Calcineurin and Calcium Channel CchA Coordinate the Salt StressResponse by Regulating Cytoplasmic Ca2� Homeostasis inAspergillus nidulans

Sha Wang,a,b Xiao Liu,a,c Hui Qian,a Shizhu Zhang,a Ling Lua

Jiangsu Key Laboratory for Microbes and Functional Genomics, College of Life Sciences, Nanjing Normal University, Chinaa; Program in Molecular and TranslationalMedicine (PMTM), School of Medicine, Huzhou University, Zhejiang, Chinab; School of Nursing, Qingdao Huanghai University, Shandong, Chinac

ABSTRACT

The eukaryotic calcium/calmodulin-dependent protein phosphatase calcineurin is crucial for the environmental adaption offungi. However, the mechanism of coordinate regulation of the response to salt stress by calcineurin and the high-affinity cal-cium channel CchA in fungi is not well understood. Here we show that the deletion of cchA suppresses the hyphal growth defectscaused by the loss of calcineurin under salt stress in Aspergillus nidulans. Additionally, the hypersensitivity of the �cnaA strainto extracellular calcium and cell-wall-damaging agents can be suppressed by cchA deletion. Using the calcium-sensitive photo-protein aequorin to monitor the cytoplasmic Ca2� concentration ([Ca2�]c) in living cells, we found that calcineurin negativelyregulates CchA on calcium uptake in response to external calcium in normally cultured cells. However, in salt-stress-pretreatedcells, loss of either cnaA or cchA significantly decreased the [Ca2�]c, but a deficiency in both cnaA and cchA switches the [Ca2�]c

to the reference strain level, indicating that calcineurin and CchA synergistically coordinate calcium influx under salt stress.Moreover, real-time PCR results showed that the dysfunction of cchA in the �cnaA strain dramatically restored the expression ofenaA (a major determinant for sodium detoxification), which was abolished in the �cnaA strain under salt stress. These resultssuggest that double deficiencies of cnaA and cchA could bypass the requirement of calcineurin to induce enaA expression undersalt stress. Finally, YvcA, a member of the transient receptor potential channel (TRPC) protein family of vacuolar Ca2� channels,was proven to compensate for calcineurin-CchA in fungal salt stress adaption.

IMPORTANCE

The feedback inhibition relationship between calcineurin and the calcium channel Cch1/Mid1 has been well recognized fromyeast. Interestingly, our previous study (S. Wang et al., PLoS One 7:e46564, 2012, http://dx.doi.org/10.1371/journal.pone.0046564) showed that the deletion of cchA could suppress the hyphal growth defects caused by the loss of calcineurin under salt stressin Aspergillus nidulans. In this study, our findings suggest that fungi are able to develop a unique mechanism for adapting toenvironmental salt stress. Compared to cells cultured normally, the NaCl-pretreated cells had a remarkable increase in transient[Ca2�]c. Furthermore, we show that calcineurin and CchA are required to modulate cellular calcium levels and synergisticallycoordinate calcium influx under salt stress. Finally, YvcA, a member of of the TRPC family of vacuolar Ca2� channels, wasproven to compensate for calcineurin-CchA in fungal salt stress adaption. The findings in this study provide insights into thecomplex regulatory links between calcineurin and CchA to maintain cytoplasmic Ca2� homeostasis in response to different envi-ronments.

To rapidly sense and respond to different environmental con-ditions, organisms have evolved signaling pathways to coordi-

nate growth, proliferation, and metabolism (1–6). Among them,the calcium-mediated signaling pathway plays an important reg-ulatory role in various physiological processes, such as cell cycle,cytoskeletal rearrangement, ion homeostasis, and stress response(7–10). Calcium homeostasis systems are highly regulated path-ways used by cells to maintain cytoplasmic Ca2� concentrations([Ca2�]c)within an optimal range in the cytosol and other organ-elles (11–14). The rise and fall of free [Ca2�]c can be directlysensed, decoded, and retransmitted to cellular targets, such as theCa2�/calmodulin-dependent protein phosphatase calcineurin,which is highly conserved from yeasts to humans and mediatesmany important cellular processes (15, 16).

Calcineurin is a member of the serine-threonine-specific pro-tein phosphatase (PP) family. It differs from other phosphatasesin its metal ion requirements, range of substrate specificity, andcellular regulation (17). Calcineurin exists as a heterodimer of

catalytic subunits (CnA) and regulatory subunits (CnB) (18, 19),and the CnA subunit contains the catalytic domain and three reg-ulatory domains, including the CnB-binding, calmodulin-bind-

Received 1 February 2016 Accepted 28 March 2016

Accepted manuscript posted online 1 April 2016

Citation Wang S, Liu X, Qian H, Zhang S, Lu L. 2016. Calcineurin and calciumchannel CchA coordinate the salt stress response by regulating cytoplasmic Ca2�

homeostasis in Aspergillus nidulans. Appl Environ Microbiol 82:3420 –3430.doi:10.1128/AEM.00330-16.

Editor: M. J. Pettinari, University of Buenos Aires

Address correspondence to Shizhu Zhang, szzhang@njnu.edu.cn, orLing Lu, linglu@njnu.edu.cn.

S.W. and X.L. contributed equally to this article.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00330-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

3420 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ing, and autoinhibitory domains, all located toward the carboxyterminus (20–22). Calcineurin signaling is vital to the regulationof intracellular cation homeostasis, which is crucial for the properfunction of living cells (23, 24). [Ca2�]c is stringently controlledby complex interactions between calcineurin and different Ca2�

channels, Ca2� pumps, and other Ca2� transporters (16). In aprevious study, we implicated the calcium channel CchA and itsregulatory subunit MidA, which form a high-affinity calcium in-flux system (HACS), in facilitating calcium influx in low-calcium-concentration environments and in stress responses in Aspergillusnidulans (25). Studies in fission yeast have shown that the additionof extracellular CaCl2 induced an increase in [Ca2�]c, and thisincreased Ca2� activated calcineurin, which subsequently inhib-ited the Cch1-Mid1 calcium channel through dephosphorylationto prevent calcium toxicity (26). Studies in fungi have revealedthat calcineurin has essential roles in fungal morphogenesis, cellcycle progression, cell wall integrity, and antifungal drug activity(8, 17, 27, 28). Calcineurin also plays a crucial role in osmoticadaptation. In budding yeast, osmotic pretreatment of cells en-hances salt tolerance and growth in highly saline environments.However, the addition of EGTA to the osmotic pretreatment me-dium or deletion of cch1 reduced cellular NaCl adaptation (3).Further studies have indicated that hyperosmotic stress induces atransient increase in [Ca2�]c through Cch1p-Mid1p (26, 29).However, exactly how calcineurin and CchA coordinate the[Ca2�]c and the response to salt stress in fungi is not well under-stood.

Aspergillus species are among the most abundant fungi world-wide. Among them, Aspergillus nidulans has been used as a modelto study many fungal biological processes. Our previous studieshave shown that deletion of cchA in A. nidulans could restorehyphal growth defects caused by the calcineurin inhibitor FK506under salt stress (25). In this study, the roles of calcineurin andCchA in salt stress adaption were investigated by generating cal-cineurin and cchA single and double deletion strains, studyingcalcium homeostasis under different conditions, and analyzingthe transcriptional profiles of genes responsible for the salt stressresponse and calcium homeostasis. Our results reveal new insightsinto the complex relationship between calcineurin and CchA inthe regulation of cell survival processes in fungi.

MATERIALS AND METHODSStrains, media, culture conditions, and transformation. A list of the A.nidulans strains used in this study is given in Table 1. TN02A7, a strainwith deletion of a gene required for nonhomologous end joining in dou-ble-strand break repair (30), was used in all transformation experimentsas a reference strain. The following media were used: YAG (2% glucose,0.5% yeast extract, with trace elements as needed), YUU (YAG supple-mented with 5 mM uridine and 10 mM uracil), YAGK (YAG with 0.6 MKCl); YUUK (YUU with 0.6 M KCl), MMPDRUU (minimal mediumwith 2% glucose, nitrate salts, trace elements, 0.5 mg/liter pyridoxine, 2.5mg/liter riboflavin, 5 mM uridine, 10 mM uracil, pH 6.5, with trace ele-ments and nitrate salts added to the medium as described previously [31,32]), and MMPGRUU (same as MMPDRUU, except with 2% glucosereplaced with 1% vol/vol glycerol). For solid media, 2% agar was added.Growth conditions and genetic crosses were performed as previously de-scribed (33). Standard DNA transformation procedures were done ac-cording to a method described for A. nidulans (34, 35). For growth rateanalysis, 1 � 105 spores were cultured on either MMPDRUU or MMP-DRUU with 800 mM NaCl, and the change in colony diameter was mon-itored over 48 h. To quantify the production of conidia, 1 � 105 conidia ofrelevant strains were spotted on MMPDRUU. The inoculations were cul-

tured for 2.5 days at 37°C, and then the number of conidia was counted.The determination of total biomass was performed by inoculating a totalnumber of 1 � 108 conidia into 100 ml of MMPDRUU liquid medium.After 18 h of growth at 37°C with shaking at 220 rpm, each sample wasdried before a final dry weight was recorded. All experiments were per-formed in triplicate.

Genetic mutant strain construction. The Aspergillus fumigatus pyrGgene, used as a selectable nutritional marker for transformation, was am-plified from the plasmid pXDRFP4 using the primers pyrG5= and pyrG3=.To generate constructs for the �cnaB strain WSA08, the double-joint PCRmethod was used as previously described (36). In brief, a 1,093-bp 5=-flank DNA fragment and a 1,089-bp 3=-flank DNA fragment were ampli-fied using the primers cnaB-p1 and cnaB-p3 and cnaB-p4 and cnaB-p6,respectively, from genomic DNA (gDNA) of A. nidulans reference strainTN02A7. The linearized DNA fragment, including a 5= flank of cnaB,pyrG, and a 3= flank of cnaB, was amplified with primers cnaB-p2 andcnaB-p5. The final fusion PCR product was purified and transformed intoTN02A7. A diagnostic PCR assay was performed to detect cnaB replacedby A. fumigatus pyrG (AfpyrG) at the original cnaB locus using primerscnaB-p1 and Diag-pyrG. The same strategy was used to construct the yvcAdeletion strain ZSA01. The primers for the genetic mutant strain con-struction are listed in Table 2.

To construct the �cnaA cchAre conditional mutant strain, the �cnaAstrain CNA1 (37) was crossed with the cchAre strain HHA02 (7), resultingin �cnaA cchAre strain CJA01. In the conditional mutant strain CJA01,cchA was under the control of alc(p), which was repressed (“re” in“cchAre”) by glucose on MMPDRUU or not repressed by glycerol onMMPGRUU (25). To construct the calcineurin and cchA double deletionstrain, the �cnaA strain CNA1 and the �cnaB strain WSA08 were crossedwith the �cchA strain WSA05 (25), respectively, resulting in the �cnaA�cchA strain LXA04 and �cnaB �cchA strain LXA05. To construct theyvcA and cnaA double deletion strain, the �yvcA strain ZSA01 was crossedwith the �cnaA strain CNA1. All progeny were screened according to astandard protocol (38).

For the mutants expressing the codon-optimized aequorin, the plas-mid pAEQS1-15 containing codon-optimized aequorin (39) and the plas-mid pQa-pyroA or pJH37 containing selective marker genes pyroA orriboB, respectively, were cotransformed into the indicated mutants.Transformants were screened for aequorin expression using methods de-scribed previously (34, 35), and a high-aequorin-expression strain wasselected after homokaryon purification.

TABLE 1 List of the A. nidulans strains used in this study

Strain Genotypea

Referenceor source

TN02A7 pyrG89 riboB2 pyroA4 nkuA::argB2 veA1 30CNA1 pyrG89 �cnaA::pyroA pyroA4 wA3 37CJA01 pyrG89 �cnaA::pyroA pyroA4

alcA(p)::YFP-CchA::pyr-47

HHA02 pyrG89 riboB2 pyroA4 nkuA::argB2alcA(p)::YFP-CchA::pyr-4 veA1

7

WSA05 pyrG89 riboB2 pyroA4 nkuA::argB2�cchA::pyrG veA1

25

WSA08 pyrG89 �cnaB::pyrG riboB2 pyroA4nkuA::argB2 veA1

This study

LXA04 pyrG89 riboB2 �cnaA::pyroA pyroA4nkuA::argB2 �cchA::pyrG veA1

This study

LXA05 pyrG89 �cnaB::pyrG nkuA::argB2�cchA::pyrG veA1

This study

ZHA01 pyrG89 riboB2 pyroA4 nkuA::argB2�yvcA::pyrG veA1

This study

ZSA01 pyrG89 riboB2 �cnaA::pyroA pyroA4nkuA::argB2 �yvcA::pyrG veA1

This study

a YFP, yellow fluorescent protein.

Calcium Homeostasis with Salt Stress

June 2016 Volume 82 Number 11 aem.asm.org 3421Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Plate assays. Unless indicated elsewhere, MMPDRUU or MMP-GRUU, in which pH was adjusted to 6.5, was used as the plate assay. Foreach test, at least three replicates were prepared for each strain. The influ-ence of osmotic stress or ionic stress was tested by adding 800 mM NaCl,600 mM KCl, or 1 M sorbitol into MMPDRUU or MMPGRUU, respec-tively. To assess the role of the absence of extracellular calcium under saltstress, MMPDRUU was supplemented with 800 mM NaCl and 3 mMEGTA. Two microliters of 1 � 107/ml conidia from the indicated strainswas spotted onto relevant media and cultured at 37°C for 2.5 days. For thecell wall integrity test, aliquots of 2 �l from a series of 10-fold dilutionsderived from a starting suspension of 108/ml conidia as indicated werespotted onto solid MMPDRUU supplemented with 30 �g/ml calcofluorwhite or 100 �g/ml Congo red after sterile filtration as indicated in thetext. After being cultured for 2.5 days at 37°C, the colonies were observedand imaged unless stated otherwise.

Real-time monitoring of the cytoplasmic Ca2� level. The cytoplas-mic Ca2� concentrations were determined using a previously describedmethod with minor modifications (39). In brief, the vector pAEQS1-15harboring the codon-optimized aequorin gene was transformed into thereference strain and relevant mutant strains, respectively. A total of 1 �106 spores were cultured on either MMPDRUU or MMPDRUU with 800mM NaCl in a 96-well microtiter plate (Thermo Fischer, United King-dom) and then incubated at 37°C for 18 h. The medium was then re-moved, and the mycelia were rinsed twice with PGM: 20 mM PIPES [pi-

perazine-N,N=-bis(2-ethanesulfonic acid)] (pH 6.7), 50 mM glucose, and1 mM MgCl2. Aequorin was reconstituted by incubation of mycelia in 100�l PGM containing 2.5 �M coelenterazine for 4 h at 4°C in the dark. Afterreconstitution, mycelia were washed two times with 100 �l PGM andallowed to recover to room temperature for 1 h (40). Following recovery,luminescence was measured for 180 s after 15 mM CaCl2 addition within20 s. At the end of each experiment, the active aequorin was completelydischarged by permeabilizing the cells with 20% (vol/vol) ethanol in thepresence of excess Ca2� (3 M CaCl2). Luminescence was measured withan LB 96P Microlumat luminometer (Berthold Technologies, Germany).The data from relative light unit (RLU) values detected were convertedinto [Ca2�]c by using the empirically derived calibration formula pCa �0.332588 (�log k) � 5.5593, where k is luminescence (RLU) s�1/totalluminescence (RLU) (39).

Microscopic observation and image processing. For hyphal growthmicroscopic observations, conidia of the relevant strains were inoculatedonto precleaned glass slides overlaid with MMPDRUU or MMPDRUUamended with 800 mM NaCl. Strains were grown on slides at 37°C for 16h, and hyphae dispersing at the edge of colony of each strain were observedunder a microscope. The branching frequency was measured by assessingthe percentage of subapical hyphal compartments that had one or morebranches or lateral buds (41). More than 400 individual hyphal filamentsper strain were measured for analysis. To assess the influence of extracel-lular calcium on fungal growth, strains were inoculated onto precleaned

TABLE 2 List of primers used in this study

Primer DNA sequence (5=¡3=)cnaB-p1 AAGACCGGAGCACTGCCTACcnaB-p2 TGCTTTAATCGCACCGTCTCcnaB-p3 CTCTAGATGCATGCTCGAGCTGCGGCGTTGTTCGGTTCATTAcnaB-p4 CAGTGCCTCCTCTCAGACAGCGTAAATGGGATACCCTACACcnaB-p5 GGATCAGTCATTAGTTCGCCTcnaB-p6 GTTTTGATTTCGAGCAGTACApyrG5= GCTCGAGCATGCATCTAGAGpyrG3= CTGTCTGAGAGGAGGCACTGcnaB-self GCAACCCGTACAAACAGAGcnaB-post TTAGCATAAACACCAGCACCDiag-pyrG TAGGGACCGAGACCTGTATCyvcA-p1 AGGTCGTTATTGTGCTCCGTGyvcA-p2 TTATAGGAACCCCGATGTTTGGyvcA-p3 GGTGAAGAGCATTGTTTGAGGCTGGATGACTGCTGGATGAAGGyvcA-p4 CATCAGTGCCTCCTCTCAGACAGCGGAAATGCCACTGACGAATAyvcA-p5 TTGACTCCACGCCATCCAACTyvcA-p6 CTCATCGTCACCTGAACAAGACAGAyvcA-self CTTGCTCTGCGGCTGAAATACyvcA-post TCAACTGCTCGCTCAATGACGCpyrGR CATCGTGGGAATGGAGGGTTATactin-RT-up TCTTCCAGCCCAGCGTTCTactin-RT-down GGGCGGTGATTTCCTTCTGenaA-RT-up TGGTGAGCCAACCGACATAGCenaA-RT-down ACTCGCTCCACGGCACCTTTCpmcA-RT-up GGGAGTCGTGGCTGGCAGTATpmcA-RT-down ACGGAATCAGGTCTGGGTTTTpmrA-RT-up GTCTGCAAACCTCCCTCACCCpmrA-RT-down CAAACCCAACCGTAACCACAAyvcA-RT-up TGCCGTTCTGCCTACTCGyvcA-RT-down GCTTTCTTCGCCGTCCTGvcxA-RT-up TCTGGGTCAGGCTTTGGGvcxA-RT-down CAGGACGAGAAGGATGTTGGnhaA-RT-up AGGCGGACAAACGAGAACGnhaA-RT-down TCATCGCTGCCACTGCTTAtrkA-RT-up AACTTAGGGCTTACCTTGACGCtrkA-RT-down TCCAGATCACAAGTCGCAGAAA

Wang et al.

3422 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

glass coverslips within a petri dish overlaid with liquid MMPDRUU in thepresence or absence of 15 mM CaCl2, 15 mM CaCl2 plus 15% polyethyl-ene glycol (PEG), or 15 mM CaCl2 plus 1 M sorbitol and cultured for 12 hat 37°C. Differential interference contrast (DIC) images of the cells werecollected with a Zeiss Axio imager A1 microscope (Zeiss, Jena, Germany).These images were then collected and analyzed by a SensiCamQE cooleddigital camera system (Cooke Corporation, Germany), and the resultswere assembled in Adobe Photoshop (Adobe, San Jose, CA).

RNA isolation and quantitative RT-PCR assays. For RNA isolation,briefly, a total of 1 � 108 conidia of the relevant strains were incubated in100 ml MMPDRUU at 37°C with shaking at 220 rpm for 18 h, and then thecultures underwent an additional incubation supplemented with or with-out NaCl (800 mM final concentration) at 37°C for 30 min. The sampleswere harvested by filtration and ground to a fine powder in the presence ofliquid nitrogen. Total RNA was isolated using TRIzol (Invitrogen catalogno. 15596-025) following the manufacturer’s instruction. Reverse tran-scription-PCR (RT-PCR) was carried out using HiScript Q RT SuperMix(Vazyme catalog no. R123-01), and then cDNA was used for the real-timeanalysis, which was performed using an ABI one-step fast thermocycler(Applied Biosystems), and the reaction products were detected with SYBRPremix Ex Taq (TaKaRa catalog no. DRR041A). Primer information isprovided in Table 2. Independent assays were performed with three bio-logical replicates, and transcript levels were calculated by the comparativethreshold cycle (�CT) method and normalized against the expression ofactin mRNA level in A. nidulans. The 2���CT method was used to deter-mine the change in expression (42).

RESULTSHyphal growth defects caused by the loss of calcineurin are sup-pressed by the absence of cchA under salt stress conditions. Cal-cineurin plays a central role in the regulation of fungal morpho-genesis, cell wall integrity, cation homeostasis, and stressadaptation (43–45). Interestingly, our previously published datashowed that the absence of the high-affinity calcium channelsCchA and MidA could suppress hyphal growth defects caused bythe addition of the calcineurin inhibitor FK506 under salt stressconditions (25). To gain insights into the relevance of calcineurinand the calcium channel CchA in the regulation of fungal hyphalgrowth under salt stress and confirm the accuracy of our previousfindings, both the �cnaA cchAre and �cnaA �cchA strains weregenerated. The relevant strains were analyzed for hyphal growthon MMPDRUU in the presence or absence of salt stress (800 mMNaCl or 600 mM KCl) and osmotic stress (1 M sorbitol). Consis-tent with our previous report, the �cnaA strain displayed compactcolony morphology with severe defects on hyphal radial growth,which amounted to a decrease to 29.2% � 1.4% compared withthe reference strain (Fig. 1A and B). Furthermore, the percentageof subapical hyphal compartments that had one or more brancheswas measured by microscopic observation. As shown in Fig. 1C,the reference strain showed organized, parallel, and defined hy-phal filaments under both normal and salt stress conditions, whileboth the �cnaA and the �cnaA cchAre strains showed dramaticallyincreased hyphal branching frequencies of 93.33% � 1.53% and91.8% � 1.31%, respectively, in comparison to 7.53% � 0.5% inthe reference strain on MMPDRUU (Fig. 1D). Moreover, thepresence of NaCl, KCl, or sorbitol did not restore the hyphalgrowth defects in the �cnaA strain. However, in contrast to the�cnaA strain, the presence of NaCl restored the hyphal growthdefects in the �cnaA cchAre and �cnaA �cchA strains on MMP-DRUU. As shown in Fig. 1B and D, the hyphal radial growth in the�cnaA cchAre strain increased from 32.7% on MMPDRUU aloneto 78.1% on MMPDRUU with 800 mM NaCl compared to the

reference strain, and the hyphal branching frequency decreasedfrom 91.8% on MMPDRUU alone to 3.97% on MMPDRUU with800 mM NaCl. What needs illustration is that the �cnaA cchAre

strain showed an identical phenotype to the �cnaA strain underthe nonrepression medium MMPGRUU, with which the expres-sion of cchA was turned on by glycerol (see Fig. S1 in the supple-mental material).

With the aim of understanding the functions of cnaB in theregulation of hyphal growth in A. nidulans, the cnaB deletionstrain WSA08 was generated (see Fig. S2 in the supplemental ma-terial). In a similar fashion to the �cnaA strain, the �cnaB straindisplayed small densely packed colonies with severe defects in hy-phal radial growth and increased hyphal branching. The conidialquantification assay for the whole colony showed that loss of ei-ther cnaA or cnaB caused a sharp reduction in conidial produc-tion. The percentages of conidial production were 1.44% � 0.17%and 0.06% � 0.01% in the �cnaA and �cnaB strains, respectively,compared with that of the reference strain (100%). Interestingly,when either the �cnaA or �cnaB strain was exposed to salt stress,the compact colony turned green compared to the control. Theconidia produced by the �cnaA and �cnaB strains under salt stresswere approximately increased 13-fold and 100-fold, respectively,compared to those on MMPDRUU alone, suggesting that saltstress was able to induce conidiation in calcineurin-null strains.

Since our aforementioned data verified that the deletion ofcchA could suppress hyphal growth defects in the �cnaA strainunder salt stress conditions, this prompted us to explore whetherdeletion of cchA could restore the hyphal growth defect in the�cnaB strain under salt stress. As expected, the hyphal growthdefects in the �cnaB �cchA strain were reversed by growth undersalt stress, which was indistinguishable from the phenomenonidentified in the �cnaA cchAre strain on MMPDRUU (Fig. 1A andC). Since cchA is thought to encode an alpha-subunit of the high-affinity Ca2� channel, the most likely reason for the lack of cchA-based suppression of hyphal defects in the �cnaA strain would bedue to reduced calcium uptake via CchA. To test this hypothesis,we inoculated the relevant strains on MMPDRUU solid mediumsupplemented with the Ca2� chelator EGTA or EGTA plus NaCl.As expected, the presence of EGTA under salt stress alleviated thegrowth defects of the �cnaA or �cnaB strains in comparison withthe control (see Fig. S3 in the supplemental material). Taken to-gether, the above results indicated the loss of either cnaA or cnaBresulted in identical hyphal growth defects. Moreover, the absenceof cchA suppressed the hyphal growth defects caused by the loss ofeither cnaA or cnaB under salt stress.

Hypersensitivity to extracellular calcium in calcineurin-nullmutants is suppressed by cchA deletion. To address how cal-cineurin and CchA coordinately regulate biological processes inthe presence of exogenous Ca2�, the phenotypic response to cal-cium tolerance was determined. As shown in Fig. 2A, when strainswere exposed to 15 mM CaCl2, unlike the reference strain, whichcontained fully extended hyphae, the �cnaA strain exhibiteddrumstick-shaped hyphal tips, in which the protoplasm was bulg-ing out. However, in comparison, the �cnaA cchAre and �cnaB�cchA strains both displayed increased-calcium-tolerance pheno-types compared to the �cnaA or �cnaB strains, resulting in rela-tively long hyphal growth under the same conditions (Fig. 2A; seeFig. S4 in the supplemental material). Considering that the hyper-sensitivity to extracellular calcium in the cnaA- and cnaB-null mu-tants may be associated with cell wall defects, we tested whether

Calcium Homeostasis with Salt Stress

June 2016 Volume 82 Number 11 aem.asm.org 3423Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

osmotic stabilizers could alleviate this growth defect in the pres-ence of Ca2�. As expected, the hyphal growth of both the �cnaAand �cnaA cchAre strains was improved by adding PEG or sorbitolunder the exogenous calcium condition. The same recovery phe-notype occurred in the �cnaB and �cnaB �cchA strains (Fig. 2A).Consistently, the biomasses of the �cnaA and �cnaB strains werereduced by 80% � 4% and 90% � 1.6%, respectively, when grownwith 15 mM CaCl2 compared with growth in MMPDRUU alone.However, the biomasses of the �cnaA cchAre and �cnaB �cchAstrains decreased by only 50% � 5% and 35% � 4%, respectively,in the same calcium-enriched environment (Fig. 2B). Collectively,the above results suggested that calcineurin inhibition most likelyperturbed cell wall synthesis and the absence of CchA could en-hance the tolerance of the calcineurin-null strain to calcium tox-icity.

The loss of CchA increases the resistance to cell-wall-damag-ing agents in calcineurin-null mutants. To detect whether cal-cineurin and CchA cooperatively contribute to the modulation ofcell wall biosynthesis, the growth of the relevant strains in thepresence of the cell-wall-damaging stressors calcofluor white and

Congo red was tested. In comparison to the �cnaA and �cnaBstrains, the �cnaA cchAre and �cnaB �cchA strains were moder-ately sensitive to calcofluor white and Congo red. To more clearlydefine the subtle growth differences between the relevant strains,different inocula of conidia were spotted onto MMPDRUU sup-plemented with calcofluor white and Congo red. As shown in Fig.3, the �cnaA cchAre and �cnaB �cchA strains grew faster than theircorresponding single deletion strains in response to those wall-damaging stressors. These data suggested that the �cnaA cchAre

and �cnaB �cchA strains were more resistant to cell-wall-damag-ing agents than the �cnaA and �cnaB strains.

Calcineurin negatively regulates CchA upon calcium uptakein response to extracellular calcium. Our data shown above havedemonstrated that the absence of cchA in calcineurin deletionstrains enhances tolerance to extracellular calcium. To further ex-plore the roles of calcineurin and CchA in the regulation of[Ca2�]c, real-time monitoring of [Ca2�]c in living hyphal cells wascarried out. As shown in Fig. 4, upon addition of 15 mM CaCl2, thelevel of [Ca2�]c increased immediately and reached a peak level inall of the tested strains. As expected, deletion of cchA caused a

FIG 1 The hyphal growth defects of the �cnaA or �cnaB strains could be suppressed by the dysfunction of CchA under salt stress. (A) Colony morphology ofthe �cnaA, �cnaA cchAre, �cnaB, and �cnaB �cchA strains and the reference strain. The conidia were spotted on solid MMPDRUU and MMPDRUU supple-mented with 800 mM NaCl, 600 mM KCl, or 1 M sorbitol, respectively, at 37°C for 2.5 days. (B) Graphic representation of radial growth rates of the �cnaA and�cnaA cchAre strains and the reference strain. The values are means � standard deviations (SD) from three independent experiments. (C) Differential interfer-ence contrast images of hyphae grown on MMPDRUU in the presence or absence of salt stress at 37°C for 16 h. Bar, 10 �m. (D) Analysis of branching frequenciesin hyphal filaments of the �cnaA and �cnaA cchAre strains and the reference strain. The values are means � SD from three independent experiments.

Wang et al.

3424 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

reduction of 21.9% in transient [Ca2�]c compared with that of thereference strain (0.66 � 0.17 �M for the reference strain versus0.51 � 0.09 �M for the �cchA strain). In contrast, the resultingtransient [Ca2�]c was increased approximately 5-fold in the�cnaA strain compared with that in the reference strain (0.66 �0.17 �M for the reference strain versus 3.06 � 0.18 �M for the�cnaA strain). This suggests that the deletion of cnaA leads tocalcium hyperaccumulation in the presence of extracellular cal-cium, confirming the important function of calcineurin as a keyregulator of cellular calcium homeostasis. However, the deletionof cchA abolished the abnormal calcium hyperaccumulation in the

�cnaA strain. Collectively, the above data show that calcineurinnegatively regulates CchA upon calcium uptake, and the [Ca2�]c

increase in the �cnaA strain is mediated by the CchA channel inresponse to external calcium.

CnaA and CchA act synergistically to coordinate calcium in-flux in salt-stress-pretreated cells. To gain further insights intothe roles of calcineurin and CchA in the regulation of calciumhomeostasis under salt stress, the [Ca2�]c levels were monitoredafter salt stress pretreatment. As described in Materials and Meth-ods, the spores of the TN02A7, �cnaA, �cchA, and �cnaA cchAre

strains were first cultured on MMPDRUU supplemented with 800

FIG 2 Calcium tolerance assay. (A) Phenotypic comparison of the �cnaA and �cnaA cchAre strains and the reference strain cultured on liquid medium in thepresence or absence of 15 mM CaCl2 or 15 mM CaCl2 plus 15% PEG or 1 M sorbitol at 37°C for 12 h. Bars, 10 �m. (B) Biomass assay of the indicated strains. Theerror bars indicate the standard deviations of results from three independent replicates. Significance was set at P 0.05 (*) and P 0.01 (**) between calciumpretreatment and no calcium pretreatment.

FIG 3 The loss of CchA increases the resistance to cell-wall-damaging agents in calcineurin-null mutants. A series of 2-�l 10-fold dilutions derived from astarting suspension of 1 � 108/ml conidia as indicated were spotted onto solid MMPDRUU supplemented with 40 �g/ml calcofluor white and 100 �g/ml Congored, respectively. All plates were incubated at 37°C for 2.5 days.

Calcium Homeostasis with Salt Stress

June 2016 Volume 82 Number 11 aem.asm.org 3425Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

mM NaCl for 18 h at 37°C, and then the [Ca2�]c was measured for3 min after the addition of 15 mM CaCl2. Interestingly, comparedto cells cultured normally (Fig. 4), the NaCl-pretreated cells hadan approximately 5-fold increase in transient [Ca2�]c at the peakof the burst in the reference strain (3.26 � 0.03 �M for salt-stress-pretreated cells versus 0.66 � 0.17 �M for normally cultured cells)in response to the addition of calcium. Not surprisingly, transient[Ca2�]c in the cchA deletion strain decreased by 24.2% comparedto the reference strain, indicating that increased transient [Ca2�]c

under salt stress is partly mediated by the CchA channel. Unex-pectedly, the cnaA deletion strain also exhibited decreased tran-sient [Ca2�]c amplitudes under the same stimulating conditions.Therefore, the loss of either cnaA or cchA in salt-stress-pretreatedcells was able to decrease the transient [Ca2�]c, suggesting thatcalcineurin and CchA were required to modulate cellular calciumlevels and synergistically coordinate calcium influx under saltstress. However, the deficiency of cchA in the cnaA deletion back-ground unexpectedly switched the transient [Ca2�]c amplitude to3.0 � 0.16 �M, a nearly normal level compared with the referencestrain when pretreated with salt stress (Fig. 5). These results indi-cated that the restoration of calcium homeostasis in the �cnaA

cchAre strain under salt stress is probably due to a bypass of thecalcineurin-CchA pathway.

Comparison of transcriptional responses of salt-stress-in-duced genes and Ca2� signaling-related genes. To validate theregulatory roles of calcineurin and CchA in the maintenance of[Ca2�]c homeostasis under salt stress, the expression levels ofgenes encoding calcium pumps, exchangers, and transporterswere measured by real-time qPCR in relevant strains either pre-treated with 800 mM NaCl or not pretreated. As shown in Fig. 6A,vcxA, a vacuolar Ca2�/H� exchanger responsible for Ca2� uptakeinto vacuoles in vivo (46, 47) was upregulated approximately 3-and 6-fold in the �cnaA and �cnaA cchAre strains, respectively,when these strains were treated with 800 mM NaCl, in comparisonto results in the absence of salt stress. Furthermore, there were nodetectable changes in the reference strain pretreated with saltstress. This result suggested that more calcium may be taken upinto vacuoles in the �cnaA strain and �cnaA cchAre strain than inthe reference strain under salt stress. Meanwhile, expression ofyvcA, a transient receptor potential channel (TRPC) family Ca2�

channel gene that mediates Ca2� release from vacuoles into thecytosol (48), was increased 5-fold in both the reference strain and

FIG 4 Real-time monitoring of [Ca2�]c level in response to extracellular calcium. The bar graph shows the peak [Ca2�]c of the indicated strains after treatmentwith 15 mM CaCl2. *, P 0.05; **, P 0.01. The basal [Ca2�]c level is indicated by the horizontal line at the bottom (approximately 0.09 �M). In eachexperiment, values represent averages from six wells, and error bars represent SD (n � 6).

FIG 5 Real-time monitoring of [Ca2�]c in salt-stress-pretreated cells. The bar graph shows the peak [Ca2�]c of the indicated strains after treatment with 15 mMCaCl2. *, P 0.05; **, P 0.01. The basal [Ca2�]c level is indicated by the horizontal line at the bottom (approximately 0.09 �M). In each experiment, valuesrepresent averages from six wells, and error bars represent SD (n � 6).

Wang et al.

3426 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

the �cnaA strain when stimulated by salt stress, while no changeswere observed in the �cnaA cchAre strain. This suggested thatmore calcium was probably released from vacuoles into the cyto-sol in the reference strain and the �cnaA strain compared with the�cnaA cchAre strain under salt stress. Taken together, these resultsindicated that vacuolar Ca2� exchangers/channels are not likely tobe involved in the increased [Ca2�]c in the �cnaA cchAre strainunder salt stress. Additionally, there were no significant differ-ences (3-fold) in the mRNA levels of pmcA (plasma membranecalcium-ATPase) and pmrA (plasma membrane ATPase related)between the �cnaA and �cnaA cchAre strains.

Furthermore, the expression of genes involved in ion transportwas determined. As shown in Fig. 6B, enaA, a putative P-typeATPase sodium pump, was upregulated 70-fold when the refer-ence strain was treated with 800 mM NaCl compared to growth inMMPDRUU alone. However, no obvious increase was observedin the �cnaA strain under the same treatment conditions, consis-tent with reports that the expression of the enaA gene is mediatedby calcineurin (29, 49). Most interestingly, the loss of cchA in the�cnaA strain dramatically restored the expression of enaA undersalt stress. Expression of enaA was upregulated approximately 31-

fold in the �cnaA cchAre strain after salt stress treatment comparedwith the non-salt-treated strain. However, the expression of twoother sodium transporter genes, nhnA and trkA (50–52), showedno significant differences among the tested strains when treatedwith 800 mM NaCl. These results suggested that increased expres-sion of enaA may bypass the requirement for calcineurin in the�cnaA cchAre strain under salt stress.

YvcA compensates for calcineurin-CchA in fungal salt stressadaption. In budding yeast, hypertonic shock induces the releaseof calcium from internal stores through Yvc1p (53). To furtherexplore the roles of YvcA in the calcineurin-CchA pathway infungal salt stress adaption, we constructed the �yvcA and �yvcA�cnaA strains. As shown in Fig. 7, the deletion of yvcA does notaffect the hyphal radial growth and conidiation of strains grownon MMPDRUU in the presence or absence of the Ca2� chelatorEGTA or EGTA plus NaCl. As mentioned in Fig. S3 in the supple-mental material, the addition of EGTA to the �cnaA strain cultureremarkably alleviated the growth defects of the �cnaA strain un-der salt stress, which mimics the phenotype of the �cnaA �cchAstrain under salt stress. However, the addition of EGTA was un-able to suppress the growth defects of the �yvcA �cnaA strainunder salt stress. These results indicated that YvcA compensatesfor calcineurin-CchA in fungal salt stress adaption.

DISCUSSION

Calcium signaling has been implicated in a broad spectrum ofdevelopmental processes in a variety of biological systems. Cal-cineurin, as the central regulator of calcium homeostasis, has beenshown to play a role in morphogenesis and stress response in bothyeasts and filamentous fungi (17, 44, 54, 55). Moreover, it has beenshown that the calcium channel MidA-CchA complex is involvedin regulating hyphal polarity and salt stress adaption (25). How-ever, exactly how MidA-CchA and calcineurin coordinate the reg-ulation of morphogenesis and the response to salt stress remainsto be fully elucidated. In A. fumigatus, the presence of sorbitolimproved the growth of the �cnaA strain but not the �cnaB strain,

FIG 6 Expression analysis of Ca2�-signaling-related and salt-stress-inducedgenes in response to salt stress by quantitative PCR. (A) Fold changes in mRNAlevels, including vcxA, yvcA, pmrA, and pmcA, after incubation with MMP-DRUU with addition of 800 mM NaCl compared to results with MMPDRUUalone using real-time RT-PCR. (B) Fold changes in mRNA levels, includingenaA, nhaA, and trkA, after incubation with MMPDRUU with addition of 800mM NaCl compared to results with MMPDRUU alone using real-time RT-PCR. Data representing the indicated strains’ mRNA levels from salt stresspretreatment were normalized to the non-salt-pretreatment condition. Theerror bars indicate the standard deviations from three independent replicates.

FIG 7 Colony morphologies of the �yvcA, �cnaA, and �cnaA �yvcA strainsgrown on MMPDRUU in the presence or absence of 800 mM NaCl or 800 mMNaCl plus 3 mM EGTA at 37°C for 2.5 days.

Calcium Homeostasis with Salt Stress

June 2016 Volume 82 Number 11 aem.asm.org 3427Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

suggesting that CnaA and CnaB might play different roles in theregulation of cell wall biosynthesis (56). In contrast to the resultsfrom A. fumigatus, the addition of sorbitol could not alleviate thegrowth defects in either the �cnaA or �cnaB strain of A. nidulans.Furthermore, both the �cnaA and �cnaB strains were sensitive toexternal calcium, especially in liquid culture, where the proto-plasm was extruded from drumstick-shaped hyphal tips. More-over, the calcium toxicity phenotype could be alleviated by addingthe osmotic stabilizer PEG or sorbitol, suggesting that calcineurincontributes to cell wall organization. These data are consistentwith the function of calcineurin in cell wall biosynthesis, wherecalcineurin acts as a positive regulator of the expression of theFKS2 gene, which encodes a component of the �-1,3-glucan syn-thase complex necessary for cell wall integrity (56, 57).

Since the major roles of calcineurin and CchA are in calciumregulation, real-time monitoring of the [Ca2�]c in living hyphalcells exposed to external calcium was carried out in both normallycultured cells and salt-stress-pretreated cells. In normally culturedcells, the deletion of cnaA led to calcium overaccumulation in thepresence of external calcium in A. nidulans. Moreover, the abnor-mal increase in [Ca2�]c in the�cnaA strain was dependent on thecalcium CchA channel, and the deletion of cchA completely abol-ished the overaccumulation of [Ca2�]c seen in the �cnaA strain.However, fungi may use different mechanisms to adapt to saltstress. As shown in Fig. 5, significantly higher [Ca2�]c was trig-gered in salt-stress-pretreated cells than in normally cultured cellsin response to the same external calcium stimulus. It appears thatmore calcium was needed for fungi to better survive under saltstress than under the normal condition. Unexpectedly, the cnaAdeletion strain showed lower transient [Ca2�]c amplitude than thereference strain under the same salt-stress-pretreated culture con-ditions. It should be noted that the decrease in transient [Ca2�]c inthe �cnaA strain in the salt-stress-pretreated cells was completelyopposite to the results seen in normally cultured cells in responseto CaCl2 stimulation, where the �cnaA strain showed a 5-foldincrease in [Ca2�]c over the reference strain. Therefore, we con-clude that CnaA and CchA synergistically coordinate the calciuminflux in salt-stress-pretreated cells. Interestingly, the loss of bothcnaA and cchA unexpectedly switched [Ca2�]c amplitude to anearly normal level in salt-stress-pretreated cells, indicating thatthe [Ca2�]c was restored to a normal level, possibly by bypassingthe calcineurin-CchA pathway in the �cnaA cchAre strain undersalt stress.

The origin of increased [Ca2�]c upon salt stress in the �cnaAcchAre strain may be due to Ca2� release from internal stores. Inthe budding yeast Saccharomyces cerevisiae, hypertonic shock in-duces the release of calcium from internal stores through the vac-uolar membrane-localized transient receptor potential (TRP)channel-like protein, Yvc1p (53). However, in A. nidulans, yvcAwas increased up to 5-fold by salt stimulation in both the referencestrain and the �cnaA strain but not in the �cnaA cchAre strain.Also, vcxA, a vacuolar Ca2�/H� exchanger responsible for Ca2�

uptake into the vacuole (58), was upregulated approximately 3-and 6-fold in the �cnaA and �cnaA cchAre strains, respectively,but not in the reference strain. Thus, it seems that vacuoles maynot contribute to increased [Ca2�]c upon salt stress in the �cnaAcchAre strain of A. nidulans. However, it is probably not accurate toqualify the activities of calcium channels using transcriptional ex-pression. Therefore, to more fully characterize the relationshipamong YvcA, CchA and calcineurin in fungal salt stress adaption,

a �yvcA �cnaA strain was constructed. The results showed thatsalt stress was unable to suppress the hyphal growth defects in thepresence of EGTA in the �yvcA �cnaA strain, indicating that YvcAcompensates for calcineurin-CchA in fungal salt stress adaption.

To maintain a low intracellular sodium level, cells need to ex-trude excess sodium cations. The ENA system is the major deter-minant of sodium detoxification (29). The link between calcineu-rin signaling and ENA regulation has been reported previously(18, 59, 60). Calcineurin activation of ENA is mediated by thedephosphorylation of Crz1. Two Crz1 binding regions have beenidentified in the ENA1 promoter (29, 49). Consistent with previ-ous reports, enaA was significantly upregulated (70-fold) in thereference strain grown under salt stress compared with that grownin MMPDRUU alone. However, no obvious increase was ob-served in the absence of cnaA under the same treatment. Mostinterestingly, the expression of enaA was upregulated approxi-mately 31-fold in the �cnaA cchAre strain under the same condi-tions. Thus, the increased expression of enaA that occurred in the�cnaA cchAre strain may lead to hyphal growth remediation inresponse to salt stress. Considering the loss of cnaA and increased[Ca2�]c in the �cnaA cchAre strain under salt stress, it is possiblethat calcium-dependent upstream regulators of enaA other thancalcineurin exist. Collectively, the findings in this study provideinsights into the complex regulatory links between calcineurinand CchA. Calcineurin may negatively regulate or synergisticallycoordinate with CchA to maintain the cytoplasmic Ca2� homeo-stasis in response to different environments.

ACKNOWLEDGMENTS

We thank N. D. Read (University of Manchester) for kindly providingplasmid pAEQS1-15, G. H. Goldman (Universidade de São Paulo) for theA. nidulans cnaA deletion strain CNA1, H. M. Park (Chungnam NationalUniversity) for plasmid pQa-pyroA, and N. P. Keller (University of Wis-consin) for plasmid pJH37.

FUNDING INFORMATIONThis work, including the efforts of Sha Wang, was funded by NaturalScience Foundation of Technology Department of Huzhou (2014YZ01).This work, including the efforts of Sha Wang, was funded by NationalNatural Science Foundation of China (NSFC) (31400065). This work,including the efforts of Shizhu Zhang, was funded by National NaturalScience Foundation of China (NSFC) (31200057). This work, includingthe efforts of Ling Lu, was funded by National Natural Science Founda-tion of China (NSFC) (81330035 and 31370112).

REFERENCES1. Almeida RS, Loss O, Colabardini AC, Brown NA, Bignell E, Savoldi M,

Pantano S, Goldman MH, Arst HN, Jr, Goldman GH. 2013. Geneticbypass of Aspergillus nidulans crzA function in calcium homeostasis. G3(Bethesda) 3:1129 –1141. http://dx.doi.org/10.1534/g3.113.005983.

2. Garcia R, Rodriguez-Pena JM, Bermejo C, Nombela C, Arroyo J. 2009.The high osmotic response and cell wall integrity pathways cooperate toregulate transcriptional responses to zymolyase-induced cell wall stress inSaccharomyces cerevisiae. J Biol Chem 284:10901–10911. http://dx.doi.org/10.1074/jbc.M808693200.

3. Matsumoto TK, Ellsmore AJ, Cessna SG, Low PS, Pardo JM, BressanRA, Hasegawa PM. 2002. An osmotically induced cytosolic Ca2� tran-sient activates calcineurin signaling to mediate ion homeostasis and salttolerance of Saccharomyces cerevisiae. J Biol Chem 277:33075–33080. http://dx.doi.org/10.1074/jbc.M205037200.

4. Munro CA, Selvaggini S, de Bruijn I, Walker L, Lenardon MD, GerssenB, Milne S, Brown AJ, Gow NA. 2007. The PKC, HOG and Ca2� signal-ling pathways co-ordinately regulate chitin synthesis in Candida albicans.

Wang et al.

3428 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Mol Microbiol 63:1399 –1413. http://dx.doi.org/10.1111/j.1365-2958.2007.05588.x.

5. Spielvogel A, Findon H, Arst HN, Araujo-Bazan L, Hernandez-Ortiz P,Stahl U, Meyer V, Espeso EA. 2008. Two zinc finger transcription factors,CrzA and SltA, are involved in cation homeostasis and detoxification inAspergillus nidulans. Biochem J 414:419 – 429. http://dx.doi.org/10.1042/BJ20080344.

6. Sui Y, Wisniewski M, Droby S, Liu J. 2015. Responses of yeast biocontrolagents to environmental stress. Appl Environ Microbiol 81:2968 –2975.http://dx.doi.org/10.1128/AEM.04203-14.

7. Gao L, Song Y, Cao J, Wang S, Wei H, Jiang H, Lu L. 2011. Osmoticstabilizer-coupled suppression of NDR defects is dependent on the calci-um-calcineurin signaling cascade in Aspergillus nidulans. Cell Signal 23:1750 –1757. http://dx.doi.org/10.1016/j.cellsig.2011.06.009.

8. Thewes S. 2014. Calcineurin-Crz1 signaling in lower eukaryotes. Eu-karyot Cell 13:694 –705. http://dx.doi.org/10.1128/EC.00038-14.

9. Aramburu J, Heitman J, Crabtree GR. 2004. Calcineurin: a centralcontroller of signalling in eukaryotes. EMBO Rep 5:343–348. http://dx.doi.org/10.1038/sj.embor.7400133.

10. Reedy JL, Filler SG, Heitman J. 2010. Elucidating the Candida albicanscalcineurin signaling cascade controlling stress response and virulence.Fungal Genet Biol 47:107–116. http://dx.doi.org/10.1016/j.fgb.2009.09.002.

11. Cui J, Kaandorp JA, Sloot PM, Lloyd CM, Filatov MV. 2009. Calciumhomeostasis and signaling in yeast cells and cardiac myocytes. FEMS YeastRes 9:1137–1147. http://dx.doi.org/10.1111/j.1567-1364.2009.00552.x.

12. Bonilla M, Cunningham KW. 2002. Calcium release and influx in yeast:TRPC and VGCC rule another kingdom. Sci STKE 2002:pe17.

13. Cui J, Kaandorp JA. 2006. Mathematical modeling of calcium homeo-stasis in yeast cells. Cell Calcium 39:337–348. http://dx.doi.org/10.1016/j.ceca.2005.12.001.

14. Cyert MS, Philpott CC. 2013. Regulation of cation balance in Saccharo-myces cerevisiae. Genetics 193:677–713. http://dx.doi.org/10.1534/genetics.112.147207.

15. Hemenway CS, Heitman J. 1999. Calcineurin. Structure, function, andinhibition. Cell Biochem Biophys 30:115–151.

16. Cunningham KW. 2011. Acidic calcium stores of Saccharomyces cerevi-siae. Cell Calcium 50:129 –138. http://dx.doi.org/10.1016/j.ceca.2011.01.010.

17. Stie J, Fox D. 2008. Calcineurin regulation in fungi and beyond. EukaryotCell 7:177–186. http://dx.doi.org/10.1128/EC.00326-07.

18. Mendoza I, Rubio F, Rodriguez-Navarro A, Pardo JM. 1994. The pro-tein phosphatase calcineurin is essential for NaCl tolerance of Saccharo-myces cerevisiae. J Biol Chem 269:8792– 8796.

19. Rusnak F, Mertz P. 2000. Calcineurin: form and function. Physiol Rev80:1483–1521.

20. Ke H, Huai Q. 2003. Structures of calcineurin and its complexes withimmunophilins-immunosuppressants. Biochem Biophys Res Commun311:1095–1102. http://dx.doi.org/10.1016/S0006-291X(03)01537-7.

21. Griffith JP, Kim JL, Kim EE, Sintchak MD, Thomson JA, FitzgibbonMJ, Fleming MA, Caron PR, Hsiao K, Navia MA. 1995. X-ray structureof calcineurin inhibited by the immunophilin-immunosuppressantFKBP12-FK506 complex. Cell 82:507–522. http://dx.doi.org/10.1016/0092-8674(95)90439-5.

22. Kissinger CR, Parge HE, Knighton DR, Lewis CT, Pelletier LA, Temp-czyk A, Kalish VJ, Tucker KD, Showalter RE, Moomaw EW, GastinelLN, Habuka N, Chen X, Maldonado F, Barker JE, Bacquet R, Villa-franca JE. 1995. Crystal structures of human calcineurin and the humanFKBP12-FK506-calcineurin complex. Nature 378:641– 644. http://dx.doi.org/10.1038/378641a0.

23. Tanida I, Hasegawa A, Iida H, Ohya Y, Anraku Y. 1995. Cooperation ofcalcineurin and vacuolar H�-ATPase in intracellular Ca2� homeostasis ofyeast cells. J Biol Chem 270:10113–10119. http://dx.doi.org/10.1074/jbc.270.17.10113.

24. Juvvadi PR, Kuroki Y, Arioka M, Nakajima H, Kitamoto K. 2003.Functional analysis of the calcineurin-encoding gene cnaA from Aspergil-lus oryzae: evidence for its putative role in stress adaptation. Arch Micro-biol 179:416 – 422.

25. Wang S, Cao J, Liu X, Hu H, Shi J, Zhang S, Keller NP, Lu L. 2012.Putative calcium channels CchA and MidA play the important roles inconidiation, hyphal polarity and cell wall components in Aspergillusnidulans. PLoS One 7:e46564. http://dx.doi.org/10.1371/journal.pone.0046564.

26. Ma Y, Sugiura R, Koike A, Ebina H, Sio SO, Kuno T. 2011. Transientreceptor potential (TRP) and Cch1-Yam8 channels play key roles in theregulation of cytoplasmic Ca2� in fission yeast. PLoS One 6:e22421. http://dx.doi.org/10.1371/journal.pone.0022421.

27. Zhang T, Xu Q, Sun X, Li H. 2013. The calcineurin-responsive tran-scription factor Crz1 is required for conidation [sic], full virulence andDMI resistance in Penicillium digitatum. Microbiol Res 168:211–222. http://dx.doi.org/10.1016/j.micres.2012.11.006.

28. Liu S, Hou Y, Liu W, Lu C, Wang W, Sun S. 2015. Components of thecalcium-calcineurin signaling pathway in fungal cells and their potentialas antifungal targets. Eukaryot Cell 14:324 –334. http://dx.doi.org/10.1128/EC.00271-14.

29. Ruiz A, Arino J. 2007. Function and regulation of the Saccharomycescerevisiae ENA sodium ATPase system. Eukaryot Cell 6:2175–2183. http://dx.doi.org/10.1128/EC.00337-07.

30. Nayak T, Szewczyk E, Oakley CE, Osmani A, Ukil L, Murray SL, HynesMJ, Osmani SA, Oakley BR. 2006. A versatile and efficient gene-targetingsystem for Aspergillus nidulans. Genetics 172:1557–1566.

31. Kafer E. 1977. Meiotic and mitotic recombination in Aspergillus and itschromosomal aberrations. Adv Genet 19:33–131. http://dx.doi.org/10.1016/S0065-2660(08)60245-X.

32. Wang J, Hu H, Wang S, Shi J, Chen S, Wei H, Xu X, Lu L. 2009. Theimportant role of actinin-like protein (AcnA) in cytokinesis and apicaldominance of hyphal cells in Aspergillus nidulans. Microbiology 155:2714 –2725. http://dx.doi.org/10.1099/mic.0.029215-0.

33. Wang G, Lu L, Zhang CY, Singapuri A, Yuan S. 2006. Calmodulinconcentrates at the apex of growing hyphae and localizes to the Spitzen-korper in Aspergillus nidulans. Protoplasma 228:159 –166. http://dx.doi.org/10.1007/s00709-006-0181-3.

34. Osmani SA, Pu RT, Morris NR. 1988. Mitotic induction and mainte-nance by overexpression of a G2-specific gene that encodes a potentialprotein kinase. Cell 53:237–244. http://dx.doi.org/10.1016/0092-8674(88)90385-6.

35. May GS. 1989. The highly divergent beta-tubulins of Aspergillus nidulansare functionally interchangeable. J Cell Biol 109:2267–2274. http://dx.doi.org/10.1083/jcb.109.5.2267.

36. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y, ScazzocchioC. 2004. Double-joint PCR: a PCR-based molecular tool for gene manip-ulations in filamentous fungi. Fungal Genet Biol 41:973–981. http://dx.doi.org/10.1016/j.fgb.2004.08.001.

37. Soriani FM, Malavazi I, da Silva Ferreira ME, Savoldi M, Von ZeskaKress MR, de Souza Goldman MH, Loss O, Bignell E, Goldman GH.2008. Functional characterization of the Aspergillus fumigatus CRZ1 ho-mologue, CrzA. Mol Microbiol 67:1274 –1291. http://dx.doi.org/10.1111/j.1365-2958.2008.06122.x.

38. Todd RB, Davis MA, Hynes MJ. 2007. Genetic manipulation of Asper-gillus nidulans: meiotic progeny for genetic analysis and strain construc-tion. Nat Protoc 2:811– 821. http://dx.doi.org/10.1038/nprot.2007.112.

39. Nelson G, Kozlova-Zwinderman O, Collis AJ, Knight MR, Fincham JR,Stanger CP, Renwick A, Hessing JG, Punt PJ, van den Hondel CA, ReadND. 2004. Calcium measurement in living filamentous fungi expressingcodon-optimized aequorin. Mol Microbiol 52:1437–1450. http://dx.doi.org/10.1111/j.1365-2958.2004.04066.x.

40. Greene V, Cao H, Schanne FA, Bartelt DC. 2002. Oxidative stress-induced calcium signalling in Aspergillus nidulans. Cell Signal 14:437– 443.http://dx.doi.org/10.1016/S0898-6568(01)00266-2.

41. Veses V, Richards A, Gow NA. 2009. Vacuole inheritance regulates cellsize and branching frequency of Candida albicans hyphae. Mol Microbiol71:505–519. http://dx.doi.org/10.1111/j.1365-2958.2008.06545.x.

42. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2���CT method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

43. Fox DS, Cruz MC, Sia RA, Ke H, Cox GM, Cardenas ME, HeitmanJ. 2001. Calcineurin regulatory subunit is essential for virulence andmediates interactions with FKBP12-FK506 in Cryptococcus neoformans.Mol Microbiol 39:835– 849. http://dx.doi.org/10.1046/j.1365-2958.2001.02295.x.

44. Fox DS, Heitman J. 2002. Good fungi gone bad: the corruption of cal-cineurin. Bioessays 24:894 –903. http://dx.doi.org/10.1002/bies.10157.

45. Kraus PR, Heitman J. 2003. Coping with stress: calmodulin and calcineu-rin in model and pathogenic fungi. Biochem Biophys Res Commun 311:1151–1157. http://dx.doi.org/10.1016/S0006-291X(03)01528-6.

46. Cunningham KW, Fink GR. 1996. Calcineurin inhibits VCX1-dependent

Calcium Homeostasis with Salt Stress

June 2016 Volume 82 Number 11 aem.asm.org 3429Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from

H�/Ca2� exchange and induces Ca2� ATPases in Saccharomyces cerevi-siae. Mol Cell Biol 16:2226 –2237. http://dx.doi.org/10.1128/MCB.16.5.2226.

47. Pittman JK, Cheng NH, Shigaki T, Kunta M, Hirschi KD. 2004. Func-tional dependence on calcineurin by variants of the Saccharomyces cerevi-siae vacuolar Ca2�/H� exchanger Vcx1p. Mol Microbiol 54:1104 –1116.http://dx.doi.org/10.1111/j.1365-2958.2004.04332.x.

48. Palmer CP, Zhou XL, Lin J, Loukin SH, Kung C, Saimi Y. 2001. A TRPhomolog in Saccharomyces cerevisiae forms an intracellular Ca2�-permeable channel in the yeast vacuolar membrane. Proc Natl Acad SciU S A 98:7801–7805. http://dx.doi.org/10.1073/pnas.141036198.

49. Ruiz A, Yenush L, Arino J. 2003. Regulation of ENA1 Na�-ATPase geneexpression by the Ppz1 protein phosphatase is mediated by the calcineurinpathway. Eukaryot Cell 2:937–948. http://dx.doi.org/10.1128/EC.2.5.937-948.2003.

50. Jung KW, Strain AK, Nielsen K, Jung KH, Bahn YS. 2012. Two cationtransporters Ena1 and Nha1 cooperatively modulate ion homeostasis, an-tifungal drug resistance, and virulence of Cryptococcus neoformans via theHOG pathway. Fungal Genet Biol 49:332–345. http://dx.doi.org/10.1016/j.fgb.2012.02.001.

51. Kinclova-Zimmermannova O, Gaskova D, Sychrova H. 2006. TheNa�,K�/H�-antiporter Nha1 influences the plasma membrane potentialof Saccharomyces cerevisiae. FEMS Yeast Res 6:792– 800. http://dx.doi.org/10.1111/j.1567-1364.2006.00062.x.

52. Benito B, Garciadeblas B, Fraile-Escanciano A, Rodriguez-Navarro A.2011. Potassium and sodium uptake systems in fungi. The transporterdiversity of Magnaporthe oryzae. Fungal Genet Biol 48:812– 822. http://dx.doi.org/10.1016/j.fgb.2011.03.002.

53. Denis V, Cyert MS. 2002. Internal Ca2� release in yeast is triggered byhypertonic shock and mediated by a TRP channel homologue. J Cell Biol156:29 –34. http://dx.doi.org/10.1083/jcb.200111004.

54. Juvvadi PR, Lamoth F, Steinbach WJ. 2014. Calcineurin as a multifunc-tional regulator: unraveling novel functions in fungal stress responses,hyphal growth, drug resistance, and pathogenesis. Fungal Biol Rev 28:56 –69. http://dx.doi.org/10.1016/j.fbr.2014.02.004.

55. Steinbach WJ, Cramer RA, Jr, Perfect BZ, Asfaw YG, Sauer TC, NajvarLK, Kirkpatrick WR, Patterson TF, Benjamin DK, Jr, Heitman J,Perfect JR. 2006. Calcineurin controls growth, morphology, and patho-genicity in Aspergillus fumigatus. Eukaryot Cell 5:1091–1103. http://dx.doi.org/10.1128/EC.00139-06.

56. Juvvadi PR, Fortwendel JR, Rogg LE, Burns KA, Randell SH, SteinbachWJ. 2011. Localization and activity of the calcineurin catalytic and regu-latory subunit complex at the septum is essential for hyphal elongationand proper septation in Aspergillus fumigatus. Mol Microbiol 82:1235–1259. http://dx.doi.org/10.1111/j.1365-2958.2011.07886.x.

57. Zhao C, Jung US, Garrett-Engele P, Roe T, Cyert MS, Levin DE. 1998.Temperature-induced expression of yeast FKS2 is under the dual controlof protein kinase C and calcineurin. Mol Cell Biol 18:1013–1022. http://dx.doi.org/10.1128/MCB.18.2.1013.

58. Cui J, Kaandorp JA, Ositelu OO, Beaudry V, Knight A, Nanfack YF,Cunningham KW. 2009. Simulating calcium influx and free calcium con-centrations in yeast. Cell Calcium 45:123–132. http://dx.doi.org/10.1016/j.ceca.2008.07.005.

59. Hirata D, Harada S, Namba H, Miyakawa T. 1995. Adaptation tohigh-salt stress in Saccharomyces cerevisiae is regulated by Ca2�/calmodulin-dependent phosphoprotein phosphatase (calcineurin) andcAMP-dependent protein kinase. Mol Gen Genet 249:257–264. http://dx.doi.org/10.1007/BF00290525.

60. Mendoza I, Quintero FJ, Bressan RA, Hasegawa PM, Pardo JM. 1996.Activated calcineurin confers high tolerance to ion stress and alters thebudding pattern and cell morphology of yeast cells. J Biol Chem 271:23061–23067. http://dx.doi.org/10.1074/jbc.271.38.23061.

Wang et al.

3430 aem.asm.org June 2016 Volume 82 Number 11Applied and Environmental Microbiology

on February 1, 2020 by guest

http://aem.asm

.org/D

ownloaded from