c. cascio et al- detection of p450c17-independent pathways for dehydroepiandrosterone (dhea)...

8/3/2019 C. Cascio et al- Detection of P450c17-independent pathways for dehydroepiandrosterone (DHEA) biosynthesis in br

1/6

Proc. Natl. Acad. Sci. USAVol. 95, pp. 28622867, March 1998Biochemistry

Detection of P450c17-independent pathways fordehydroepiandrosterone (DHEA) biosynthesisin brain glial tumor cells

C. CASCIO*, V. V. K. PRASAD, Y. Y. LIN, S. LIEBERMAN, AND V. PAPADOPOULOS*

Departments of *Cell Biology and Pharmacology, Georgetown University Medical Center, Washington, DC 20007; Department of Pediatrics, New YorkUniversity Medical Center, New York, NY 10016; and Department of Obstetrics and Gynecology, St. LukesRoosevelt Hospital Center, New York, NY 10019

Contributed by S. Lieberman, December 29, 1997

ABSTRACT Dehydroepiandrosterone (D) is biosynthe-

sized in the brain by a pathway different from that existing in

the adrenal cortex. C6 rat glioma tumor cells in culture

biosynthesize both pregnenolone (P) and D. They possess the

mRNA, protein, and side-chain cleavage activity of P450scc.

On the other hand, P450c17 was not detected. Adding FeSO4to C6 cells increased the synthesis of both P and D. Even in the

presence of aminoglutethimide, an inhibitor of P450scc,

FeSO4 increased the synthesis of both steroids, indicating that

the Fe

2

-sensitive process does not involve P450scc. Likewise,the FeSO4-induced formation of D was not blocked by the

P450c17 inhibitor, SU-10603. These results suggest that the

FeSO4-induced synthesis of D as well as of P in C6 cells may

be due to the fragmentation of in situ-formed tertiary hy-

droperoxides. It is likely, however, that the effect of the Fe 2

is not limited to this one reaction. When exogenous P was

added to C6 microsomes, along with FeSO4, the amount of D

formed was greater than control values, indicating that Fe2

facilitated the conversion of P to D. Unlike the constituents

that are converted by Fe2 to P, the precursor of D in C6 cells

is not soluble in a 1:1 mixture of ether and ethylacetate.

Treatment of C6 cells with KI, NaBH4, or HIO4 resulted in an

increase in D synthesis. From this it seems clear that a

precursor of the D produced in C6 cells is a steroid where both

C-17 and C-20 are oxygenated.

The specific interactions of steroids with binding sites in thebrain (1) together with the rapid effects of various steroids onneuronal function (2) have prompted the investigation of thesteroidogenic potential of central nervous system structures.The pioneering work of Baulieu and Robel demonstrated thatpregnenolone (P) and dehydroepiandrosterone (D) accumu-late in the brain independently of the supply by peripheralendocrine organs (3). In addition, these authors demonstratedthat glial cells can convert cholesterol to P and thus makepossible the availability of steroid metabolites as potentialmodulators of neuronal function. It has been shown thatoligodendrocytes (4), a glioma cell line (5), and Schwann cells(6) express P450scc and have the ability to metabolize cho-

lesterol to P. In other endocrine glands, P450c17 is the enzy meresponsible for the conversion of P to D. D was the firstneurosteroid to be described (7) and is one of the mainneuroactive steroids found in brain (7, 8).

Despite these initial findings and numerous subsequentstudies, the data available to date on the synthesis of neuro-steroids does not account for the mechanisms responsible fortheir synthesis. First, the levels of the P450scc enzymaticactivity, immunoreactivity, and mRNA are not consistent with

each other (3, 9). Second, neither P450c17 protein nor itsactivity have been detected in brain (10) or glioma cells (11).Only a transient expression of the mRNA for this enzymeduring embryonic life was reported (12), and contradictorydata on the presence of its mRNA in the adult has beenpresented (9, 13, 14). Thus, the pathway by which D issynthesized in the brain is unknown, and it seems that brainsteroid synthesis may not fit the well accepted scheme foradrenal and gonadal steroidogenesis and that alternate path-

ways may exist.In 1994, Prasad and c olleagues (15) presented evidence thatshowed that organic extracts of rat brain contain precursors

which, upon treatment with various chemicals, especiallyFeSO4, liberate P and D. In the present paper, we report thatin rat tumor glioma cells in culture, which do not possess theP450c17 enzyme, D biosynthesis may be mediated by alterna-tive mechanisms.

MATERIALS AND METHODS

Materials. [7-3H(N)]P (specific activity, 21.1 Cimmol; 1Ci 37 GBq), [1,2,6,7-3H(N)]progesterone (specific activity,92 Cimmol), and [1,2,6,7-3H(N)]dehydroepiandrosterone(D) (specific activity, 89.2 Cimmol) were obtained from

DuPontNew England Nuclear. Trilostane was a gift fromStegram Pharmaceuticals (Sussex, U.K.), and SU-10603 wasfrom CIBAGeigy. Aminogluthetamide (A MG) was obtainedfrom Research Biochemicals. Cell culture supplies were pur-chased from GIBCO, and cell culture plasticware was fromCorning. Electrophoresis reagents and materials were suppliedfrom Bio-Rad. Sep-Pak Silica cartridges were purchased fromWaters. Organic solvents were of HPLC grade purchased fromFluka and Fisher Scientific. All other chemicals were ofanalytical quality and were obtained from Sigma.

Cell Culture and Treatments. The C62B clone of C6 ratglioma cell line (5) and MDA-231 human breast cancer cells(16) were maintained in DMEM supplemented with 10% fetalbovine serum100 units/ml penicillin100 g/ml streptomycinat 37C and 5% CO2 in 95% air. MA-10 mouse Leydig tumor

cells were maintained in modified Waymouths MB7521medium containing 20 mM Hepes1.2 g/liter NaHCO315%horse serum, pH 7.4, as previously described (17). Rat Leydigcells were isolated from 70-day-old SpragueDawley rats afterenzymatic dissociation of the testes followed by discontinuousPercoll gradient centrifugation as we described (18).For all theexperiments, glial, Leydig, as well as breast tumor cells each

were cultured in 100-mm and 150-mm dishes. Cells were

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. 1734 solely to indicate this fact.

1998 by The National Academy of Sciences 0027-842498952862-6$2.000PNAS is available online at http:www.pnas.org.

Abbreviations: P, pregnenolone3-hydroxypregn-5-en-20-one; D,dehydroepiandrosterone, 3-hydroxyandrost-5-en-17-one (commonlycalled DHEA); AMG, aminoglutethimide; RT, reverse transcriptase.To whom reprint requests should be addressed at: Department of Cell

Biology, Georgetown University Medical Center, 3900 ReservoirRoad, Washington, DC 20007. e-mail: [email protected].

2862


2/6

washed with serum-free medium to remove preexisting ste-roids and treated for 2 hr with the indicated concentrations ofoxidizing and reducing agents (FeSO4, FeCl3, H2O2) in thepresence or absence of 0.76 mM AMG, a specific inhibitor ofP450scc (19). At the end of the incubation, the culture medium

was quickly removed, and the remaining cells were collected byscraping and sonicated in 1 ml ice-cold deionized water.

Aliquots of these sonicates were reserved for protein assay andthe remainder were recombined with the culture medium to be

processed for steroid extraction and isolation.To determine whether a 17-hydroperoxide derivative is a

likely precursor of D, C6 glial cells were treated with 1%solution of the reducing agent KI for 10 min at room temper-ature, then washed once with H2O2 (0.01%) to eliminate excessKI and twice with deionized water. Cells were then incubated

with 20 mM aqueous solution of NaBH4 for 4 hr at 37C, washed with 1% solution formaldehyde to destroy excessNaBH4, and subsequently treated with 20 mM aqueous solu-tion of HIO4 for 2 hr at 37C. The glial cells were processed asdescribed above.

Steroid Isolation and Measurement. Samples from cellstreated and processed as described above were extracted w ithdiethyl-etherethyl acetate (1:1, vol:vol); the organic phases

were collected and then evaporated to dryness. In all samples,

radiolabeled steroids were added to correct for the recovery ofthe extraction. The dried residues were resuspended in n-hexane and applied to Sep-Pak Silica cartridges, where thesteroids of interest were eluted with n-hexaneisopropyl alco-hol (95:5, vol:vol) as previously described (20). The steroids

were then separated by HPLC (Beckman) by using a Beckmanultrasphere XL 3-m Spherical 80 A pore column equilibrated

with methanol (50%) in water and eluted with a 1 mlmin flowrate with a 50100% gradient of methanol. Steroids wereidentified by their respective retention time (Rt) compared

with radiolabeled steroid standards (Rt for P 30 min, Rt forprogesterone 24 min; Rt for D 18 min). In otherexperiments, unrelated to those described in this paper, thisisolation procedure provided samples in which P, D, andprogesterone were identified by GC coupled to MS.

Steroid contents were quantified by using specific RIAs.Antisera to P, D, and progesterone were obtained from ICN,and the assays were performed as described by the manufac-turer. The sensitivity of the RIAs was 10 pg. The analysis of theRIA data was performed by using the IBM PC RIA datareduction program (version 4.1) obtained from Jaffe and

Associates (Silver Spring, MD).Reverse Transcriptase (RT)PCR. Total cellular RNA from

C6 glioma and MA-10 Leydig cells was isolated by acid-guanidium thiocyanate-phenol-chloroform extraction method(21) by using the RNAzol B reagent (Tel-Test, Friendswood,TX). Reverse transcription and PCR were carried out acc ord-ing to Stromsted and Waterman (13) by using the Gene AmpRNA PCR kit (PerkinElmer), 1 g of total RNA as template,and 20 M of specific primers. The primers used for PCRamplification were as follows: ( i) for the P450scc, sense

CAACATCACAGAGATGCTGGCAGG and antisense CT-CAGGCATCAGGATGAG GTTGAA, and (ii) f or theP450c17, sense CCCATCTATTCTCTTCGCCTGGGTA andantisense GCCCCAA AGATGTCTCCCACCGTG. PCRproducts were resolved on 1.5% agarose electrophoresis gelscontaining 1 gml ethidium bromide. The amplified frag-ments were recovered and purified by using the Quiaquick gelextraction kit (Qiagen). The identity of the generated PCRproducts was confirmed by automatic sequencing, which wascarried out by using the ABI Prism Dye Terminator CycleSequencing ready reaction kit (PerkinElmer). DNA sequenc-ing was performed at theLombardi Cancer Center SequencingCore Facility (Georgetown University Medical Center).

D Synthesis in Microsomes. Microsomes from C6 gliomacells were prepared by differential centrifugation as previously

described (22). Briefly, the cells were homogenized with 0.25M sucrose in a glassTeflon homogenizer. Homogenates werecentrifuged for 10 min at 1,000g, the pellets were discarded,and the supernatants were centrifuged for 10 min at 10,000

g to eliminate the mitochondrial fraction of the cells. Thesupernatants from the mitochondrial fraction were collectedand centrifuged for 60 min at 120,000 g. Microsomal pellets

were washed and suspended in 50 mM Tris-maleate buffer (pH7.4) to a final protein concentration of 5 mgml.

To test the P450c17 enzymatic activity, 100 g of themicrosomal protein fraction was incubated in Tris-maleatebuffer in the presence of 600 M NADPH, 10 mM glucose6-phosphate, 1,500 unitsliter glucose-6-phosphate dehydro-genase together with the substrate P (50 M) (23) in thepresence or absence of the inhibitors of P450c17, SU-10603 (5M), and 3-hydroxysteroid dehydrogenase, trilostane (5M). In addition, to test the hypothesis that a process respon-sible for D formation could oc cur in the microsomal fractions,microsomes were also incubated with 50 M P or cholesterolin the presence of 10 mM FeSO4. All the incubations werecarried out at 37C in 5% CO2 atmosphere for 20 min andstopped by the addition of cold ethanol. Steroids were ex-tracted by using diethyl ether, separated by HPLC, and quan-tified by RIA. GCMS analysis of the samples was performed

on an HP5890 GC coupled to an HP5988A mass spectrometeras previously described (24). The identity of D was establishedby its Rt on GC (8.8 mm), identical with that of an authenticsample, and the me values of diagnostically important ions,288, 270, and 255. Quantification was obtained from the areaunder the ion peak (288) when compared with a standardcurve.

Miscellaneous. Protein concentration was determined bythe proteindye binding assay of Bradford (25), using BSA asstandard. Statistical analysis of the data was performed by

ANOVA followed by the StudentNewmanKauls test byusing the INSTAT 2.04 package from GraphPad (San Diego).

RESULTS

C6 rat glioma cells contain P450scc immunoreactive protein(5) and have the ability to synthesize P from the precursormevalonolactone (20). In addition, C6 glioma cell mitochon-dria incubated with the cholesterol derivative, (22R)-22-hydroxycholesterol, synthesize P in an AMG-sensitive manner,further suggesting the presence of an active P450scc (5). In thepresent studies, we isolated and measured P, progesterone, andD production by the C6 cells incubated under basal conditions.Table 1 shows that C6 cells produce measurable amounts of all

Table 1. Effect of various chemicals on steroid synthesis by C6glioma and MA-10 Leydig cells

Cell type Treatment

P,fold

increaseProges-terone D N (n)

C6 Control 1.0 1.0 1.0 4 (12)FeSO4, 10 mM 3.6 1.0 4.9 4 (18)FeCl3, 10 mM 2.0 2.4 2.8 2 (4)H2O2, 10 mM 2.0 1.0 2.0 1 (3)

MA-10 Control 1.0 1.0 1.0 2 (5)FeSO4, 10 mM 1.2 1.0 2.0 2 (5)FeCl3, 10 mM 1.1 1.0 1.8 2 (5)H2O2, 10 mM 1.5 1.0 1.0 2 (5)

Cell treatment, steroid isolation, and measurement were performedas described in Materials and Methods. Results shown are expressed asfold increase above control values. Basal values for C6 glioma cells are:P, 70 pgmg protein; progesterone, 32 pgmg protein; D, 4 pgmgprotein. Basal values for MA-10 Leydig cells are: P, 2,200 pgmgprotein; progesterone, 2,700 pgmg protein; D, 7.4 pgmg protein. N,number of experiments; n, number of samples.

Biochemistry: Cascio et al. Proc. Natl. Acad. Sci. USA 95 (1998) 2863


3/6

three steroids. Because the presence of lipid-soluble constit-uents (peroxides and others) that may be precursors of P andD have been demonstrated (15), we used C6 glial cells toinvestigate this mechanism of neurosteroid synthesis. Treat-ment of glioma cells with various agents resulted in thedetection of increased amounts of P and D (Table 1). Of thosechemicals used, the reducing agent FeSO4 was the mostrevealing. FeSO4 induced a 3.6- and 4.9-fold increase in P andD formation, respectively, compared with basal levels. No

effect of FeSO4 addition on progesterone formation wasobserved. MA-10 mouse Leydig cells were also used as arepresentative model of steroidogenesis. Treatment withFeSO4 induced a 2-fold increase in the amount of D found inthe Leydig cells, without affecting P and progesterone forma-tion. Both FeCl3 and H2O2 increased by 2-fold the amounts ofP and D found in C6 cells, but these increments were less thanthat found by treatment with FeSO4.

To examine the possibility that D formation was due toP450c17 activity we investigated the mRNA expression of thisenzyme by RT-PCR using primers designed from the pub-lished rat P450scc and P450c17 nucleotide sequences. Fig. 1shows that, as expected, P450scc mRNA is present in both theC6 glioma and MA-10 Leydig tumor cells. RT-PCR amplifi-cation did not result in the detection of P450c17 mRNA in glial

cells, although P450c17 mRNA was found in the Leydig cells.The amplified P450scc fragments from both the glial andLeydig cells, and P450c17 fragment from the Leydig cells hadthe expected size of 583 bp and 743 bp, respectively, and theiridentity was confirmed by sequencing.

Based on the above data we then examined the effects ofFeSO4 on glioma and Leydig cell steroidogenesis. Fig. 2A and

B shows P and D synthesis by the C6 cells after treatment withincreasing concentrations of FeSO4. The amounts of thesteroids measured were increased by FeSO4 in a dose-dependent manner. Maximal increases were obtained at aconcentration of 10 mM FeSO4, where P and D formation wasincreased by 10-fold. Treatment of the cells with FeSO4 in thepresence of the P450scc inhibitor AMG partially blocked theFeSO4-dependent P formation but had little effect on the

FeSO4-induced D production. Because the addition of AMGobliterated P formation in the control glial cells (Fig. 2A), the

P formed in the presence of FeSO4 appears to have beenderived from a FeSO4-stimulated pathway where the effect of

AMG is questionable. In contrast to the brain tumor cells, Pformation in the Leydig cells was not increased by FeSO4.

Although AMG abolished basal P formation by the MA-10cells, FeSO4 increased P levels in the presence of AMG (Fig.2C). A comparison of the amount of P found when both AMGand FeSO4 were added with that found when only AMG waspresent (Fig. 2C) suggests that the former could have come

from a P450scc-independent pathway. D levels were alsoincreased after treatment with 10 mM FeSO4 (Fig. 2D). Thiseffect was not altered by AMG in the MA-10 Leydig cells,suggesting that D formed in the presence of both AMG andFeSO4 was derived from a pathway that did not involve Psynthesized by the P450scc enzyme.

Microsomes prepared from C6 glial cells were found tocontain the constituentsthat are stimulated by Fe2 to produceD. Microsomal fractions treated with FeSO4 in the presence ofthe known inhibitor of the 3-hydroxysteroid dehydrogenase,trilostane (26), and SU-10603, an inhibitor of P450c17 (19),make as much D (1,221 478 pg Dmg protein per 20 min;

n 3) as they did in their absence (1,235 542 pg Dmgprotein per 20 min; n 3). As shown in Fig. 3, addition of bothP and FeSO4 to microsomes from C6 cells in the presence of

both trilostane and SU-10603 resulted in a statistically signif-icant increase in D formation over the control. Addition ofcholesterol had no such effect. Fractions considered to be Dfrom many experiments were pooled. The pooled sample had4 ng D as determined by RIA. This was then submitted toGCMS for qualitative and quantitative analysis and found tocontain 3 ng D, thus validating the assay used. Ordinarily thisfinding would be taken to suggest that P is the precursor of theD found in the control; however, such an in vitro experimentreveals only what is possible but does not prove what actuallyoccurs in situ. If D was in fact formed from P, the data shownin Fig. 2 indicate that that P was synthesized by a process notcatalyzed by P450scc.

We probed the nature of the precursor of D by usingsuccessive treatments with reducing and oxidizing agents as

described under Materials and Methods. Table 2 shows datafrom an experiment where an in situ precursor was reduced byKI followed by successive reduction with NaBH4 and oxidation

with HIO4. These probes increased the amount of D measuredabove that which existed in untreated cells. D in c ontrol dishespresumably was reduced to the diol by NaBH4. P was notformed in this experiment. Treatment of thecells with only oneof the three reagents (either KI, NaBH4, or HIO4) did notproduce any increment in the amount of D formed over thecontrol (data not shown).

Because the generation of oxygen-free radicals by theaddition of Fe2 to cells is a well known phenomenon (27, 28),

we examined the possibility that the Fe2-sensitive alternativepathway reported here is a nonspecific mechanism not relatedto steroidogenesis. Were this the case, this nonspecific mech-anism should be present in nonsteroid synthesizing tissues.MDA-231 human breast cancer cells were used to test thishypothesis. Using similar techniques, we were unable to detectany steroid formation by these cells either under basal condi-

FIG. 1. Ethidium bromide-stained P450scc and P450c17 DNAfragments generated by RT-PCR from C6 and MA-10 total cell RNA.Conditions for RNA isolation, cDNA preparation, and amplificationusing specific primers are described in Materials and Methods. Stan-dards shown have molecular sizes of 2,000, 1,200, 800, 400, and 200 bp.

Table 2. D formation by cells treated with the reducing agent KIfollowed by successive reduction and oxidation with NaBH4and HIO4

Cell typeControl,

pg per dishTreated,

pg per dish

C6 1.4 20MA-10 9.2 17

Results shown represent the means from a representative experi-ment (n 3). Similar results were obtained in a second, separateexperiment.

2864 Biochemistry: Cascio et al. Proc. Natl. Acad. Sci. USA 95 (1998)


4/6

tions or after FeSO4 treatment. In addition, we also usedpurified rat Leydig cells, which have the ability to synthesizeandrogens, as a control. FeSO4 treatment failed to induce theformation of androgens (D and testosterone) by these cells(data not shown). Also, FeSO4 treatment did not affect theinhibitory activity of the enzyme inhibitors, trilostane andSU-10603, when examined in a cell system (normal rat Leydigcells) possessing both the 3-hydroxysteroid dehydrogenaseand P450c17 activities (data not shown).

We also examined the possibility that the precursor of P andD can be found in organic extracts of the cells as previouslyreported by Prasad et al. (15) for extracts of lyophilized rat

brains. Organic extracts of C6 cells treated with FeSO4 liber-ated P (69 pgmg protein vs. 33 pgmg protein control), but,surprisingly, the Fe2-sensitive precursor of D was not de-tected in organic extracts of C6 cells.

DISCUSSION

The levels of D in brain are distinct from those in plasma, anditsfunction as neuroactivesteroidat thetype A -aminobutyricacid and N-methyl-D-aspartate receptor level has been wellestablished (2, 8). Understanding the mechanism of D forma-tion in brain, however, is paramount to all further speculationand hypotheses about D and its role in normal and pathologicbrain function. The findings reportedin this paper indicatethatrat tumor glioma cells, which do not contain the enzyme

P450c17, are nonetheless able to produce D through alterna-tive pathways. The same pathway also exists in MA-10 Leydigtumor cells. However, in Leydig tumor cells this processaccounts for a small part of the steroids produced, suggestingthat in this steroidogenic tissue, the principal pathway bymeans of which D is biosynthesized involves P450c17. Theabsence of any steroid formation by human breast cancer cellsand by purified androgen-synthesizing normal rat Leydig cellsby this alternative process suggests that the phenomenon istissue-specific. At present, we identified this process only in ratglioma and Leydig tumor cells. In view of the fact that theP450c17 enzyme protein and activity have not yet been foundin rat and guinea pig brain (8, 9), where high levels of D weremeasured, it may be possible that this D arises from a similaralternative process. We have yet to examine normal braintissue.

One alternative pathway appears to involve hydroperoxidesor peroxides because the reducing agent FeSO4, could react

with the endogenous precursor(s), present in C6 glial cells andto a lesser extent in MA-10 Leydig cells, to form the ketones,P and D. These findings are in accord with those of Prasad et

al. (15), who observed that treatment of organic extracts of ratbrains with FeSO4 produced larger amounts of P, as estimatedby mass spectrometric analysis, than were present in untreatedextracts. Thus, P could be formed in brain either by thepathway (4, 5, 9), mediated by the P450scc, or by an alternativepathway from an as yet unknown cholesterol metabolite, whichis present in organic extracts of the cells, or by both.

FIG. 2. FeSO4-induced P (A and C) and D (B and D) formation by C6 glioma (A and B) and MA-10 Leydig (C and D) cells. Cells were treatedfor 2 hr with the indicated concentrations of FeSO4 or with 10 mM FeSO4 in the presence of 0.76 mM AMG. Steroids produced were extracted,isolated, and quantified as described in Materials and Methods. Data shown are means SD from an experiment performed in triplicate. Similarresults were obtained in three other independent experiments. t incubation time of 2 hr; a, statistics performed compared with control; b, statisticsperformed compared with AMG treatment alone; , P 0.05; , P 0.01; , P 0.001.



5/6

Addition of FeSO4 directly to glial cells in culture resultedin a 5- to 10-fold increase in D production. We have inter-preted the results obtained with the addition of FeSO4 asindicating that this increase in D is due to the fragmentationof an in situ-formed tertiary hydroperoxide initiated by Fe2.It has been shown that hydroperoxides react with FeSO4 to

yield ketones (29). The reaction probably involves reduction ofthe hydroperoxide to the intermediate alkoxy radical suffi-ciently caged to allow it to fragment by -scission to the ketonegroup (Fig. 4). In contrast to the precursor of P, the Dprecursor was not found in the organic extracts of glial cells(this work), and in fact it was present in limited amounts in theorganic extracts of rat brain (15). These data suggest that theprocess leading to the formation of D need not necessarily beassociated with that producing peroxy precursors of P, some of

which are organic soluble.Evidence already exists that mammalian tissues contain

enzymes that catalyze the fragmentation of peroxy constitu-ents to steroid ketones. Larroque and van Lier (30) found that

when 20-hydroperoxycholesterol was incubated with purifiedP450scc for only 30 sec at 0C, it was readily converted to P.The heme content of the P450scc used was about 9 nmolmgprotein. Because the theoretical value of the heme content ofP450scc is about 17 nmolmg protein, the exact enzymeaffecting the conversion is uncertain, but the results show thattissue constituents can fragment peroxy substrates. Moreover,as early as 1975, Tan and Rousseau (31) showed that the rattestis microsomal fraction could convert 17-hydroperoxypro-gesterone to androstenedione when incubated in the presenceof oxygen and NADPH. The cofactor was essential, but oxygen

was not, because argon could substitute for it. These authorsalso reported that the 17-hydroperoxide could be trapped

when progesterone was incubated with adrenal homogenatesin the presence of the hydroxylase inhibitor,p-hydroxymercuri-benzoate (31).

Adding exogenous P along with FeSO4 to C6 microsomesresulted in a large increase in the amount of D formed. Thisexample, perhaps the first, of a mammalian brain cell convert-ing P to D indicates that Fe2 can activate the conversionprocess, which may, in fact, involve hydroperoxylation at C-17of the added P.

Although the Fe2 ion is a pleiotropic agent in the centralnervous system, the specificity of its reaction with endogenousprecursors to form D is characterized by the following obser-

vations: (i) the effect is specific for the formation of D becauseno effect on progesterone production is seen; (ii) the effectappears to be tissue-specific; (iii) its action is found in themicrosomal fraction; (iv) its effect is dose-dependent but notin a stoichiometric manner; and (v) the effect of FeSO4 couldnot be replicated to the same extent when using FeCl3 or H2O2.

In an effort to obtain information about the endogenousperoxy precursors of D, C6 cells were treated with KI (toreduce peroxy compounds to their corresponding alcohols),then with NaBH4 (to reduce ketones, including preexisting D,to alcohols), and finally with HIO4 (to oxidize glycols tocarbonyl products). Assuming that the reagents (KI, NaBH4,and HIO4) react as proposed, the newly formed D resultingfrom this sequence of reactions suggests that a C-17,C-20glycol was the proximal precursor of this D. Treatment of the

cells with only one of the three reagents (either KI, NaBH4, orHIO4) did not produce any increment in the amount of Dformed over the control. The steroid glycol that is mostobvious is pregn-5-ene-3,17,20-triol, in which case its peroxyprecursor is 17-hydroperoxide of P. It is noteworthy thattreatment with the above-mentioned reagents did not result inthe formation of P. As mentioned before, the formation of Pby Fe2 treatment in the presence of the inhibitor A MGindicates that this P is not produced by a process involvingP450scc. The failure to produce P by the above sequence ofreactions is particularly noteworthy because it supports thenotion that the biosynthetic pathways for P and D, resultingfrom Fe2 treatment, are not necessarily connected. More-over, the evidence presented does not exclude other peroxyprecursors, particularly one derived from a sterol, like choles-

terol, such as a 17,20-dioxygenated derivative. Fig. 5 shows analternative pathway suggested by the results obtained by usingKI, NaBH4, and HIO4 in tandem. This alternative is illustratedby using the 17-hydroperoxide of P as a model.

Theobservationthatthe peroxy precursorof D is notsolublein organic solvents suggests the potential requirement for acellular component for activity. The effect of Fe2 on theformation of D may be mediated by a proteinaceous micro-somal component associated w ith iron reduction. Such apossibility was recently suggested by Tampo and Yonaha (32),

who presented evidence indicating that a heat-labile compo-nent of the rat liver microsomal fraction was responsible forNADPH-supported lipid peroxidation. Although the peroxyprecursor(s) of D made in C6 cells was not soluble in organicsolvents, treatment of the intact cells with FeSO4 nevertheless

FIG. 3. D formation by C6 glioma cell microsomes incubated in thepresence of the substrate P (50 M) or cholesterol (50 M) andinhibitors of P450c17, SU-10603 (5 M), and 3-hydroxysteroiddehydrogenase, trilostane (5 M). Microsomes were treated with orwithout 10 mM FeSO4. D was extracted, isolated, and measured asdescribed in Materials and Methods. Data shown are means SD froman experiment performed in triplicate. Similar results were obtainedin two other separate experiments. Incubationtime was20 min; ,P0.01.

FIG. 4. Mechanism of ketone formation fromhydroperoxides.Thisscheme illustrates how the addition of FeSO4 might reduce the17-hydroperoxide of P to an intermediatealkoxy radical(29).Cleavageof the two-carbon side chain by -fragmentation results in the for-mation of D.

2866 Biochemistry: Cascio et al. Proc. Natl. Acad. Sci. USA 95 (1998)


6/6

produced 510 times as much D as was in thecontrol.From thisit appears that the process for making D in C6 cells is morecomplicated than that which simply involves fragmentation ofperoxy compounds. Fe2 ions undoubtedly affect many cellu-lar processes, including those that stimulate oxygenases andhydroxylases. It is also conceivable that Fe2 forms c omplexes

with constituents within the C6 cells that are able to mimic thecatalytic oxidative behavior of a P450. Previous reports (33, 34)suggest that the level of activation of O2 is similar to that forFenton reagents and P450 hydroxylases (34), and thus it canaffect oxygen insertion at a C17 bond. Therefore, it is notpossible now to be certain of the mechanism(s) by which Fe2

evokes an increase in D production by C6 cells. Butthe absencein these glial cells of P450c17 activity, protein, and mRNAindicates that whatever the process leading to the formation ofD in these cells is, it is different from that involving thissteroidogenic enzyme. Even if Fe2 merely stimulates anexisting enzyme to produce D, the precursor of that D alsoappears to be different from the precursor customarily as-sumed to be used in adrenals.

In conclusion, these results demonstrate that D is synthe-sized in the brain by P450c17-independent pathways. Thus, theidentification of this new process for D biosynthesis mayprovide the answer to the mystery surrounding the biosynthesisof this neuroactive steroid in brain.

The authors thank Dr. M. Ascoli (University of Iowa) for providingthe MA-10 cells, Stegram Pharmaceuticals for the gift of trilostane,and CIBAGeigy for the gift of SU-10603. This work was supportedby a grant from the National Science Foundation, IBN-9409551, to

V.P. V.P. was supported by a Research Career Development Award(HD-01031) from the National Institute of Child Health and HumanDevelopment, National Institutes of Health.

1. Brann, D., Henry, L. B. & Mahesh, V. B. (1995) J. SteroidBiochem. Mol. Biol. 52, 113133.

2. Paul, S. M. & Purdy, R. H. (1992) FASEB J. 6, 23112322.3. Baulieu, E. E. & Robel, P. (1990) J. Steroid Biochem. Mol. Biol.

37, 395403.4. Jung-Testas, I., Hu, Z. Y., Baulieu, E. E. & Robel, P. (1989)

Endocrinology 125, 20832091.5. Papadopoulos, V., Guarneri, P., Krueger, K. E., Guidotti, A. &

Costa, E. (1992) Proc. Natl. Acad. Sci. USA 89, 51135117.6. Akwa, Y., Schumacher, M., Jung-Testas, I. & Baulieu, E. E.

(1993) C. R. Acad. Sci. III (France) 316, 410414.7. Coprechot, C., Robel, P., Axelson, M., Sjovall, J. & Baulieu, E. E.

(1981) Proc. Natl. Acad. Sci. USA 78, 47044707.8. Baulieu, E. E. (1996) J. Clin. Endocr. Metab. 81, 31473151.9. Mellon, S. H. & Deschepper, C. F. (1993) Brain Res. 629,

283292.10. Le Goascogne, C., Sananes, N., Gouezou, M., Takemori, S.,

Kominami, S., Baulieu, E. E. & Robel, P. (1991) J. Reprod. Fertil.93, 609622.

11. Cascio, C., Guarneri, P., Li, H., Brown, R. C., Amri, H., Boujrad,N., Kotoula, M., Vidic, B., Drieu, K. & Papadopoulos, V. (1997)in Neurosteroids: A New Regulatory Function in the CentralNervous System, Contemporary Endocrinology, eds.Baulieu, E.E.,Robel, P. & Schumacher, M. (Humana, Clifton, NJ), in press.

12. Compagnone, N. A., Bulfone, A., Rubenstein, J. L. R. & Mellon,S. H. (1995) Endocrinology 136, 52125223.

13. Stromsted, M. & Waterman, M. R. (1995) Mol. Brain Res. 34,7588.

14. Sanne, J.-L. & Krueger, K. E. (1995) Gene 165, 327328.15. Prasad, V. V. K., Vegesna, S. R., Welch, M. & Lieberman, S.

(1994) Proc. Natl. Acad. Sci. USA 91, 32203223.16. Culty, M., Shizari, M., Thompson, E.W. & Underhill, C.B (1994)

J. Cell. Physiol. 160, 275286.17. Papadopoulos, V., Mukhin, A. G., Costa, E. & Krueger, K. E.

(1990) J. Biol. Chem. 265, 37723779.18. Papadopoulos, V., Carreau, S. & Drosdowsky, M. A. (1985)

FEBS Lett. 188, 312316.19. Gower, D. B. (1974) J. Steroid Biochem. 5, 501523.20. Guarneri, P., Papadopoulos, V., Pan, B. & Costa, E. (1992) Proc.

Natl. Acad. Sci. USA 89, 51185122.21. Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156

159.22. Papadopoulos, V., Jia, M., Culty, M., Hall, P. & Dym, M. (1993)

In Vitro Cell Dev. Biol. 29A, 943949.23. Albertson, B. D., Hill, R. B., Sprague, K. A., Wood, K. E.,

Nieman, L. K. & Loriaux, L. D. (1994) Eur. J. Endocrinol. 130,195200.

24. Mathur, C., Prasad, V. V. K., Raju, V. S., Welch, M. & Lieber-man, S. (1993) Proc. Natl. Acad. Sci. USA 90, 8588.

25. Bradford, M. M. (1976) Anal. Biochem. 72, 248254.26. Potts, J. O., Creange, J. E., Harding, H. R. & Schane, H. P. (1978)

Steroids 32, 257267.27. Gutteridge, J. M. (1992) Ann. Neurol. 32, S16S21.28. Kumar, U., Dunlop, D. M. & Richardson, J. S. (1994) Life Sci. 54,

18551860.29. Kharasch, M. S., Fono, A. & Nudenberg, W. (1950) J. Org. Chem.

15, 763774.30. Larroque, C. & van Lier, J. E. (1986) J. Biol. Chem. 261,10831087.

31. Tan, L. & Rousseau, J. (1975) Biochem. Biophys. Res. Commun.65, 13201326.

32. Tampo, Y. & Yonaha, M. (1995) Lipids 20, 5562.33. Parton, R. F., Vankelecom, I. F., Casselman, M. J., Bezoukh-

anova, C. P., Uytterhoeven, J. B. & Jacobs, P. A. (1994) Nature(London) 370, 541544.

34. Sawyer, T. T., Liu, X., Redman, C. & Chong, B. (1994) Bioorg.Med. Chem. 2, 13851395.

FIG. 5. Schematic representation of an alternative pathway byusing the precursor 17-hydroperoxide of P as a model.


c. cascio et al- detection of p450c17-independent pathways for dehydroepiandrosterone (dhea)...

Documents