by: tiffany j. simmons pd. 6. ggtccaatgcccgccagcctagctccagtgcttctagtaggagggctgaaaggga...
TRANSCRIPT
ALDOLASE
By: Tiffany J. SimmonsPd. 6
Amino Acid Sequence-Aldolase
GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGAGCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTGAACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTATTTGAAACATAAAAATGAATACCAAGGACCTGATCAAATTTCACACAGCAGTTTCCTTGCAACAC(TTCAGCTCCCCATGCTCCAGAATACCCACCCAAGAAAATAATAGGCTTTAAAACAATATCGGCTCCTCATCCAAAGAACAACTGCTGATTGAAACACCTCATTAGCTGTGTAGAGAAGTGCATCTTATGAAACAGTCTTAGCAGTGGTAGGTTGGGAAGGAGATAG
Rabbit A -Ala Leu Ser Asp His His Ile Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Pro Gly His Ala Cys Thr Gin LysFrog A- Ala Leu Ser Asx His His Val Tyr Leu Glx Gly Thr Leu Leu Lys Pro Asx Met Val Thr Ala Gly Asx Ala Cys Thr Glx LysCod A- Ala Leu Ser Asp His His Val Tyr Leu Gin Gly Thr Leu Leu Lys Pro Asp Met Val Thr Ala Gly His Ser Cys Thr Gin LysRabbit C- Ala Leu Ser Asx His His Ile Tyr Val Gix Gly Thr Leu Leu Lys Pro Glx Met Val Thr Pro Gly Asx Ala Cys Thr Glx LysRabbit B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr LysOx B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr Lys LysRat B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Leu Thr Ala Gly His Ala Cys Thr Lys LysHuman- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr Lys Lys
ANOTHER VERSION
ATGGCCCACCGATTTCCAGCCCTCACCCAGGAGCAGAAGAAGGAGCTCTCAGAAATTQCCCAGAGCATTGTT
GCCAATTCAGAAATTGCCCAGAGCATTGTTGCCCAT
Protein Structure
By: Tiffany J. SimmonsPd. 6
Primary Structure
Secondary Structure
Tertiary Structure
Quaternary
ALDOLASEAldolase- An enzyme that is used to convert glucose (sugar) into energy.
There are three different classifications of Aldolase: A,B, and C
Aldolase A: This is mainly found as an embryo. There are very small parts left in the adult tissue.
Aldolase B: Is mainly found in the main organisms such as the Kidney, the intestines, and the liver.
Aldolase C: This is found in the brain.
Each of these play an important role in giving the body the proper energy that is needed.
What uses this protein?The main organisms that use this protein are: Kidneys’Livers’The intestines’And very small in the brain.
I chose this protein because it interested me in how much the body really does need this protein. Besides being in major organisms Aldolase is found all over the body such as in the nervous system. If the Aldolase is increased in your body you can be in physical danger.
Why Did Choose This?
What Abnormal Results MeanGreater than normal levels of aldolase may be due to:Damage to skeletal muscles Hepatitis Infectious mononucleosis Liver, pancreatic, or prostate cancer Muscular dystrophy Myocardial infarction Polymyositis
Aldolase is all over the body, but is mostly found in muscle tissue. When someone has muscle or liver damage the Aldolase level will be raised higher.
Other Important Facts