Upload File

c kim et al. nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

  • Home
  • Documents
  • C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799
1
C Kim et al. Nature 000, 1-6 (2013) doi:10.1038/nature11799 Induction of pathognomonic features of ARVD/C using mutant PKP2-iPSCs.

Upload: yeva

Post on 21-Jan-2016

54 views

Category:

Documents


5 download

Report

Tags:

DESCRIPTION

Induction of pathognomonic features of ARVD/C using mutant PKP2 -iPSCs. C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000, 1-6 (2013) doi:10.1038/nature11799

Induction of pathognomonic features of ARVD/C using mutant PKP2-iPSCs.

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Nature Biotechnology: doi:10.1038/nbt

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Published in Nature Materials (2016) doi:10.1038/nmat4569

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677