude cellextracts from (lanes 1–2)IBC-10a cells at 50% and 85%confluence, respectively (lane 3),PC-3ML and (lane 4) PCa-20acells. Blots were with RPS2, ras, c-myc, and b-actin antibodies. Datarepresentative of 4 experiments.B, qRT-PCR measurements ofpre-let-7a-1, pre-let-7g, andmature let-7a to let-7i miRNAs inIBC-10a at 50% and 80%confluence, PCa-20a, and PC-3ML cells. Values normalized toU6 RNA. Data represent the mean� 1 SD from 3 separate assays. C,Western blots of (lane 1) pBABE.empty and (lane 2) pBABE.RPS2-transfected IBC-10a cells (day 10).Blots were with ras, RPS2, RPS6,c-myc, and b-actin antibodies.Data representative of 3experiments. D, qRT-PCRmeasurements of pre-let-7a-1,pre-let-7g, and let-7a to let-7ilevels in IBC-10a parent, pBABE.empty, and pBABE.RPS2-transfected IBC-10a cells. Valuesnormalized to U6 RNA. Datarepresent the mean � 1 SD from 3experiments.

A

B

0

0.5

1

1.5

2

2.5

3

pre-let-7a

pre-let-7g

let-7blet-7a let-7dlet-7c let--7e let-7glet-7f let-7h let-7i

Fol

d e

xpre

ssio

n

IBC-10a IBC-10aPCa-20a PC-3ML

D

C

1 2

Ras

RPS2

RPS6

c-myc

Actin 1 2 3 4

Ras

RPS2

c-myc

Actin

0

0.5

1

1.5

2

2.5

3

pre-let-7a

pre-let-7g

let-7blet-7a let-7dlet-7c let-7e let-7glet-7f let-7h let-7i

Fol

d e

xpre

ssio

n

IBC-10a pBABE.empty pBABE.RPS2



RETRACTED Marc

h 20,

2012




(Fig. 3A). In comparison, we found that prominent epi-some-like particles were evident in PCa-20a cells transfectedwith either pBABE.RPS2 or pBABE.pre-let-7a vectors(Fig. 3B and C). We have observed similar episomal-likeparticles in pBABE.RPS2-transfected IBC-10a cells as well(data not shown). In comparison, episome-like structureswere not evident in cells transfected with pBABE.pre-let-7g(Fig. 3D), although under these conditions, the nuclearcompartment was faintly labeled with RPS2 antibody(Fig. 3D). In other studies in which PCa-20a cells weretransfected with pLKO.TRC.shRNA.pre-let-7a to knock-down pre-let-7a expression, immunolabeling with RPS2revealed that the nuclear labeling was largely lost whereasthe cyoplasmic compartment was intensely labeled withRPS2 antibodies (cf. Fig. 3E and F). Controls showed thatin pLKO.TRC.empty variants, nuclear and cytoplasmiccompartments were labeled with RPS2 antibodies(Fig. 3E). In other studies, we examined whether LIN28might associate with episomal particles. Attempts to labelcells with LIN28B antibodies produced a faint dispersedlabeling of the nuclear and cytoplasmic compartments, butepisome-like structures were not detected (data not shown).

Northern blots showing RPS2 blocks pre-let-7aprocessingNorthern blots with a 32P-ATP-let-7a miRNA oligonu-

cleotide (21 nt) showed that in pBABE.RPS2.IBC-10avariants, mature let-7a was not expressed, although therewas an abundance of pre-let-7a expressed by the variants(Fig. 3G, lanes 2 and 4). However, mature let-7a miRNAwas expressed in parent IBC-10a, pBABE.empty and IBC-

10a cells transfected with pBABE.DRPS2-nterminal, andpBABE.DRPS2.leucine zipper domain deletions (i.e., 60–140 b; Fig. 3G, lanes 1, 3, 5, and 6, respectively). The dataindicate that the intact RPS2 protein blocked processing ofpre-let-7a to mature let-7a.

Potential role of LIN28B in targeting pre-let-7aprocessingLIN28 has been reported to bind pre-let-7g (and mature

let7g) to target it for degradation, and thereby reduce,mature let-7g expression in tumor cells (6). We examinedwhether LIN28 might also modulate expression of pre-let-7a in human prostate cells. Following IP of LIN28B frompBABE.empty and pBABE RPS2.PCa-20a cells, qRT-PCRrevealed that IPs consisted of pre-let-7g and little or no pre-let-7a (Supplementary Fig. S3). Conversely, IPs with RPS2antibodies contained pre-let-7a and no detectable pre-let-7g(Supplementary Fig. S3). In addition, we found that theamounts of pre-let-7a associated with RPS2 increased in IPsfrom crude extracts of pBABE.RPS2.PCa-20a variants (day10) compared with pBABE.empty variants (SupplementaryFig. S3). Conversely, in pLKO.TRC.shRNA.RPS2.PCa-20a cells, little RPS2 or pre-let-7a was precipitated withRPS2 antibodies (Supplementary Fig. S3). Similar IP stu-dies with LIN28B antibodies showed that the knockdownof RPS2 did not reduce LIN28B binding of pre-let-7g(Supplementary Fig. S3). Finally, in pBABE.pre.let-7a.PCa-20a variants that overexpressed pre-let-7a, the IPs withLIN28B and RPS2 consisted solely of pre-let-7g and pre-let-7a, respectively (Supplementary Fig. S3). Sequencing ofthe PCR products validated that RPS2 specifically binds

U6 snRNA

M 1 2 3 4 5 6

A B C D E F

857064

21

Pre-let-7a

Let-7a miRNA

G

Figure 3. A–F, immunolabeling of episomes. Immunoflourescent studies of RPS2 expression in transfected PCa-20a cells. PCa-20a cells were stablytransfected with (A) pBABE.empty, (B) pBABE.RPS2, (C), pBABE.pre-let-7a, and (D) pBABE.pre-let-7g for 5 day. E, pLKO.TRC.emptyF, pLKO.TRC.shRNA.pre-let-7a–transfected PCa-20a clones (day 5). Cells labeled with DAPI. G, Northern blot studies. Northern blots with let-7a oligonucleotide (1 nmol/L 32P-ATPlet-7a miRNA, 21 nt) of crude cell extracts showing the levels of (top band) pre-let-7a and (bottom band) let-7a miRNA in (lane 1) IBC-10a parent cellsand IBC-10a cells stably transfected with (lane 2) pBABE.RPS2, (10 day), (lane 3) pBABE.empty, (lane 4) pBABE.RPS2 (day 15), (lane 5) pBABE.DRPS2-nterminal (þ1 to þ20 b); and (lane 6) pBABE. DRPS2.leucine zipper (þ60 to þ140 b). mwt, mwt standards. Data representative of 5 experiments.

Wang et al.


RETRACTED Marc

h 20,

2012




pre-let-7a and also showed that RPS2 did not bind maturelet-7a or let-7f.Western blots further confirmed that the IPs with

RPS2 and LIN28B antibodies contained RPS2 andLIN28B proteins, respectively. That is, RPS2 antibodiesdid not immunoprecipitate LIN28B (SupplementaryFig. S4A) and LIN28B antibodies did not immunopre-

cipitate RPS2 (Supplementary Fig. S4B). Takentogether, the results show that RPS2 binds pre-let-7a-1 and blocks processing, thereby significantly reduc-ing the expression of mature let-7a/let-7f miRNA inthese cells. Note that RPS2 does not seem to target pre-let-7a-1 for degradation in the prostate cell lines (seeFig. 3A–F and G).

A B

0

50

100

150

200

250

300

350

400

450

IBC-1

0a

pBABE.e

mpty

pBABE.ras

pBABE.R

PS2

No.

col

onie

s

IBC-10a cells

0

50

100

150

200

250

PCa-20

a

pBABE.e

mpty

pBABE.p

re-le

t-7a

shRNA.R

as

shRNA. R

PS2

pLKO.e

mpty

No.

col

onie

s

PCa-20a cells

C

0

100

200

300

400

500

600

700

PC-3M

L

pBABE.e

mp ty

pBABE.p

re-le

t-7a

shRNA.R

as

shRNA.R

PS2

pLKO.e

mpty

No

. co

lon

ies

PC-3ML cells

Figure 4. A–C, CFAs. The numbers of colonies with more than 100-mm diameter after 20 days of incubation. A, CFAs with parent IBC-10a cells,pBABE. empty.IBC-10a (MOCK), pBABE.ras.IBC-10a, and pBABE.RPS2.IBC-10a clones. B, CFAs with parent PCa-20a cells and pBABE.empty.PCa-20a (MOCK), pBABE.pre-let-7a-1.PCa-20, pLKO.TRC.shRNA.ras.PCa-20a, pLKO.TRC.shRNA.RPS2, and pLKO.TRC.empty transfected PCa-20aclones. C, CFAs with parent PC-3ML cells and pBABE.empty (MOCK), pBABE.pre-let-7a-1.PC-3ML, pLKO.TRC.shRNA.ras, pLKO.TRC.shRNA.RPS2,and pLKO.TRC.empty transfected PC-3ML clones. A–C, cells plated in soft agar at densities of 1 � 105 cells per well in 12-well dishes in media containing10% serum for 20 days. A–C, data represent those averaged (i.e., mean � 1 SD) from 3 experiments with 3 dishes per experiment.



RETRACTED Marc

h 20,

2012




Colony-forming assaysWe wished to determine whether RPS2 promoted and/or

whether let-7a blocked tumorigenesis. We examined theCFA of pBABE.RPS2- and pBABE.ras-transfected IBC-10avariants in which RPS2 and ras were overexpressed. IBC-10a parent and pBABE.empty (MOCK)-transfected IBC-10a cells exhibited little or no CFA when the cells weregrown on 0.5% soft agar in SF-KM containing 10% FBS.In comparison, the stably transfected pBABE.ras.IBC-10aand pBABE.RPS2.IBC-10a clones formed more than 300colonies per dish after 40 days (i.e., >100-mm diameter;Fig. 4A).CFAs were also carried out with PCa-20a cells and with

pBABE.pre-let-7a–transfected PCa-20a variants (i.e., inwhich pre-let-7a-1 was overexpressed) to assess whetherlet-7a/let-7f overexpression could block CFA. We foundthat the PCa-20a parent cells and pBABE.empty.PCa-20aclones (MOCK) readily form colonies (i.e., >180 coloniesper dish after 20 days). In contrast, pBABE.pre-let-7a-1.PCa-20a clones failed to form colonies after 20 days(Fig. 4B).qRT-PCR analysis confirmed that PCa-20a and pLL.3.7.

empty cells normally expressed RPS2, ras, and c-myc(Supplementary Fig. S5A). In contrast, the pBABE.pre-let-7a-1 PCa-20a clones expressed significantly reducedlevels of RPS2, ras, and c-myc RNA compared withpBABE.empty clones after selection in puromycin for 5,20, and 50 days (Supplementary Fig. S5A). qRT-PCRfurther validated that pBABE.pre-let-7a PCa-20a variantsexpressed significantly elevated levels of pre-let-7a-1, let-7a,and let-7f miRNA (whereas let-7g, let-7d and let-7eremained unchanged; Supplementary Fig. S5B).CFAs further showed that PCa-20a cells transfected with

either pLKO.TRC.shRNA.ras or pLKO.TRC.shRNA.RPS2to knockdown these genes, failed to form colonies in soft agarafter 20 days (Fig. 4B). However, pLKO.TRC.empty clonesformed more than 170 colonies per dish (Fig. 4B).qRT-PCR analysis validated that there was a knock-

down of RPS2 and to a lesser extent than ras and c-myc inpLKO.TRC.shRNA.RPS2.PCa-20a clones (i.e., relativeto 18S RNA levels). Likewise, in pLKO.TRC.shRNA.ras.PCa-20a clones, there was a significant knockdown of rasand a partial reduction in c-myc and RPS2 compared withpLKO.TRC.empty clones (Supplementary Fig. S5C).Note that RPS6 levels remained constant in the differentvariants and along with 18S RNA served as an internalcontrol.In addition, in the pLKO.TRC.shRNA.RPS2 clones, let-

7a and let-7f levels were significantly increased (>10-fold)compared with pLKO.TRC.empty (SupplementaryFig. S5D). In pLKO.TRC.shRNA.ras clones, the levelsof let-7a and let7f were increased by more than 5-foldcompared with pLKO.TRC.empty. In both pLKO.TRC.shRNA.RPS2 and pLKO.TRC.shRNA.ras clones, the pre-let-7a/pre-let-7g and mature let-7b to let-7d, plus let-7e tolet-7i miRNAs remained unchanged relative to U6 RNAlevels and relative to the levels recorded in pLKO.TRC.empty clones (Supplementary Fig. S5D).

Studies with PC-3ML cells supported the results observedwith PCa-20a cells. CFAs with PC-3ML cells showed thatthe parent PC-3ML cells, pBABE.empty (MOCK) PC-3ML clones, and pLKO.empty.PC-3ML clones eachformed more than 500 colonies per well (Fig. 4C). Incomparison, the PC-3ML cells transfected with pBABE.pre-let 7a-1, or pLKO.TRC.shRNA.ras or pLKO.TRC.shRNA.RPS2, vectors grew only a few colonies per well(Fig. 4C), indicating that overexpression of pre-let-7a-1 orknockdown of either ras or RPS2 served to block CFA inthese highly malignant cells.qRT-PCR analysis validated that ras and c-myc levels

were reduced to near zero in the pBABE.pre-let 7a-1 andpLKO.TRC.shRNA.ras PC-3ML clones whereas RPS2 wasreduced by�65%. Likewise, in pLKO.TRC.shRNA.RPS2.PC-3ML clones, RPS2, ras, and c-myc were reduced to nearzero relative to 18S RNA whereas let-7a/let-7f levelsincreased �10-fold relative to U6 RNA (data not shown).In sum, the data suggest that the combined overexpres-

sion of RPS2, ras, and c-myc in tumor cells that expressreduced levels of let-7a and let-7f serves to promote CFA.Conversely, the overexpression of let-7a/let-7f in cells thatexpress low levels of RPS2, ras, and c-myc significantlyreduces CFA.

Modified Boyden chamber invasion assaysWe wished to assess whether the expression of either let-

7a or let-7f had an impact on the invasive activities of IBC-10a and PCa-20a cells. In modified Boyden chamberinvasion assays, we found that IBC-10a cells or pBABE.empty (Mock) transfected IBC-10a cells exhibited lowlevels of invasion after 48 to 72 hours (Fig. 5A). Incomparison, the pBABE-ras.IBC-10a and pBABE-RPS2.IBC-10a clones were highly invasive after 48 and 72 hours(Fig. 5A). Likewise, PCa-20a parent and pBABE.empty.PCa-20a (MOCK) PCa-20a clones that expressed rela-tively high levels of ras, c-myc, and RPS2 were highlyinvasive after 48 and 72 hours (Fig. 5A). In contrast, theinvasive ability of pBABE.pre-let-7a-1.PCa-20a clones wasnear zero (Fig. 5A).Similar results were observed with PC-3ML cells. The

parent and MOCK transfected PC-3ML clones were highlyinvasive (i.e., >20% invasive after 48 hours; Fig. 5B). Incomparison, the pBABE.pre-let-7a-1.PC-3ML, pLKO.TRC.shRNA.ras.PC-3ML, and pLKO.TRC.shRNA.RPS2.PC-3ML clones exhibited very low invasive capabil-ities (i.e., <5%; Fig. 5B).

Tumor modeling studiesNormally, PCa-20a cells will not form tumors in CB17-

SCID mice, although they are tumorigenic in NOD-SCIDmice. We have, therefore, evaluated where the expression ofRPS2, ras, or pre-let-7a had an effect on tumor uptake inCB17-SCID mice. In these studies, we injected CB17-SCID mice intraperitoneally with either PCa-20a parent,pBABE-ras.PCa-20a, or pBABE.RPS2.PCa-20a cells (i.e.,at 1 � 106 cells per mouse, n ¼ 5 mice per cell variant).Mice injected with the PCa-20a parent cells failed to grow

Wang et al.


RETRACTED Marc

h 20,

2012




tumors after 2 months. However, all the mice injected withpBABE-ras.PCa-20a and pBABE.RPS2.PCa-20a clonesgrew numerous tumor nodules on the liver, kidney, mesen-tery, and colon after 2 months that varied in size from 0.1-to 1.5-mm diameter (Table 1).

Western blots of crude cell extracts from collagenase Idigested tumor tissue showed that all the mouse tumorsderived from pBABE-ras.PCa-20a (n ¼ 5) and pBABE-RPS2.PCa-20a clones (n ¼ 4) were uniformly positive forRPS2, ras, c-myc, RPS6, and b-actin (Fig. 6A and B).

Figure 5. A and B, modifiedBoyden chamber invasion assays.A, The percent invasion by parentIBC-10a, pBABE-ras.IBC-10a,pBABE-RPS2.IBC-10a, andpBABE.empty (MOCK) IBC-10aclones. Invasion assays withparent PCa-20a cells and withpBABE.pre-let-7a-1.PCa-20a andpBABE.empty.PCa-20a (MOCK)clones are shown. B, the percentinvasion by parent PC-3ML,pBABE.empty.PC-3ML (MOCK),and pBABE.pre-let-7a-1.PC-3MLclones. Also, the percent invasionby pLKO.TRC.shRNA.ras.PC-3ML, pLKO.TRC.shRNA.RPS2,and pLKO.TRC.empty.PC-3ML(MOCK) clones after 48 hours isshown. In A and B, cells wereplated at 50,000 cells per well onMatrigel-coated Transwellchambers, 6.5-mm diameter(Becton-Dickinson), and invasionstimulated with TGFb1 plus EGF(10 ng/mL) added to the cells inthe top compartment and VEGFD(25 ng/mL) added to the bottomcompartment. The invasive cellswere collected from the bottomcompartment with trypsin-EDTAafter 48 and 72 hours and countedwith a flow cytometer afterlabeling with 1 mmol/L propidiumiodide. Data represent the mean �1 SD from 3 experiments.

A

0

5

10

15

20

25

30

35

40

45

IBC-1

0a

pBABE.ra

s

pBABE.R

PS2

pBABE.e

mpt

y

PCa-20

a

pBABE.p

re-le

t-7a

pBABE.e

mpt

yP

erce

nt in

vasi

on

48 h72 h

B

0

5

10

15

20

25

30

35

PC-3M

L

pBABE.e

mpt

y

pBABE.p

re-le

t-7a

shRNA.R

as

shRNA.R

PS2

pLKO.e

mpt

y

Per

cent

inva

sion

PC-3ML

Table 1. Tumor modeling studies

Organ site PCa-20a pBABE.ras pBABE.RPS2 PC-3MLa pLKO.TRC.shRNA.ras.PC-3MLb

pLKO.TRC.shRNA.RPS2.PC-3MLb

pBABE.prelet-7a-1.PC-3MLb

Liver 0 1 � 1 2 � 2 6 � 5 0 1 0Colon 0 9 � 4 11 � 4 19 � 8 2 2 2Kidney 0 1 � 1 1 � 1 4 � 1 0 0 0Mesentery 0 10 � 5 10 � 5 15 � 9 1 3 1

NOTE: A pBABE.pre-let-7a-1.GFP vector was used to transfect the PC-3ML cells and stably transfected clones selected by limiteddilution at passages 2 to 5weregrownup for the tumormodeling studies.Measurementsof tumor size following sacrifice of the animalsrevealed that the PCa-20a tumors ranged in size from 0.1 to 1.5 mm whereas PC-3ML tumors ranged in size from 0.3-mm to 1-cmdiameter. The pLKO.TRC shRNA tumors were less than 0.2-mm diameter. Tumor cells were injected i.p. at 1 � 106 cells.a Column indicates PC-3ML cells that died after � 5 weeks from tumor burden.b Mice were injected twice i.p. at day 1 and day 10. Mice were normally sacrificed after�2 months except in the case of mice injectedwith parent PC-3ML cells that died after�5 weeks from tumor burden. Data represent the numbers of tumors per organ sit (n = 5miceper cell variant) as the mean þ� SD.



RETRACTED Marc

h 20,

2012




qRT-PCR analysis of pBABE-RPS2.PCa-20a tumorsrevealed that let-7a and let-7f levels were reduced to nearzero, whereas pre-let-7a and pre-let-7g were more than 1.2-fold higher than U6 RNA. In addition, let-7b/7c/7d/7e/7g/7h/7i levels were less than or equivalent to U6 RNA levels

(Fig. 6C). Interestingly, the levels of these miRNAs wereonly partially reduced by �50% in pBABE-ras. PCa-20atumors indicated that total elimination of let-7a and let-7fwas not associated with the overexpression of ras. Also, thedata suggest that relatively low levels of expression of these

ApBABE-Ras.PCa-20a

BpBABE.RPS2.PCa-20a

C

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

pre-let-7a

pre-let-7g

U6RNAlet-7ilet-7hlet-7glet-7flet-7elet-7dlet-7clet-7blet-7a

Fol

d ch

ange

pBABE.RPS2 pBABE.ras

RPS2

RPS6

ras

c-myc

Actin

1 2 3 4

ras

RPS2

RPS6

c-myc

Actin

1 2 3 4 5

D

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

18S RNAc-mycrasRPS6RPS2

Fol

d ch

ange

pBABE.RPS2

pBABE.ras

Figure 6. A–D, analysis of gene expression in SCID mouse tumors. A, Western blots of crude cell extracts from pBABE-ras.PCa-20a tumors. Therelative levels of expression of ras, RPS2, RPS6, c-myc, and actin in (lanes 1–5) 5 different mouse tumors are shown. B, Western blots of crude cell extractsfrom pBABE-RPS2.PCa-20a tumors. The relative levels of expression of RPS2, RPS6, ras, c-myc, and b-actin in (lanes 1–4) 4 different mouse tumorsare shown. C, qRT-PCR measurements of pre-let-7a, pre-let-7g, and let-7a to let-7i expression in pBABE-RPS2.PCa-20a and pBABE-ras.PCa-20a tumors(day 60). Values were normalized to U6 RNA (set at 1). D, qRT-PCR measurements of RPS2, RPS6, ras, c-myc, and 18S RNA in pBABE.RPS2 and pBABE.ras tumors (day 60). Data normalized to 18S RNA. Data were averaged from 5 tumors � 1 SD.

Wang et al.


RETRACTED Marc

h 20,

2012




miRNAs did not seem to interfere with tumor growth tooccur (Fig. 6C).qRT-PCR of RPS2, ras, and c-myc mRNA levels in the

tumors confirmed that all 3 genes were elevated relative to18S RNA in pBABE-RPS2.PCa-20a and pBABE-ras.PCa-20a tumors. Note that the levels of RPS2 were significantlylower in the pBABE.ras.PCa-20a tumors than in thepBABE-RPS2 tumors (Fig. 6D), indicating that ras maynot directly promote RPS2 expression. Note, attempts tomeasure LIN28B mRNA levels by qRT-PCR indicated thatthis gene was expressed at levels equivalent to U6 RNA inpBABE.RPS2.PCa-20a tumors, but the levels were reducedto near zero in pBABE-ras.PCa-20a tumors.Similar types of studies with the highly malignant PC-

3ML cells showed that the parent PC-3ML cells grewnumerous tumor nodules on the liver, kidney, colon, andmesentery by 5 weeks that varied in size from 0.3-mm to 1-cm diameter (Table 1).Western blots of these tumor extractsindicated that the tumors expressed relatively high levels ofras, RPS2, and c-myc but faint levels of LIN28B (data notshown). Northern blots and qRT-PCR showed that thetumors were either negative for let-7a/let-7f miRNA orexpressed faint levels of the gene (data not shown).Tumor modeling studies with pBABE.pre-let-7.PC-

3ML, and pLKO.TRC.shRNA.ras.PC-3ML and pLKO.TRC.shRNA.RPS2.PC-3ML clones, failed to yieldtumors (despite injection of the cells at 1 � 106 cellstwice at 10-day intervals) or the cells produced only 1 to 3tumors per mouse (<0.2-mm diameter) after 2 months(Table 1). Immunolabeling indicated that these lattertumors expressed RPS2, ras, and c-myc plus faint levelsof LIN28B (data not shown), indicating that these tumorsmay arise from cells that were no longer expressed thepLKO.TRC vector. Unfortunately, there was inadequatematerial for PCR analysis of gene expression levels in thesetumors.

Discussion

The results reported in this article have shown that RPS2specifically binds the stem-loop domain (i.e. UAGGGU-CAC) of pre-let-7a-1 and blocks processing of pre-let-7a-1to mature let-7a and let-7f. Using EMSAs, we showed thatrecombinant RPS2 specifically binds pre-let-7a RNA butnot pre-let-7g or mutated pre-let-7a RNA. We estimatedthe Kd of RPS2 binding to pre-let-7a to be 2.45 � 0.23mmol/L, indicating that RPS2 has a high affinity for pre-let-7a. qRT-PCR assays and Northern blots of the complexesimmunoprecipitated with RPS2 antibodies from pBABE.RPS2-transfected IBC-10a cells showed that RPS2 blockedprocessing of pre-let-7a and the expression of mature let-7a.Immunoflourescent studies of PCa-20a cells further indi-cated that RPS2 binds pre-let-7a-1 to form "episomalcomplexes" in the nuclear matrix, albeit the nature of thesecomplexes has not been resolved. As a result of RPS2blocking pre-let-7a processing, let-7a was no longer avail-able to inhibit the translation of ras (and c-myc). Theconsequence of RPS2 overexpression (and the inhibition

of let-7a expression) was that increased ras (and c-myc)expression served to promote cell growth, CFA, invasion,and tumor growth in SCID mice.

miRNAs and cancermiRNAs are a diverse family of RNA molecules, typically

�18 to 24 nt in length, that have emerged as a class oftranscripts that regulate the stability and translational effi-ciency of a variety of mRNAs, including different oncogenessuch as c-myc (25). A large body of evidence has documentednearly ubiquitous deregulation of miRNA expression incancer cells (1, 26, 27). Although select miRNAs are unre-gulated in cancer cells, globalmiRNA abundance seems to begenerally reduced in tumors (28). In fact, downregulation ofselect miRNA families (i.e., let-7) is thought to contribute toneoplastic transformation by allowing an increased expres-sion of proteins with oncogenic potential (i.e., c-myc and ras;refs. 1, 29).In studies of the let-7 family miRNAs in various human

cancers including lung, colon, ovarian, gastric cancer, leio-myoma, and melanoma, let-7 family members have beendescribed as being downregulated during cancer progression(4, 28, 30–33). Although it is not understood how thisrelates to cancer progression, the targets of let-7a-1 identi-fied include cell-cycle regulators such as CDC25A andCDK (2, 34) that function as key promoters of Ha-rasand c-myc expression (26–27, 29, 31, 34, 35) and a numberof early embryonic genes including HMGA2,Mlin-41, andIMP-1 (36–41). Consequently, it is presumed that a loss oflet-7a expression enables activation of signaling pathwaysthat promote tumor growth. Our data support this supposi-tion and show that overall there is a reduction of let-7miRNAs bymore than 50% inmalignant cell lines (i.e., PC-3ML and PCa-20a cells) compared with the nonmalignantcell lines (i.e., IBC-10a cells). More important, there is asignificant reduction of let-7a and let-7f miRNA in malig-nant prostate cancer cells (i.e., PCa-20a and PC-3ML cells)to near zero compared with IBC-10a cells. This reductionoccurs in concert with the upregulation of ras, c-myc, andRPS2 and malignancy of the cell lines.

RPS2 ribosomal protein and cancerA variety of ribosomal proteins (i.e., RPS3a, L7, L11, and

L19) have been found to be overexpressed in cancer, but theirmechanisms of action are poorly understood (9). RPS2 hasbeen found to promote tumorigenesis (10), but unlike otherribosomal genes, RPS2 belongs to the highly conservedspecies of repetitive mammalian gene termed LLRep3, mem-bers of which hybridize to a single abundant poly Aþ RNA(9, 13). Interestingly, RPS2 levels are consistently high intumorigenic cell lines transformed by Ha-ras, SV-40, poly-oma virus, Rous sarcoma virus, Abelson murine leukemiavirus, and chemical carcinogen than in nontumorigenic cells(11, 12). Likewise, ribosomal protein genes L37,RPP-1, andRPS2 have been shown to be upregulated in the presence ofan oncogenic form of the mutated p53 tumor suppressor(14). The implication is that RPS2 in conjunction with rasor c-mycmay cooperate with p53 to promote tumorigenesis.



RETRACTED Marc

h 20,

2012




With regard to prostate cancer, our group found thatRPS2 was abundantly overexpressed in all prostate cancersand was not expressed in normal or BPH tissues (7). Thecurrent studies suggest that RPS2 may function to blockprocessing of pre-let-7a-1 to prevent let-7a inhibition of rasand c-myc expression, thereby promoting tumorigenesis intumor modeling studies. The overall implication is thatRPS2 binds pre-let-7a to block expression of let-7a andthereby cooperates with ras (and possibly c-myc or p53) topromote tumor growth. In reality, we predict that a delicateimbalance in the expression of RPS2 and let-7a may con-stantly serve to modulate ras and c-myc expression tocontrol tumor growth and progression.It may turn out that RPS2 also targets a number of

miRNAs in addition to pre-let-7a. Blast analysis indicates apotential binding site for RPS2 (i.e., AGGCAC) is alsopresent in the stem-loop domain of other mammalianmiRNAs (i.e., pre-let-7f, and mature 105-1, 124, 17,302d, 214, 593, 564, 506, and BART 20 miRNAs). Futurestudies are warranted to examine whether RPS2 can alsoblock processing of these miRNAs or target them fordegradation.

Role of ras in prostate cancerUnfortunately, there is conflicting data regarding the

potential involvement of ras and oncogenic mutations ofras in prostate cancer. In this regard, ras mutations seem tobe low in American males, whereas 25% of Japanesepatients have the mutated ras gene and show a correlationwith tumor stage and grade, suggesting ethnic differencesexist in frequency of ras mutation in prostate cancer (42,43). However, in contrast to these findings, immunohis-tochemical studies revealed a strong epithelial staining forras in the vast majority of prostate cancers. In fact, asignificant increase in ras expression has been observed incarcinomas of the prostate and an inverse correlation of raspositivity with the degree of differentiation or survival ofpatients has been recorded (44). In this study, we found thatthe malignant prostate cell lines (PCa-20a and PC-3MLcells) expressed ras but the nonmalignant cells (i.e., IBC-10a) expressed little or no ras. Stable transformation of thePCa-20a cells with pBABE.ras stimulated expression of ras,RPS2 (and c-myc) to promote malignancy. It is thereforefeasible that functional activation of wild-type ras (or c-myc)may somehow stimulate increased RPS2 expression to blockDrosha/Dicer processing of pre-let-7a. Under these condi-tions, the levels of ras (and c-myc) may reach levels sufficientfor tumor growth. We are currently examining the mechan-isms by which ras (and c-myc) might regulate RPS2 tran-scription and/or induce posttranslational modifications ofRPS2 to increase its activity or stability.Interestingly, Watanabe et al. (45) found that oncogenic

ras signaling can induce HMGA2 expression (i.e., high-mobility group protein A2), a gene induced during epithe-lial mesenchymal transitions (46), and promote malignancyof pancreatic cancer cells. In this connection, 3 groups (47–49) showed that HMGA2 translation is blocked by let-7a incancer cells. In fact, Mayr et al. (48) showed that the

truncated form of HMGA2 is uncoupled from let-7a–induced growth suppression and that HMGA2 has onco-genic properties when expressed in NIH3T3 cells thatexpress endogenous levels of let-7a miRNA. Given theintriguing nature of these observations, we are currentlyinvestigating the role of let-7a/let-7f in controlling ras-dependent epithelial mesenchymal transitions and ras-dependent HMGA2 and vimentin expression in the pri-mary prostate cells. One goal was to determine whetherRPS2 could block pre-let-7a processing to promote ras-dependent invasion via activation of signaling pathwaysdriving HMGA2, vimentin, and MMP-2/9 expression intumor cells and tumors.

Potential cooperative activities of RPS2 and LIN28BPiskounova et al. (50) have clearly shown that LIN28

selectively binds the terminal loop region of precursor let-7gmiRNAs (i.e., both pri- and pre-let-7g sequences) andmature let-7g localized primarily to the cytoplasm (51).It has also been shown that the expression of LIN28B andless frequently LIN28 is activated in several cancer types andtheir overexpression causes cellular transformation (6) alongwith increased c-Myc, HMGA2, and ras expression (52).Unlike RPS2, LIN28 targets pre-let-7g for uridylated anddegradation in cancer cells (53). The results in this articlesupport this conclusion. The IP assays show that LIN28Bselectively binds pre-let-7g whereas RPS2 binds pre-let-7a.More important, the data show that RPS2 and LIN28B donot bind pre-let-7a or pre-let-7g in a cooperative manner.We, therefore, believe that RPS2 and LIN28Bmay functionindependently in controlling processing of 2 separate mem-bers of the pre-let-7 family to independently promotetumorigenesis.

CFAs, invasion assays, and tumor modeling studiesThe overexpression of RPS2, ras, and c-myc in PCa-20a

cells transformed them to a malignant phenyotype. CFAsshowed that pBABE.ras- and pBABE.RPS2-transfectedPCa-20 cells were more malignant and formed a greaternumber of colonies in CFAs than the parent PCa-20a cells.Conversely, PC-3ML cells (which normally exhibit a highCFA ability) transfected with pLKO.TRC.shRNA.ras orpLKO.TRC.shRNA.RPS2 and pBABE.pre-let-7a-1 vectorsexhibited almost zero CFA compared with the parent PC-3ML cells.Likewise, functional studies designed to measure the

invasive activity of the cell lines in modified Boydenchamber assays showed that PCa-20a clones transfectedwith either pBABE-ras or pBABE-RPS2 constructsacquired a highly invasive phenotype. Conversely, whenthe highly invasive PC-3ML cells were transfected withpLKO.TRC.shRNA.ras and pLKO.TRC.shRNA.RPS2vectors, the stable variants exhibited little or no invasiveactivity.The CFAs and invasions studies further showed that the

overexpression of pre-let-7a blocked CFA and invasion. Forexample, pBABE.pre-let-7a-1.PC-3ML clones did not formcolonies and they were noninvasive in Boyden chamber

Wang et al.


RETRACTED Marc

h 20,

2012




assays. In sum, the data indicate that pre-let-7a-1 mayfunction as a tumor suppressor gene.Tumor modeling studies in CB17-SCID mice supported

the in vitro observations. The data further showed thatfollowing transfection of PC-20a cells with either pBABE-ras or pBABE.RPS2 constructs, the cells acquired an ability toform tumors when injected i.p. Characteristically, the tumorsformed expressed ras, c-myc, and RPS2, but little or no let-7amiRNA (as shown byWestern blots and qRT-PCR). Pre-let-7a was expressed by the tumors, however, and we thereforebelieve that RPS2may function to block pre-let-7a processingin tumors. Note that the pBABE.ras.PCa-20a tumors stillexpressed low levels of let-7a/let-7f but at levels that wereapparently insufficient to block oncogene-dependent growth.Normally, PC-3ML cells readily form tumors and the

mice die from tumor burden by �5 weeks postinjection.However, we found that the pBABE.pre-let-7-, pLKO.TRC.shRNA.ras-, and pLKO.TRC.shRNA.RPS2-trans-fected PC-3ML variants failed to form tumors wheninjected i.p. These data further support the conclusion thatras and RPS2 were required for tumor growth and thatelevated let-7a blocked tumor take and/or growth. In

conclusion, our data indicate that knockdown of RPS2may be of therapeutic value in helping to upregulate let-7amiRNA and block expression of oncogenes (i.e., ras, c-myc)promoting tumorigenesis.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We thank Dr. Fernando Garcia for help in obtaining human prostate tissue for theisolation of the primary cell lines and Dr. Shaun M. Goodyear (University ofPennsylvania) for careful reading of the manuscript and invaluable discussions ofthe data.

Grant Support

NIH-NCI-CA076639-8 (M.E. Stearns).The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

Received April 21, 2010; revised September 23, 2010; accepted November 15,2010; published OnlineFirst December 8, 2010.

References1. Calin GA, Croce CM.MicroRNA signatures in human cancers. Nat Rev

Cancer 2006;6:857–66.2. Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, et al.

MicroRNA let-7a down-regulates MYC and reverts MYC-inducedgrowth in Burkitt lymphoma cells. Cancer Res 2007;67:9762–70.

3. Yu F, Yao H, Zhu P, Zhang X, Pan Q, GongC, et al. let-7a regulates selfrenewal and tumorigenicity of breast cancer cells. Cell 2006;131:1109–23.

4. JohnsonSM,GrosshansH,ShingaraJ,ByromM,JarvisR,ChengA,et al.RAS is regulated by the let-7 microRNA family. Cell 2005;120: 635–47.

5. NewmanMA, Thomson JM, Hammond SM. Lin-28 interaction with theLet-7a precursor loopmediates regulatedmicroRNA processing. RNA2008;14:1539–49.

6. Viswanathan SR, Daley GQ, Gregory RI. Selective blockade of micro-RNA processing by LIN28. Science 2008;320:97–103.

7. Ohkia A, Hu Y, Wang M, Garcia FU, Stearns ME. Evidence for aprostate cancer associated diagnostic marker-1, PCADM-1: immu-nohistochemistry and in situ hybridization studies. Clin Can Res2004;10:2452–8.

8. Wang M, Hu Y, Stearns ME. RPS2: a novel therapeutic target inprostate cancer. J Exp Clin Cancer Res 2004;28:6–14.

9. Wool IG. Extraribosomal functions of ribosomal proteins. TrendsBiochem Sci 1996;21:164–5.

10. Chiao PJ, Shin DM, Sacks PG, Hong WK,, Tainsky MA. Elevatedexpression of the ribosomal protein S2 gene in human tumors. MolCarcinog 1992;5:219–31.

11. Scott MR, Westphal KH, Rigby PW. Activation of mouse genes intransformed cells. Cell 1983;34:557–67.

12. Shin DM, Chiao PJ, Sacks PG, Shin HJ, Hong WK, Hittelman WN,et al. Activation of ribosomal protein S2 gene expression in a hamstermodel of chemically induced oral carcinogenesis. Carcinogenesis1993;14:163–6.

13. Slynn G, Jenner D, PottsW, Elvin P, Morten J. Human cDNA sequencehomologous to the mouse LLRep3 gene family. Nucleic Acids Res1990;18:681–92.

14. Loging WT, Reisman D. Elevated expression of ribosomal proteingenes L37, Rpp-1, and S2 in the presence of mutant p53. CancerEpidemiol Biomark Prev 1999;8:1011–6.

15. Ardini E, Pesole G, Tagliabue E,Magnifico A, Castronovo V, Sobel ME,et al. The 67-kDa laminin receptor originated from a ribosomal proteinthat acquired a dual function during evolution. Mol Biol Evol 1998:15:1017–25.

16. Kondoh N, Schweinfest CW, Henderson KW, Papas TS. DifferentialexpressionofS19 ribosomalprotein, laminin-bindingprotein, andhumanlymphocyte antigen class I messenger RNAs associated with coloncarcinoma progression and differentiation. Cancer Res 1992:52:791–6.

17. Wang M, Stearns ME. Isolation and characterization of PC-3 humanprostatic tumor sublines which preferentially metastasize to selectorgans in S.C.I.D. mice. Differentiation 1991;48:115–25.

18. Goodyear SB, Amatangelo MD, Stearns ME. Dysplasia of humanprostate CD133hi SPs in NOD-SCIDS is blocked by c-myc anti-sense.Prostate 2009;69:689–98.

19. Yasunaga Y, Nakamura K KD, Srivastava S, Moul JW, Sesterhenn IA,McLeod DG, et al. A novel human cancer culture model for the studyof prostate cancer. Oncogene 2001;20:8036–41.

20. Blevins T. Northern blotting techniques for small RNAs. Methods MolBiol 2010;631:87–107.

21. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual,Biotechnology; Molecular Biology; Biochemistry; Laboratory Man-uals. Vol. 108. 3rd ed. Plainview, NY: Cold Spring Harbor LaboratoryPress, 2003. 82–2.

22. Stearns M, Tran J, Zhang H, Francis MK, Sell C. Activated rasenhances insulin-like growth factor 1 mediated induction of vascularendothelial growth factor in prostate epithelial cells. Cancer Res2005;65:2085–8.

23. Forooghian F, Macdonald IM, Heckenlively JR, H�eon E, Gordon LK,Hooks JJ, et al. The need for standardization of anti-retinal antibodydetection and measurement. Am J Ophthalmol 2008;146:489–95.

24. Croce CM. Role of TCL1 and ALL1 in human leukemias and devel-opment. Cancer Res 1999;59:1778s–83s.

25. Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H., EndohH, et al. Reduced expression of the let-7 microRNAs in human lungcancers in associationwith shortened postoperative survival. Can Res2004;64:3753–6.

26. Meltzer PM. Cancer genomics: small RNAs with big impacts. Nature2005;435:745–6.



RETRACTED Marc

h 20,

2012




27. Calin GA, Ferracin M, Cimmino A, Leva GD, Shimizu M, Wojcik SE,et al. MicroRNA signature associated with prognosis and progressionin chronic lymphocytic leukemia. N Engl J Med 2005;353:1793–801.

28. Lu J, Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, et al.MicroRNA expression profiles classify human cancers. Nature 2005;435:834–8.

29. Yang H, Kong W, He L, Zhao JJ, O’Donnell JD, Wang J, et al.MicroRNA expression profiling in human ovarian cancer: miR-214induces cell survival and cisplatin resistance by targeting PTEN.Cancer Res 2008;68:425–33.

30. Nam EJ, Yoon H, Kim SW, Kim H, Kim YT, Kim JH, et al. MicroRNAexpression profiles in serous ovarian carcinoma. Clin Cancer Res2008;14:2690–5.

31. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, et al.Combinatorial microRNA target predictions. Nat Genet 2005;37:495–500.

32. Akao Y, Nakagawa Y, Naoe T. let-7 microRNA functions as a potentialgrowth suppressor in human colon cancer cells. Biol Pharm Bull2006;29:903–6.

33. Motoyama K, Inoue H, Nakamura Y, Uetake H, Sugihara K, Mori M.Clinical significance of high mobility group A2 in human gastric cancerand its relationship to let-7 microRNA family. Clin Cancer Res2008;14:2334–40.

34. Johnson CD, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K,Ovcharenko D, et al. The let-7 microRNA represses cell proliferationpathways in human cells. Cancer Res 2007;67:7713–22.

35. Shama S, Avni D, Frederickson R, Sonenberg N, Meyuhas O. Over-expression of initiation factor eIF-4E does not relieve the translationalrepression of ribosomal protein mRNAs in quiescent cells. Gene Expr1995;4:241–52.

36. Nygard O, Nilsson L. Translational dynamics. Interactions betweenthe translational factors, tRNA and ribosomes during eukaryoticprotein synthesis. Eur J Biochem 1990;191:1–17.

37. Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses theHMGA2 oncogene. Genes Dev 2007;21:1025–30.

38. Hebert C, Norris K, Scheper MA, Nikitakis N, Sauk JJ. High mobilitygroup A2 is a target for miRNA-98 in head and neck squamous cellcarcinoma. Mol Cancer 2007;6:5–12.

39. Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME.The role of let-7in cell differentiation and cancer . Endocr Relat Cancer 2010;17:19–36.

40. Maller Schulman BR, Liang X, Stahlhut C, Delconte C, Stefani G, SlackFJ. The let-7 microRNA target gene, Mlin41/Trim71 is required for

mouse embryonic survival and neural tube closure. J Cell Cycle2008;7:3935–42.

41. Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNAprocessing enhances cellular transformation and tumorigenesis. NatGenet 2007;39:673–7.

42. Watanabe S, Ueda Y, Akaboshi S, Hino Y, Sekita Y, NakaoM. HMGA2maintains oncogenic RAS-induced epithelial–mesenchymal transitionin human pancreatic cancer cells. Am J Pathol 2009;174:854–68.

43. Bushman EC, Nayak RN, BushmanW. Immunohistochemical stainingof ras p21: staining in benign and malignant prostate tissue. J Urol1995;153:233–7.

44. Agnantis NJ, Constantinidou AE, Papaevagelou M, Apostolikas N.Comparative immunohistochemical study of ras-p21 oncoprotein inadenomatous hyperplasia and adenocarcinoma of the prostate gland.Anticancer Res 1994;14:2135–40.

45. Watanabe S, Ueda Y, Akaboshi S, Hino Y, Sekita Y, NakaoM. HMGA2maintains oncogenic RAS-induced epithelial–mesenchymal transitionin human pancreatic cancer cells. Am J Pathol 2009;174:854–68.

46. Thuault S, Tan EJ, Peinado H, Cano A, Heldin CH, Moustakas A.HMGA2 and Smads co-regulate SNAIL1 expression during inductionof epithelial-to-mesenchymal transition. J Biol Chem 2008;283:33437–46.

47. Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses theHMGA2 Oncogene. Genes Dev 2007;21:1025–30.

48. Mayr C, Hemann MT, Bartel DP. Disrupting the pairing between let-7and HMGA2 enhances oncogenic transformation. Science 2007;315:1576–9.

49. Shell S, Park SM, Radjabi AR, Schickel R, Kistner EO, Jewell DA, et al.let-7 expression defines two differentiation stages of cancer. Proc NatlAcad Sci USA 2007;104:11400–5.

50. Piskounova E, Viswanathan SR, Janas M, Lapierre RJ, Daley GQ, SlizP, et al. Determinants of microRNA processing inhibition by thedevelopmentally regulated RNA-binding protein LIN28. J Biol Chem2008;283:21310–4.

51. Dangi-Garimella S, Yun J, Eves EM, Newman M, Erkeland SJ, Ham-mond SM, et al. Raf kinase inhibitory protein suppresses a metastasissignalling cascade involving LIN28 and let-7. EMBO J 2009;28:347–58.

52. Heo I, Joo C, Cho J, HaM, Han J, Kim VN. LIN28mediates the terminaluridylation of let-7 precursor microRNA. Mol Cell 2008;32:276–84.

53. Bussing I, Slack FJ, Grosshans H. let-7 microRNAs in development,stem cells and cancer. Trends Mol Med 2008;14:400–9.

Wang et al.


RETRACTED Marc

h 20,

2012




Retraction

Retraction: Role of Ribosomal Protein RPS2 inControlling let-7a Expression in Human ProstateCancer

The authors wish to retract the paper entitled Role of Ribosomal ProteinRPS2 in Controlling let-7a Expression in Human Prostate Cancer (1), becauseof errors in Figures 1 and 6.

All of the authors agree with the retraction of this article.

Min WangYouji HuMichael D. AmantageloMark E. StearnsDepartment of PathologyDrexel University College of MedicinePhiladelphia, PA

Reference1. Wang M, Hu Y, Amatangelo MD, Stearns ME. Role of Ribosomal Protein RPS2 in Controlling

let-7a Expression in Human Prostate Cancer. Mol Cancer Res 2011;9:36–50.

Published OnlineFirst March 20, 2012.doi: 10.1158/1541-7786.MCR-12-0085�2012 American Association for Cancer Research.

MolecularCancer

Research

Mol Cancer Res; 10(4) April 2012570

2011;9:36-50. Published OnlineFirst December 8, 2010.Mol Cancer Res Min Wang, Youji Hu, Michael D. Amatangelo, et al. Expression in Human Prostate CancerRole of Ribosomal Protein RPS2 in Controlling let-7a

Updated version

10.1158/1541-7786.MCR-10-0158doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2021/03/13/1541-7786.MCR-10-0158.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/9/1/36.full#ref-list-1

This article cites 52 articles, 19 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/9/1/36.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/9/1/36To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-10-0158

http://mcr.aacrjournals.org/content/suppl/2021/03/13/1541-7786.MCR-10-0158.DC1

http://mcr.aacrjournals.org/content/9/1/36.full#ref-list-1

http://mcr.aacrjournals.org/content/9/1/36.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/9/1/36


cancer genes and genomics - molecular cancer researchras and c-myc expression and the transformation...

Documents