by qinyin lingufdcimages.uflib.ufl.edu/uf/e0/05/04/61/00001/ling_q.pdfaugust 2016 chair: julie a....

55
FUNCTIONAL ANALYSIS OF THE RQC2 HOMOLOG OF HALOFERAX VOLCANII By QINYIN LING A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2016

Upload: others

Post on 12-Jul-2020

0 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

FUNCTIONAL ANALYSIS OF THE RQC2 HOMOLOG OF HALOFERAX VOLCANII

By

QINYIN LING

A THESIS PRESENTED TO THE GRADUATE SCHOOL

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2016

Page 2: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

© 2016 Qinyin Ling

Page 3: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

To my family and girlfriend

Page 4: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

4

ACKNOWLEDGMENTS

I thank my professor, Dr. Maupin-Furlow, for giving me the project and guiding

me through it, and my committee member Dr. Romeo. I thank all the members of Dr.

Maupin’s lab, Dantuluri Swathi, Xian Fu, Shiyun Cao, Sungmin Hwang and Lana

McMillan, also former members Dr. Hepowit, Dr. Martin and Rui Liu for providing me

suggestions for this project.

Page 5: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 7

LIST OF FIGURES .......................................................................................................... 8

LIST OF ABBREVIATIONS ............................................................................................. 9

ABSTRACT ................................................................................................................... 10

CHAPTER

1 INTRODUCTION .................................................................................................... 12

Ribosome ................................................................................................................ 12

Ribosome Stalling ................................................................................................... 13 Ribosome Rescue System ...................................................................................... 14 Ribosome Quality Control Complex Subunit 2 ........................................................ 16 Haloferax volcanii – A Model Archaeon .................................................................. 17

Hypothesis .............................................................................................................. 19

Specific Aims .......................................................................................................... 19

2 METHODS .............................................................................................................. 23

Media ...................................................................................................................... 23 Strains and Growth Conditions ............................................................................... 23 DNA Extraction and Cloning ................................................................................... 24

Generation of mutant strains ................................................................................... 24 Phenotypic Analysis of Δrqc2 Mutant Strains ......................................................... 25

Protein Purification .................................................................................................. 26 Immunoblotting Analysis ......................................................................................... 27 Ribosome Stalling Reporter .................................................................................... 28

3 RESULTS ............................................................................................................... 34

Bioinformatic Analyses of Rqc2 .............................................................................. 34 Generation of C-terminal Tagged Rqc2 Expression Strains ................................... 35 Generation of rqc2 Deletion Strain .......................................................................... 36

Deletion of rqc2 Reduced Cell Growth .................................................................... 37 Deletion of rqc2 Increased Sensitivity to Translation Inhibitor Blasticidin S ............ 37

Generation of Ribosome Stalling Reporters ............................................................ 37

4 DISCUSSION ......................................................................................................... 46

Page 6: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

6

LIST OF REFERENCES ............................................................................................... 48

BIOGRAPHICAL SKETCH ............................................................................................ 55

Page 7: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

7

LIST OF TABLES

Table page 2-1 Strains ................................................................................................................ 30

2-2 Plasmids ............................................................................................................. 31

2-3 Primers ............................................................................................................... 32

3-1 Ribosome rescue factors of bacteria, eukaryotes and Hfx. volcanii .................... 39

Page 8: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

8

LIST OF FIGURES

Figure page 1-1 Schematic representation of the tmRNA mediated trans-translation pathway

for ribosome rescue in bacteria .......................................................................... 21

1-2 Model of ribosome rescue system in eukaryotes ................................................ 21

1-3 Rqc2 mediated C-terminal alanine and threonine (CAT) tail formation ............... 22

2-1 pyrE2 based pop-in/pop-out gene knockout system ........................................... 33

2-2 Ribosome stalling reporter plasmid encoding nonstop GFP fusion proteins containing lysine residues encoded by rare codons followed by mCherry .......... 33

3-1 Domain architectures of Rqc2 proteins in Saccharomyces cerevisiae and Haloferax volcanii ............................................................................................... 40

3-2 HvRqc2-StrepII expression in trans .................................................................... 41

3-3 HvRqc2-StrepII expression from the Rqc2-StrepII integrant strain ..................... 42

3-4 Protein bands at 120 kDa (HvRqc2-StrepII-His) and 60 kDa from the HvRqc2-StrepII-His integrant strain .................................................................... 43

3-5 Identification of Δrqc2 mutant by PCR ................................................................ 43

3-6 Schematic of Southern blotting analysis of the Δrqc2 mutant strain ................... 44

3-7 The Δrqc2 mutant strain grows slower than the H26 parent strain under standard aerobic growth condition ...................................................................... 45

3-8 The Δrqc2 strain is more sensitive to the treatment with the translation elongation inhibitor blasticidin S compared to H26 parent strain ........................ 45

Page 9: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

9

LIST OF ABBREVIATIONS

CAT

NFACT

PCR

RQC

C-terminal alanine and threonine

Protein family including NEMF, FbpA, Caliban, Tae2

Polymerase chain reaction

Ribosome-associated quality control

Rqc2 Ribosome quality control complex subunit 2

Page 10: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

10

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

FUNCTIONAL ANALYSIS OF THE RQC2 HOMOLOG OF HALOFERAX VOLCANII

By

Qinyin Ling

August 2016

Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science

The ribosome is one of the oldest macromolecular assemblies of extant life,

playing a major role in the process of translation during protein biosynthesis, which is

essential for all living cells. The failure of translation arising from various factors can

lead to the stalling of the ribosome, which reduces the capacity for protein synthesis and

disrupts cellular fitness. While ribosome rescue systems have been studied in bacteria

and eukaryotes, the mechanism how archaea handle a stalled ribosome remains largely

unknown. To further understand the ribosome rescue system of archaea, the

HVO_2883 (HvRqc2) protein was investigated for its putative role as a ribosome rescue

factor in the model archaeon, Haloferax volcanii (Hfx. volcanii). Comparative genomics

revealed that HVO_2883 is homologous to Rqc2, a component of the eukaryotic

ribosome-associated quality control (RQC) complex which recognizes peptidyl tRNA on

the stalled ribosome to trigger the ribosome rescue pathway and to mediate mRNA-

independent C-terminal alanine and threonine extensions (CAT tails) to the stalled

nascent polypeptide chains. The presence of the catalytic N terminal NFACT (Protein

family including NEMF, FbpA, Caliban, Tae2; Burroughs and Aravind, 2014) domain

suggests that HvRqc2 may have similar functions during ribosome stalling. An Δrqc2

Page 11: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

11

mutant strain was generated for phenotype analysis. The growth of the Δrqc2 mutant

strain was found to be 8.2% slower than the H26 parent strain, suggesting that HvRqc2

is important for the growth of Hfx. volcanii. In addition, the Δrqc2 mutant strain was

identified with increased growth sensitivity to the translation elongation inhibitor

blasticidin S than the H26 parent strain, strongly indicating that HvRqc2 is involved in

the process of translation during protein synthesis. An HvRqc2-StrepII-His integrant

strain was generated to analyze HvRqc2 associated protein partners. A protein with

molecular mass of 60 kDa was co-purified with HvRqc2 by StrepII-His tandem affinity

chromatography. Ribosome stalling reporters were generated to induce translation

stalling in Hfx. volcanii to determine whether HvRqc2 can mediate CAT tail modification

of the stalled nascent chains. Future work in characterizing the function of HvRqc2 will

provide an insight in understanding ribosome rescue system in the domain archaea.

Page 12: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

12

CHAPTER 1 INTRODUCTION

Ribosome

Ribosomes were first discovered by George Palade in 1954 (Palade, 1955). As a

complex molecular machine, the ribosome is a major site for protein biosynthesis, which

is essential to life. The synthesis of protein is guided by genetic information, which is

stored by the sequences of deoxyribonucleic acid (DNA) in all organisms (Watson and

Crick, 1953). During protein synthesis, genetic information in DNA is first copied to

messenger ribonucleic acids (mRNAs) by transcription, followed by the process of

translation assisted by different elements like translation initiation factors, elongation

factors, termination factors, which takes place on the ribosome. The ribosome is

responsible for the translation process, decoding mRNAs and joining amino acids

together in the order specified by mRNAs to form polypeptide chains, which can fold

into proteins and perform multiple functions.

The distribution of ribosomes can be classified as free ribosomes in the cytosol in

bacteria, archaea and eukaryotes, and membrane-bond ribosomes which are found in

eukaryotes and Hfx. volcanii, a species of archaea (Ring and Eichler, 2004). Ribosomes

consist of ribosomal proteins as well as ribosomal RNAs and these molecules are

arranged into a large subunit and a small subunit. According to sedimentation

coefficients measured in Svedberg units, bacterial and archaeal ribosomes are

designated as 70S ribosomes made of 50S (large) subunits and 30S (small) subunits,

while the eukaryotic 80S ribosome is larger and more complex consisting of a larger

60S subunit and a smaller 40S subunit. Despite the difference in size and distribution,

ribosomes from all three domains of life share a similar core structure and function. All

Page 13: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

13

the ribosomes have three binding sites for transfer RNAs (tRNAs), the A site for binding

aminoacyl tRNAs, the P site for binding peptidyl tRNAs and the E site for binding free

tRNAs before exiting the ribosome (Ramakrishnan, 2002). The small subunit of the

ribosome binds to mRNA and the anticodon loop area of tRNA, contributing to the

mRNA decoding process by monitoring the base pairing between the codon and

anticodon and controlling the fidelity. The large subunit of the ribosome catalyzes the

formation of a peptide bond between an amino acid on A-site tRNA and the nascent

peptide chain at the P-site (Ramakrishnan, 2002). The ribosome is necessary to all

cellular life, and the quality control of every step during the translation process on the

ribosome needs to be highly effective.

Ribosome Stalling

Every biosynthetic pathway has its own intrinsic limits on overall fidelity, leading

to a low but tangible rate of biosynthetic errors. Environmental factors or changes may

also influence or even disrupt the process of cellular biosynthesis (Rodrigo-Brenni and

Hegde, 2012). Under various circumstances, the process of translation on the ribosome

can fail and result in the stalling of the translational machinery. Environmental reasons

include high temperature induced heat shock, nutrient limitation induced amino acid

starvation, as well as oxidative stress, which induce the pausing of translation and

stalling of the ribosome (Shalgi et al., 2013). Antibiotics, such as cycloheximide, have

been widely used to block the elongation step of eukaryotic translation, leading to the

stalling of the ribosome (Alamgir et al., 2010). Translation of aberrant mRNAs with

truncations, depurination, pseudoknots, and/or extensive stem loop structures can also

cause ribosome stalling (Mansouri et al., 2012; Tholstrup et al., 2012; Li et al., 2006).

Furthermore, mRNAs templates with specific sequences, like consecutive rare codons

Page 14: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

14

or lacking stop codons may stop the ribosome from elongating and cause stalling

(Letzring et al., 2010; Dimitrova et al., 2009). Translation of mRNA into polybasic protein

sequences, such as poly(A) encoding polylysines, can cause strong electrostatic

interaction with the negatively charged ribosomal exit tunnel and will also induce the

stalling of the ribosome (Ito-Harashima et al., 2007; Brandman et al., 2012; Lu and

Deutsch, 2008).

In general, ribosome stalling caused by all these factors will reduce the

availability of translation-competent ribosomes and retain the incomplete nascent

polypeptide chains associated with the large ribosomal subunits. If left uncontrolled,

these partially-synthesized or misfolded polypeptides have the potential to disrupt

cellular homeostasis, reduce fitness and cause cell death (Rodrigo-Brenni and Hegde,

2012). Therefore, every cell requires systems for rescuing the stalled ribosomes and

handling the aberrant products.

Ribosome Rescue System

To ensure accurate translation and maintain the protein synthesis capacity of the

cell, all organisms have evolved mechanisms to manage and recognize the stalled

ribosomes and initiate pathways for ribosome recycling, aberrant mRNA degradation

and nascent peptide degradation (Figure 1-3; Shao et al., 2015).

Bacteria mainly use a hybrid transfer-messenger RNA (tmRNA) mediated trans-

translation system for ribosome rescue (Figure 1-1; Keiler et al., 1996). The specialized

RNA molecule, tmRNA, has both tRNA- and mRNA-like properties. The tRNA-like

region together with a small protein B (SmpB) can mimic a tRNA molecule structurally,

which enables the aminoacylation of tmRNA with alanine for interacting with ribosome

(Karzai et al., 1999; Keiler, 2015). After accommodation, the tRNA-like domain is placed

Page 15: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

15

in the peptidyl transferase center and the nascent polypeptide chain is transferred to the

tmRNA complex (Weis et al., 2010). With the help of elongation factor G (EF-G), the

peptidyl-tmRNA complex is translocated to P site. The original faulty mRNA will be

removed from the stalled ribosome during the process and will be degraded to avoid re-

initiation of translation by the ribosome, thus preventing the translation of the faulty

mRNA and the synthesis of aberrant protein products in the future (Ramrath et al.,

2012). Upon the removal, the mRNA-like region of the tmRNA is placed at the decoding

center to resume the process of translation. The mRNA-like region contains an open

reading frame (ORF) with a ‘resume’ codon at the 5’ end which is translated into a

degradation SsrA tag (ANDENYALAA) which is attached to to the C-terminus of the

nascent peptide chain (Karzai et al., 1999). After reaching the stop codon of the ORF in

the mRNA-like region, the nascent polypeptide chain is terminated and released, and

the stalled ribosomes are rescued and recycled. Finally, with the help of different

adaptor proteins, the tagged nascent polypeptides are recognized and degraded by

different proteases, such as FtsH, ClpAP, ClpXP, Lon, HflB and Tsp (Keiler et al., 1996;

Choy et al., 2007; Gottesman et al., 1998; Herman et al., 1998; Flynn et al., 2001).

Eukaryotes use a fundamentally different system consisting of factors unrelated

to the bacterial tmRNA system for ribosome rescue (Figure 1-2). Firstly, eukaryotes use

the splitting factors Pelota, Hbs1 and ABCE1 for the disassociation of the stalled

ribosome and releasing the mRNA for degradation (Shoemaker et al., 2010; Shoemaker

et al., 2011; Pisareva et al., 2011). However, unlike the eukaryotic translation

termination factors eRF1 and eRF3, these rescue factors cannot catalyze the hydrolysis

of peptidyl-tRNA, so the aberrant nascent chain cannot be readily released to rescue

Page 16: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

16

the stalled ribosome (Pisareva et al., 2011). To release the nascent polypeptide chains

for degradation, eukaryotes have a ribosome-associated quality control (RQC) pathway.

How this pathway works has not been fully understood. According to the current model,

in yeast, the RQC complex consists of Rqc1, Rqc2, Ltn1, Cdc48, Npl4 and Ufd1. Rqc2

specifically binds to the peptidyl tRNA on the stalled ribosome, and the ubiquitin E3

ligase Ltn1 binds to Rqc2 on the stalled ribosome and triggers the ubiquitynation of the

nascent chains (Bengtson and Joazeiro, 2010; Brandman et al., 2012). With the

assistance of Rqc1, the Cdc48 complex, made up of an AAA-ATPase Cdc48 with its

cofactors Npl4 and Ufd1, will extract the ubiquitinated nascent chains from the stalled

ribosomes for proteasomal degradation so the ribosome can be rescued and recycled

(Defenouillère et al., 2013; Verma et al., 2013).

For archaea, the ribosome rescue system is still poorly understood. The bacterial

tmRNA system has not been identified in archaea, while some factors related to the

eukaryotic ribosome rescue system have been found, such as archaeal homologs of the

splitting factors Pelota and ABCE1 (Becker et al., 2012). Like eukaryotes, archaea have

a ubiquitin-like proteins and proteasomes for protein tagging and degradation

(Humbard, M.A. et al., 2010; Maupin-Furlow, 2013). However, with limited data it is hard

to determine the model for the archaeal ribosome rescue system.

Ribosome Quality Control Complex Subunit 2

Rqc2, the abbreviation for Ribosome quality control complex subunit 2, also

named as Tae2 (Translation associated element 2) in yeast, Caliban in Drosophila, and

NEMF (nuclear export mediator factor) in mammals, is a component of the eukaryotic

RQC complex (Burroughs and Aravind, 2014). Rqc2 belongs to a highly conserved

nucleic acid–binding protein family termed NFACT family which can be traced to the

Page 17: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

17

LUCA (last universal common ancestor) of life among three domains of life (Shao and

Grishin, 2000; Doherty et al., 1996; Aravind et al., 1999). Proteins of the NFACT family

contain two HhH (helix-hairpin-helix) domains, several coiled-coil domains, NFACT-N, -

R and -C domains. The N-terminal NFACT-N domain was found to recognize and bind

to peptidyl-tRNA using two conserved aspartate residues and a conserved arginine

residue (Burroughs and Aravind, 2014). The yeast Rqc2 consists of 1038 amino acids,

and the NFACT-N domain D9, D98, R99 residues of this Rqc2 were characterized to

play a role in binding RNA (Shen et al., 2015; Burroughs and Aravind, 2014).

Interestingly, Rqc2 also mediates the mRNA-independent C-terminal addition of

alanine and threonine extensions (CAT tails) to nascent chains on stalled ribosomes

(Shen et al., 2015). Rqc2 can recognize the A-site alanine and threonine tRNAs by the

anticodon and D loops, and stimulate the addition CAT tails onto the nascent chains

(Shen et al., 2015). The CAT tail modification of the nascent polypeptide chains results

in the formation of detergent-insoluble aggregates (Yonashiro et al., 2016; Choe et al.,

2016). However, the biological purpose of CAT tail formation is not fully understood.

Haloferax volcanii – A Model Archaeon

The group of single-celled microorganisms termed archaea are recognized as a

seperate domain of life for biological classification (Woese and Fox, 1977; Woese et al.,

1990). Initially classified as bacteria, archaea are found generally similar to bacteria in

size and shape and do not contain a cell nucleus, interior membranes or organelles.

However, some unique features separate archaea from the bacteria including the lack

of peptidoglycan in the cell wall and use of ether-linked phospholipids with isoprenoid

chains. More importantly, based on the results of genome sequencing, many archaeal

genes and enzymes of basic information processing systems are found to be largely

Page 18: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

18

different from bacterial ones but similar to eukaryotic ones, making some archaeal

machinery more related to the eukaryotic system, especially for the process of DNA

replication (MacNeill, 2001), transcription (Bell and Jackson, 2001) and translation

(Dennis, 1997).

Many archaea are extremophiles existing in some of the most extreme

environmental conditions on Earth. Some archaea survive temperatures as high as 122

ºC (Takei et al., 2008), pressures as high as 40 MPa (Marteinsson et al., 1999), and pH

as low as 0 (Schleper et al., 1995).

Hfx. volcanii is a halophilic archaeon found in different hypersaline environments

such as the Dead Sea (Mullakhanbhai and Larsen, 1975). To inhabit environments at

NaCl concentrations of 1.7-2.5 M (Mullakhanbhai and Larsen, 1975), Hfx. volcanii cells

have evolved mechanisms for tolerating intracellular cations (Mevarech et al., 2000) and

maintaining protein activity in high concentration of salt.

In addition to being halophilic, Hfx. volcanii is also mildly acidophilic and grows

optimally at the temperature of 42 ºC in aerobic conditions (Mullakhanbhai and

Larsen,1975) on various carbon resources, such as sugars, sugar alcohols or low

molecular weight acids (Javor, 1984). Hfx. volcanii can also grow anaerobically with

dimethyl sulfoxide (DMSO), trimethylamine oxide (TMAO) (Oren and Truper, 1990),

fumarate (Oren, 1991) or nitrate (Bickel-Sankotter and Ufer, 1995) as alternative

electron acceptors in the absence of oxygen.

Different from many extremophiles, Hfx. volcanii can be cultured in the laboratory

on simple defined media without much difficulty, making it possible for further

biochemical and genetic study. A variety of methods have been developed in Hfx.

Page 19: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

19

volcanii, including genome sequencing, targeted gene deletion and affinity protein

purification (Soppa, 2006; Allers and Mevarech, 2005), making it a key model organism

for the biological research of archaea. Hfx. volcanii has a relatively stable genome, and

the genome of Hfx. volcanii strain DS2 was sequenced in 2010. It consists of a 2.848

Mb main chromosome and three smaller chromosomes named pHV1 (85 Kb), pHV3

(438 Kb), pHV4 (636 Kb) and a pHV2 plasmid (6.4 Kb) (Hartman et al., 2010).

Hypothesis

Our hypothesis for this study is that the HvRqc2 (HVO_2883, Rqc2 homolog of

Hfx. volcanii) is involved in ribosome rescue pathways of Hfx. volcanii. We propose that

HvRqc2 plays important role with protein partners in the rescue of the stalled ribosomes

during the process of translation elongation and the degradation of the stalled nascent

peptide chains.

Specific Aims

To test the hypothesis above, a gene deletion strain of rqc2 will be generated. If

the deletion of rqc2 is not lethal, the phenotype of this mutant will be compared to H26

parent strain in several growth assays. A growth assay under standard growth condition

will be performed to determine the importance of HvRqc2 for cell growth, while growth

assays with treatment with different antibiotics inhibiting translation initiation, translation

elongation and transcription will be used to determine a possible function of HvRqc2

during protein synthesis. An integration strain, which expresses C-terminal StrepII-His

tagged HvRqc2 from the genome, will be constructed to analyze the associated protein

partners of HvRqc2 by StrepII-His tandem affinity chromatography and mass

spectrometry. Reporter plasmids containing optimized stalling sequences will be

generated to induce ribosome stalling in Hfx. volcanii to facilitate the association of

Page 20: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

20

HvRqc2 with its protein partners and determine whether HvRqc2 protein can mediate

CAT tail modification of the nascent polypeptide chains on the stalled ribosome.

Page 21: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

21

Figure 1-1. Schematic representation of the tmRNA mediated trans-translation pathway

for ribosome rescue in bacteria. Photo courtesy of Kenneth C. Keiler. Schematic pathway showing the mechanism of trans-translation. 2015. Source: Keiler, K.C. (2015). Mechanisms of ribosome rescue in bacteria. Nat. Rev. Microbiol. 13, 285-297.

Figure 1-2. Model of ribosome rescue system in eukaryotes. Photo courtesy of Tarek

Hilal and Christian M. Spahn. Scheme of the Ribosomal Quality Control. 2015. Source: Hilal, T. and Spahn, C.M. (2015). Ribosome rescue and protein quality control in concert. Mol. Cell 57, 389-90.

Page 22: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

22

Figure 1-3. Rqc2 mediated C-terminal alanine and threonine (CAT) tail formation. (A)

Recognition of the A-site tRNA via the anticodon loop and D loop by Rqc2. (B) Rqc2 mediated CAT tail elongation of nascent chains. Photo courtesy of Onn Brandman and Ramanujan S. Hegde. CAT-tail formation by Rqc2p. 2015. Source: Brandman, O. and Hegde, R.S. (2016). Ribosome-associated protein quality control. Nat. Struct. Mol. Biol. 23, 7-15.

Page 23: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

23

CHAPTER 2 METHODS

Media

Luria-Bertani (LB) medium contained 10 g NaCl, 10 g tryptone, and 5 g yeast

extract in deionized water brought to a final volume of 1 liter adjusted to pH 7. ATCC

974 liquid medium contained 125 g NaCl, 50 g MgCl2•6H2O, 5 g K2SO4, 0.134 g

CaCl2•2H2O, 5 g tryptone, and 5 g yeast extract in deionized water brought to a final

volume of 1 liter adjusted to pH 6.8. Solid agar media consisted of the same ingredients

mixed with 15 g agar to make agar plates. Casamino acids (Hv-Ca) solid agar medium

contained 33 ml CA solution (1.65 g casamino acids and 776 l 1 M KOH in deionized

water to a final volume of 33 ml), 200 ml 30% (vol/vol) salt water (240 g NaCl, 30 g

MgCl2•6H2O, 35 g MgSO4•7H2O, 7 g KCl, and 20 ml 1 M Tris-HCl pH 7.5 in the final

volume of 1 liter), and 100 ml deionized H2O mixed with 5 g agar to make agar plates,

and 3 mM CaCl2, 0.8 g•ml-1 thiamin, 0.01 g•ml-1 biotin were added to the sterilized

mixture upon cooling to 50 ºC.

Strains and Growth Conditions

The strains used in this study are listed in Table 1-1. Recombinant plasmids were

constructed using Escherichia coli (E.coli) strain TOP10. E. coli strain GM2163 was

used to purify plasmid DNAs for transformation into Hfx. volcanii. Strains of E. coli were

grown at the temperature of 37 ºC under aerobic conditions in LB medium. Strains of

Hfx. volcanii were grown at the temperature of 42 ºC aerobically in ATCC 974 or Hv-CA

medium. Cells were grown aerobically in liquid medium with rotary shaking at 200 rpm

(revolutions per minute) or on solid agar plates. Ampicillin (100 g•ml-1), novobiocin (0.2

g •ml-1), 5-flouroorotic acid (5-FOA, 50 g•ml-1), uracil (50 g•ml-1) and tryptophan (2.5

Page 24: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

24

mM) were added as needed. Glycerol stocks for all strains were prepared by mixing

equal volume of stationary-phase cell culture with 40% (vol/vol) sterile glycerol in

cryogenic tubes. The glycerol stocks were maintained at -80 ºC.

DNA Extraction and Cloning

Genomic DNA of Hfx. volcanii was extracted from 8 ml cell cultures at optical

density at 600 nm (OD600) of 0.6 using the method of spooling (Dyall-Smith, 2009).

Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit from Qiagen (Hilden,

Germany). DNA was sequenced by Sanger sequencing (Interdisciplinary Center for

Biotechnology Research at University of Florida and GENEWIZ, South Plainfield, NJ).

Custom oligonucleotide primers were synthesized by Integrated DNA Technologies

(Coralville, IA).

The plasmids and primers used for this study are listed in Table 1-2 and Table 1-

3, respectively. DNA polymerases and restriction enzymes were from New England

Biolabs (Ipswich, MA). Phusion high-fidelity DNA polymerase was used for PCR

cloning. Taq DNA polymerase was used for colony PCR screening.

Generation of mutant strains

Hfx. volcanii mutant strains were generated by a pyrE2-based ‘pop-in/pop-out’

method (Figure 2-1; Bitan-Banin et al., 2003; Allers et al., 2004). Deletion and integrant

strains were identified by PCR using primer pairs specific to the genome immediately

flanking the genomic region on the plasmid used for the homologous gene

recombination in Hfx. volcanii. The deletion strain was further confirmed by Southern

blotting analysis using an optimized hybridization probe immediately 5’ to the targeted

gene. The probe was labeled by digoxigenin (DIG)-11-dUTP (Roche, Indianapolis, IN),

which was detected by polyclonal anti-DIG-alkaline phosphatase-linked antibody

Page 25: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

25

(Roche). The pattern of hybridization was visualized by chemiluminescence using

CSPD (Roche) with X-ray film (Hyperfilm; GE Healthcare Life Sciences, Pittsburgh, PA).

Phenotypic Analysis of Δrqc2 Mutant Strains

Strains were inoculated from -80 ºC glycerol stocks to ATCC 974 plates. The

ATCC 974 plates were incubated aerobically at 42 ºC for 5 days and kept at room

temperature (20 ºC) for 5 or 15 days. Strains were inoculated from ATCC 974 plates

into 4 ml ATCC 974 liquid medium in 13 x 100 mm culture tubes to serve as seed

cultures. Seed cultures were grown under standard aerobic growth conditions with

rotary shaking at 200 rpm at 42 ºC to early log phase (OD600 of 0.4). Seed cultures of

each strain were inoculated into 4 ml ATCC 974 medium in 13 x 100 mm culture tubes

to a final OD600 of 0.003 to serve as starter cultures. To obtain a standard growth curve

for each strain, starter cultures were grown aerobically at 42 ºC with rotary shaking at

200 rpm until cells reached an OD600 of 0.1, and then inoculated to 40 ml ATCC 974

medium in 250 ml Erlenmeyer flasks to a final OD600 of 0.003. Cultures were incubated

aerobically at 42 ºC with rotary shaking at 200 rpm. Experiments were performed in

biological triplicate and the growth of each strain was monitored at OD600 over a 50-hour

time period. To analyze drug sensitivity of Δrqc2 mutant strains, seed cultures were

inoculated to 4 ml ATCC 974 medium in 13 x 100 mm culture tubes. Cultures were

grown aerobically at 42 ºC with rotary shaking at 200 rpm until cells reached an OD600 of

0.4. Cells were treated with and without blasticidin S (200 g•ml-1) by incubation for 10

hours at 42 ºC with rotary shaking at 200 rpm. Serial dilutions (10-1 to 10-5) of the cell

cultures were performed. Each dilution was spotted in a row on ATCC 974 agar plates.

Page 26: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

26

The spotted ATCC 974 agar plates were grown aerobically at the temperature of 42 ºC

for 6 days.

Protein Purification

Strains were inoculated from ATCC 974 plates into 4 ml ATCC 974 liquid

medium in 13 x 100 mm culture tubes to serve as seed cultures. Seed cultures were

grown under standard aerobic growth conditions with rotary shaking at 200 rpm at 42 ºC

to early log phase (OD600 of 0.4). Seed cultures of each strain were subcultured into 4 1-

liter cultures in 2.8-liter Fernbach flasks to a final OD600 of 0.0003. Cells were grown

aerobically with rotary shaking at 200 rpm at 42 ºC to log phase (OD600 of 2) and

harvested by centrifugation (9,000 × g for 20 min at 20°C). Cell pellets were

resuspended at 5 ml per 1 g (wet weight) cells in Tris-salt buffer (2 M NaCl, 50 mM Tris-

HCl, pH 7.4) supplemented with 1 minitablet EDTA-free protease inhibitor cocktail

(Roche) per 40 ml buffer and lysed by French press 5 times (20,000 lb/in2). Cell debris

was removed by centrifugation (10,000 × g for 20 min at 4°C) and the cell lysate was

further clarified by filtration using 0.8-m and 0.45-m cellulose acetate filters (Thermo

Scientific). For StrepII affinity purification, clarified cell lysate (480 mg protein per 32 ml)

was applied to Strep-Tactin Superflow Plus Cartridge (1 ml; Qiagen). The Strep-Tactin

Cartridge was washed with 120 ml Tris-salt buffer to remove unbound proteins. StrepII-

tagged proteins were eluted in Tris-salt buffer supplemented with 2.5 mM d-

desthiobiotin. For StrepII-His tandem affinity purification, clarified cell lysate (480 mg

protein per 32 ml) was first applied to a HisTrap HP column (1 ml, GE Healthcare Life

Sciences). The HisTrap HP column was washed with 120 ml Tris-salt buffer

supplemented with 40 mM imidazole to remove unbound proteins, and proteins from the

Page 27: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

27

HisTrap column were eluted in Tris-salt buffer supplemented with 500 mM imidazole.

Eluted fractions were then applied to the Strep-Tactin Cartridge for StrepII affinity

purification to further purify Strep-His tandem tagged proteins. Protein concentration

was determined by bicinchoninic acid (BCA) assay (Thermo Fisher Scientific, Rockville,

IL) using bovine serum albumin (BSA) as the protein standard.

Immunoblotting Analysis

Immunoblotting analysis was performed as follows. Protein samples were boiled

for 10 min in SDS loading buffer (100 mM Tris-Cl, pH 6.8, 0.6 mg·mL−1 bromophenol

blue, 10% w/v glycerol, 2% w/v SDS and 2.5% w/v β-mercaptoethanol) and centrifuged

at 13,000 × g for 10 min to obtain the supernatant. Samples were separated by SDS-

PAGE (10% or 12%) and transferred to 0.5 m polyvinylidene difluoride (PVDF)

membranes (GE Healthcare Life Sciences) by electroblotting (150 Volts, 180 min).

StrepII affinity tagged proteins on PVDF membranes were analyzed by immunoblotting

using mouse anti-StrepII polyclonal antibody (Qiagen; 1:60,000 dilution) followed by

goat anti-mouse IgG (whole molecule)-alkaline phosphatase-linked antibody (Sigma-

Aldrich, St. Louis, MO; 1:60,000 dilution). Immunoreactive antigens were detected by

chemiluminescence using CDP-Star (Thermo Fisher Scientific) as the substrate for

alkaline phosphatase. smRSGFP were analyzed by immunoblotting using Living Colors

Aequorea victoria peptide rabbit immunoglobulin anti-GFP antibody (Clontech

Laboratories, Palo Alto, CA; 1:400 dilution) followed by Horseradish peroxidase-

conjugated anti-rabbit immunoglobulin (H+L) antibody raised in goats (Southern

Biotechnology, Birmingham, AL; 1:4,000 dilution). mCherry were analyzed by

immunoblotting using rabbit anti-mCherry polyclonal antibody (abcam, Cambridge, MA;

Page 28: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

28

1:1000 dilution) followed by Horseradish peroxidase-conjugated anti-rabbit

immunoglobulin (H+L) antibody raised in goats (Southern Biotechnology; 1:4,000

dilution). Immunolabeled smRSGFP and mCherry were visualized by

chemiluminescence using ECL Prime Western Blotting Detection Reagent (GE

Healthcare Life Sciences). Chemiluminescence was monitored with X-ray film

(Hyperfilm; GE Healthcare Life Sciences). For loading control, an equivalent amount of

protein for each sample determined by BCA assay or OD600 of whole cells was

separated by SDS-PAGE (10% or 12%) and stained with Coomassie blue or SYPRO

Ruby (Thermo Fisher Scientific).

Ribosome Stalling Reporter

Ribosome stalling reporter plasmids were constructed by cloning genes encoding

two fluorescent proteins, smRSGFP (a soluble modified derivative of green fluorescent

protein [GFP] with red-shifted mutation; Reuter and Maupin-Furlow, 2004) and mCherry

fluorescent protein. Genes encoding smRSGFP and mCherry were amplified from

pJAM1020 and pFPV-mCherry plasmids respectively by PCR. The stop codon of

smRSGFP was replaced by tracts of consecutive rare codons encoding 4 lysine

residues, serving as the stalling signal (Figure 2-2). The DNA fragment was ligated with

T4 DNA ligase (New England Biolabs) to pJAM3136 plasmid. The fluorescent reporter

genes were positioned to be regulated by a tryptophan-inducible promoter PtnaA

promoter, which is tightly controlled by tryptophan (Large et al., 2009). A non-stalling

plasmid encoding smRSGFP and mCherry both with stop codons, was constructed as

the control for the ribosome stalling reporter. The ribosome stalling reporter plasmid and

control reporter plasmid were transformed into E. coli TOP10 cells, and the

Page 29: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

29

transformants were screened by PCR for the presence of the inserted genes using the

primers which generated the inserts.

Page 30: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

30

Table 2-1. Strains

Strain Description Source or reference

E. coli Top10

F– recA1 endA1 hsdR17(rK

– mK+)

supE44 thi-1 gyrA relA1

Invitrogen

GM2163 F– ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 rpsL136 dam13::Tn9 xylA5 mtl-1 thi-1 mcrB1 hsdR2

New England Biolabs

Hfx. volcanii

DS70 wild-type isolate DS2 cured of plasmid pHV2

Wendoloski et al., 2001

H26 DS70 ΔpyrE2 Allers et al., 2004 QL01 DS70 Δrqc2* This study

*rqc2, HVO_2883.

Page 31: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

31

Table 2-2. Plasmids

Plasmid Description Source or reference

pJAM202c Ampr; Novr; Hfx. volcanii-E. coli shuttle plasmid, empty vector carrying P2rrna-His

Zhou et al., 2010

pJAM809 Ampr; Novr; pJAM202c carrying P2rrna-Hvo_1862-StrepII

Humbard et al., 2009

pTA131 pBluescript II carrying Pfdx-pyrE2 with MCS a

Allers et al., 2004

pJAM1020 Ampr; Novr; pJAM202c carrying P2rrnA-smRSGFP

Reuter and Maupin-Furlow, 2004

pJAM3136 Ampr; Novr; pJAM202c carrying PtnaAM3-StrepII

Hwang, unpublished

pJAM3250 Ampr; Novr; pJAM202c carrying P2rrnA-Rqc2-StrepII

This study

pJAM3251 Ampr; Novr; pTA131-based pre-knockout plasmid for rqc2

This study

pJAM3252 Ampr; Novr; pTA131-based knockout plasmid for rqc2

This study

pJAM3253 Ampr; Novr; pTA131-based Rqc2-StrepII, C-terminal fusion to StrepII

This study

pJAM3254 Ampr; Novr; pJAM202c carrying PtnaAM3-smRSGFP-STOP b

This study

pJAM3255 Ampr; Novr; pJAM202c carrying PtnaAM3-smRSGFP-K4-NSTOP c, d

This study

pJAM3256 Ampr; Novr; pJAM202c carrying PtnaAM3- smRSGFP-STOP-mCherry

This study

pJAM3257 Ampr; Novr; pJAM202c carrying PtnaAM3- smRSGFP-K5-NSTOP-mCherry

This study

pJAM3258 Ampr; Novr; pTA131-based Rqc2-StrepII-His, C-terminal fusion to StrepII and polyhistidine

This study

pJAM3259 Ampr; Novr; pJAM202c carrying P2rrnA-Rqc2

This study

pFPV-mCherry Ampr; pFPV vector carrying mCherry Addgene a MCS, multiple cloning site. b STOP, stop codon. c K4, sequence encoding 4 lysine residues using rare codons (AAA AAA AAA AAA). d NSTOP, no stop codon.

Page 32: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

32

Table 2-3. Primers

Primer Pair Primer sequence (5’-3’) Description

Rqc2 NdeI FW Rqc2 KpnI RV

AGCATATGGATCCGAAGCGGGAACTCACG ATGGTACCCTCGTCGACGATATCGCTCCCGC

Rqc2-StrepII

Rqc2 500bp FW Rqc2 500bp RV

TCGGTACCACCCCGTCGTCGTGGAAGTATCCA TAAGCTTGGATCCGTCATGATGCCGCCGAAGATGCCCGC

rqc2 pre-knockout

Rqc2 INV FW Rqc2 INV RV

GGTAATCGGGCGTTAGACG GAACGAAAAGGGGTGTCGT

rqc2 knockout

Rqc2 700bp FW Rqc2 700bp RV Rqc2 21bp RV

TGAGGTACGTCTGGCTCCC GTCGGTCGGTCTCAGCGT ACGAAAAGGGGTGTCGTTTCCGCG

confirmation of rqc2 knockout

Rqc2 StrepII INT FW Rqc2 StrepII INT RV

CAGTTCGAAAAATGAACGTCGCCGCCTTCGGGT CGGGTGGCTCCAGGTACCCTCGTCGACGATATC Rqc2 C-terminal

fusion to StrepII

Rqc2 StrepII-His INT FW Rqc2 StrepII-His INT RV

CACCACTGAACGTCGCCGCCTTCG GTGGTGGTGGTGGGTACCTTTTTCGAACTG

Rqc2 C-terminal fusion to StrepII and polyhistidine

smRSGFP FW smRSGFP Stop RV smRSGFP NonStop RV

GCGGATCCTAGAAATAATTTTGTTTAA GAGCTCAGCTATTTTTTTCATTATTTGTATAGTTCATCCAT GAGCTCAGCTATTTTTTTTTTTTTTTGTATAGTTCATCCAT

smRSGFP-STOP smRSGFP-K4-NSTOP

mCherry S FW mCherry NS FW mCherry RV

ACAAATAATGAAAAAAATAGCGTGAGCAAGGGCGAGGAGGATAACATGGCC ATACAAAAAAAAAAAAAAATAGCGTGAGCAAGGGCGAGGAGGATAACATGGCC GTTATGCTAGTTATTGCTTACTTGTACAGCTCGTCCATGCCGCCGGTG

smRSGFP-STOP-mCherry smRSGFP-K4-NSTOP-mCherry

Rqc2 Comp FW Rqc2 Comp RV

AGCTTGCGGCCGCACTCGAGC CTCGTCGACGATATCGCTCCCGCC

Rqc2 complementation

Page 33: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

33

Figure 2-1. pyrE2 based pop-in/pop-out gene knockout system. A plasmid carrying the

flanking regions of the gene to be deleted and pyrE2 marker is used for gene knockout in the ΔpyrE2 Hfx. volcanii H26 strain. Photo courtesy of Thorsten Allers, Hien-Ping Ngo, Moshe Mevarech and Robert G. Lloyd. Gene knockout system based on the pyrE2 gene. 2004. Source: Allers, T., Ngo, H.P., Mevarech, M., and Lloyd, R.G. (2004). Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl. Environ. Microbiol. 70, 943-953.

Figure 2-2. Ribosome stalling reporter plasmid encoding nonstop (lacking stop codons)

GFP fusion proteins containing lysine residues encoded by rare codons followed by mCherry.

Page 34: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

34

CHAPTER 3 RESULTS

Bioinformatic Analyses of Rqc2

We identified the proteins which are hypothesized to be involved in ribosome

rescue pathways in the archaeon Hfx. volcanii by comparative genomic analysis (Table

2-1). Homologs of eukaryotic ubiquitin E3 ligase Ltn1 and Rqc1 were not identified in

Hfx. volcanii. However, homologs of eukaryotic ribosome rescue factors including

translation release factors RF1 and RF3, nonstop mRNA decay factor Ski7, stalled

ribosome rescue factor Pelota, ribosome recycling factor ABCE1, as well as RQC

components Rqc2 and the AAA ATPase Cdc48 were identified in Hfx. volcanii.

Proteasomes and ubiquitin-like SAMPs were also found in Hfx. volcanii. However, a

bacterial tmRNA-mediated ribosome rescue system was not identified in Hfx. volcanii.

Further analysis revealed that Hfx. volcanii (Hv) Rqc2 was related to yeast Rqc2

in protein domain architecture. The M domain of yeast Rqc2, which is likely to interact

with the eukaryotic ubiquitin E3 ligase Ltn1 N-terminal helix (Shao et al., 2015), was

missing in HvRqc2. However, the remaining protein domain architectures were similar.

Both yeast and archaeal Rqc2 proteins contained the catalytic N-terminal NFACT-N

domain, required for binding peptidyl tRNA on the stabled ribosome to trigger RQC

pathway, and mediate CAT tail synthesis of the stalled nascent polypeptide chains in

yeast (Figure 3-1). Given the homology to some of the eukaryotic ribosome rescue

factors in Hfx. volcanii, the results suggested that HvRqc2 may have similar functions

during ribosome stalling.

Page 35: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

35

Generation of C-terminal Tagged Rqc2 Expression Strains

To further understand Rqc2 function in archaea, the HvRqc2 protein was

expressed in trans with a C-terminal StrepII tag and purified from Hfx. volcanii by StrepII

affinity purification. A single predominant protein band was detected in the purified

fractions by anti-StrepII immunoblotting from the strain expressing HvRqc2-StrepII in

trans compared to the empty vector control (Figure 3-2). The molecular mass of

HvRqc2-StrepII observed by SDS-PAGE (120 kDa) was larger than the theoretical

molecular mass (80 kDa) estimated by the deduced protein sequence. The theoretical

pI (isoelectric point) of HvRqc2-StrepII was calculated to be 4.36. Thus, the slower

migration of HvRqc2 may due to an altered SDS coating of the acidic polypeptide as

supported by previous study of other acidic proteins (Reed et al., 2013; Peck, 2006).

The protein samples purified by Strep-Tactin affinity chromatography were further

analyzed by staining with SYPRO Ruby to address the associated protein partners of

HvRqc2. However, we only identified a specific band for HvRqc2 from the strain

expressing HvRqc2-StrepII in trans compared to the empty vector control (Figure 3-2).

To maintain an appropriate ratio of HvRqc2 to its protein partners, an HvRqc2-

StrepII integrant strain was generated by a pyrE2-based ‘pop-in/pop-out’ method

(details in Methods). A StrepII affinity purification was performed and a single

predominant protein band was detected at 120 kDa by anti-StrepII immunoblotting,

which corresponded to the HvRqc2-StrepII integrant strain. However, the yield of protein

purified from the HvRqc2-StrepII integrant strain and H26 parent strain was low (protein

concentration was less than 5 g•ml-1). Multiple bands were detected for both the

HvRqc2-StrepII integrant strain and the H26 parent strain based on total protein stain

Page 36: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

36

(Figure 3-3). HvRqc2 associated protein partners were not identified due to this high

background of non-specific proteins.

Thus, we generated a HvRqc2-StrepII-His integrant strain which had an added

polyhistidine tag to identify the associated protein partners of HvRqc2. The purity of

protein partners specifically associated with HvRqc2 was increased by a tandem affinity

tag purification approach using this HvRqc2-StrepII-His integrant strain. Two protein

bands, which corresponded to the HvRqc2-StrepII-His integrant strain, were detected by

SYPRO Ruby staining at 120 kDa (HvRqc2-StrepII-His) and 60 kDa (Figure 3-4).

Generation of rqc2 Deletion Strain

An rqc2 deletion strain was generated by pyrE2 pop-in/pop-out system for

homologous recombination (details in Methods). Deletion strains were identified by PCR

of genomic DNA using primers annealing specifically to 700 bp 5’ and 3’ of the rqc2

gene on the genome and outside the deletion plasmid. The PCR product generated from

the putative Δrqc2 mutant Hfx. volcanii QL01 was 1.4 kb, and carried only the flanking

regions of rqc2 gene (the open reading frame encoding the protein was deleted) (Figure

3-4). Compared to the putative Δrqc2 mutant strain, the PCR products generated from

the parental strain were 3.5 kb, which was consistent with amplification of the rqc2 gene

(2.1 kb) and its flanking regions (Figure 3-5).

To provide further evidence for the absence of the rqc2 gene from the genome of

the Hfx. volcanii QL01 strain, Southern blotting analysis was performed using a probe

immediately 5’ to the rqc2 gene. The genomic DNA from the putative Δrqc2 mutant

strain QL01 identified by PCR was digested by BanII restriction enzyme which was

predicted to cleave at 0.95 kb upstream and 0.54 kb downstream of the rqc2 gene

based on genome sequence. The presence of a band at 1.5 kb confirmed that strain

Page 37: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

37

QL01 was an Δrqc2 mutant compared to the 3.6 kb band for the H26 parent strain

(Figure 3-6).

Deletion of rqc2 Reduced Cell Growth

While deletion of the rqc2 gene reduces the rate of protein biosynthesis in yeast

(Alamgir et al., 2010), the function of the rqc2 gene in archaea remains largely

unknown. Here we monitored growth of the Δrqc2 mutant compared to its parent H26A.

The growth of the Δrqc2 strain was found to be 8.2% slower than the H26 parent strain,

with a doubling time of 5.3 hours, compared to the doubling time of H26 parent strain,

which was 4.9 hours (Figure 3-7). These results suggest that rqc2 is an important gene

for the growth of Hfx. volcanii.

Deletion of rqc2 Increased Sensitivity to Translation Inhibitor Blasticidin S

To determine a possible role of Rqc2 during protein biosynthesis in Hfx. volcanii,

a chemical inhibitory compound was used to target a specific step of protein synthesis.

Blasticidin S, a compound that inhibits the process of translation elongation by binding

to the P site of 60S ribosomal subunit and prevents peptidyl-transferase reaction

(Svidritskiy et al., 2013), was used in the drug sensitivity analysis. Deletion of rqc2 was

found to confer increased sensitivity to blasticidin S compared to the H26 parent strain

(Figure 3-8), suggesting that HvRqc2 is involved in the process of translation during

protein synthesis.

Generation of Ribosome Stalling Reporters

Anti-GFP and anti-mCherry immunoblotting is ongoing to test whether the

ribosome stalling reporter can cause translation stalling in Hfx. volcanii. Protein bands of

25-kDa which correspond to the smRSGFP are expected to be detected by anti-GFP

immunoblotting for the strains carrying stalling reporters or non-stalling reporters, while

Page 38: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

38

27-kDa protein bands corresponding mCherry are expected to be detected only for the

strains carrying non-stalling reporters by anti-mCherry immunoblotting.

Page 39: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

39

Table 3-1. Ribosome rescue factors of bacteria, eukaryotes and Hfx. volcanii.

Ribosome rescue factors Bacteria Eukaryotes Hfx. volcanii

Translation release factors RF1 RF2 RF3 eRF1 eRF3 HvRF1 HvEF1α

Stalled ribosome rescue factors ArfA ArfB ePelota Hbs1 HvPelota HvEF1α

Non-stop mRNA decay factors SmpB-tmRNA-EF-tu Ski7 HvEF1α

Ribosome recycling factors RRF EF-G eABCE1 HvABCE1

RQC complex

Rqc1 ? eRqc2 HvRqc2 eCdc48 HvCdc48

Ubiquitylation/Ubiquitylation-like Ltn1 ?

Ubiquitin SAMPs

Nascent chain degradation Proteases Proteasome Proteasome

mRNA degradation RNase R Exosome Exosome Blank, no related factors. ?, homologs not predicted by bioinformatics.

Page 40: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

40

Figure 3-1. Domain architectures of Rqc2 proteins in Saccharomyces cerevisiae and

Haloferax volcanii (upper and lower, respectively). CC, coiled-coil; HhH, helix-hairpin-helix.

Page 41: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

41

A

B

Figure 3-2. HvRqc2-StrepII expression in trans. A) StrepII purified in trans expressed

HvRqc2-StrepII was detected by anti-StrepII immunoblotting B) SYPRO Ruby staining of purified fractions.

Page 42: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

42

A

B

Figure 3-3. HvRqc2-StrepII expression from the Rqc2-StrepII integrant strain. A) StrepII

purified HvRqc2-StrepII from the Rqc2-StrepII integrant strain was detected by anti-StrepII immunoblotting. B) SYPRO Ruby staining of purified fractions.

Page 43: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

43

Figure 3-4. Protein bands at 120 kDa (HvRqc2-StrepII-His) and 60 kDa from the

HvRqc2-StrepII-His integrant strain were detected by SYPRO Ruby staining of StrepII-His tandem purified fractions.

Figure 3-5. Identification of Δrqc2 mutant by PCR. A 1.4 kb PCR product generated

from the Δrqc2 mutant strain corresponds to gene flanking regions. A larger 3.5 kb PCR product generated from H26 parent strain corresponds to the gene plus gene flanking regions.

Page 44: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

44

A

B

Figure 3-6. Schematic of Southern blotting analysis of the Δrqc2 mutant strain. A) A

probe immediately 5’ to the rqc2 gene was used to generate a 1.5 kb fragment from the Δrqc2 mutant strain corresponding to the flanking regions of rqc2, and a 3.6 kb fragment from H26 parent strain corresponding to the flanking regions and rqc2 gene. B) The Δrqc2 mutant was confirmed by the presence of 1.5 kb band compared to the 3.6 kb band for the H26 parent strain.

Page 45: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

45

Figure 3-7. The Δrqc2 mutant strain grows slower than the H26 parent strain under

standard aerobic growth condition. OD600 was measured at time points from 15 to 51 hours to determine the growth rates. Error bars represent standard deviation. td, doubling time.

Figure 3-8. The Δrqc2 strain is more sensitive to the treatment with the translation

elongation inhibitor blasticidin S compared to H26 parent strain. The Δrqc2 mutant strain and H26 parent strain were serially diluted to 10-3 to 10-6 after 10 h treatment with and without blasticidin S and spotted on ATCC 974 solid medium.

Page 46: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

46

CHAPTER 4 DISCUSSION

To overcome ribosome stalling during protein biosynthesis and maintain cellular

fitness, organisms have evolved mechanisms known as ribosome rescue (Defenouillère

et al., 2013). While ribosome rescue pathways have been investigated in bacteria and

eukaryotes, little work has been done in archaea. Proteins related to eukaryotic

ribosome rescue factors are found to be conserved in archaea, including translation

release factors RF1 and EF1α, splitting factor Pelota and ABCE1, as well as RQC

components Cdc48 and Rqc2. Here we provide evidence for understanding the function

of the Rqc2 homolog of Hfx. volcanii, which may provide an insight into understanding

ribosome rescue system in archaea.

Deletion of the rqc2 gene leads to a reduction in the rate of cell growth,

suggesting the importance of Rqc2 for the growth of Hfx. volcanii. The Δrqc2 mutant

strain also exhibited an increased sensitivity to blasticidin S, a translation elongation

inhibitor, strongly indicating that the function of Rqc2 is linked with protein biosynthesis.

Future experiments to be performed include using different inhibitory compounds

targeting specific steps of transcription and translation. Actinomycin D, which binds

strongly to duplex DNA and minimizes the synthesis of mRNA (Sobell, 1985), can be

used to investigate the role of Rqc2 for transcription. Puromycin, an analog of the

terminal aminoacyl-adenosine part of aminoacyl-tRNA which disrupts translation

process by causing premature peptide chain termination before chain elongation (Sanz

et al., 1993), can be used to investigate the role of Rqc2 for translation elongation. With

previous work showing that in eukaryotes the RQC complex rescues stalled ribosomes

during translation elongation (Yonashiro et al., 2016), it is possible that the function of

Page 47: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

47

Rqc2 is involved in translation elongation. To assign the ribosome-associated functions

of Rqc2, it is important to analyze the Rqc2 protein partners. The Rqc2-StrepII-His

integrant strain was generated to facilitate this analysis by enabling the stoichiometry of

Rqc2 to be maintained in the cell and allowing the Rqc2 associated partners to be

purified by tandem affinity purification. A protein with molecular mass of 60 kDa with

HvRqc2 were detected in the purified fractions. Future work will include identification of

the co-purified protein at 60 kDa by mass spectrometry analysis.

The experiments to confirm that the ribosome stalling reporter leads to translation

stalling are still ongoing. Expression of only one fluorescent protein (smRSGFP) is

expected for stalling reporter compared to expression of both fluorescent proteins for

non-stalling control reporter. To determine whether Rqc2 mediates CAT tail modification

of the nascent polypeptide chains on the stalled ribosome, future work may include size

comparison of smRSGFP expressed from the Δrqc2 mutant strain/H26 parent strain

carrying the stalling reporter and amino acid analysis of the modified smRSGFP.

Page 48: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

48

LIST OF REFERENCES

Alamgir, M., Erukova, V., Jessulat, M., Azizi, A. and Golshani, A. (2010). Chemical-genetic profile analysis of five inhibitory compounds in yeast. BMC Chem. Biol. 2010, 10: 6.

Allers, T., Ngo, H.P., Mevarech, M., and Lloyd, R.G. (2004). Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl. Environ. Microbiol. 70, 943-953.

Allers, T., and Mevarech, M. (2005). Archaeal genetics - the third way. Nat. Rev. Genet. 6, 58-73.

Aravind, L., Walker, D.R. and Koonin, E.V. (1999). Conserved domains in DNA repair proteins and evolution of repair systems. Nucleic Acids Res. 27, 1223-1242.

Becker, T., Franckenberg, S., Wickles, S., Shoemaker, C.J., Anger, A.M., Armache, J.P., Sieber, H., Ungewickell, C., Berninghausen, O., Daberkow, I., Karcher, A., Thomm, M., Hopfner, K.P., Green, R. and Beckmann, R. (2012). Structural basis of highly conserved ribosome recycling in eukaryotes and archaea. Nature 482, 501-506.

Bell, S.D., and Jackson, S.P. (2001). Mechanism and regulation of transcription in archaea. Curr. Opin. Microbiol. 4, 208-213.

Bengtson, M.H. and Joazeiro, C.A. (2010). Role of a ribosome-associated E3 ubiquitin ligase in protein quality control. Nature 467, 470-473.

Bickel-Sankötter, S., and Ufer, M. (1995). Properties of a dissimilatory nitrate reductase from the halophilic archaeon Haloferax volcanii. Z. Naturforsch., C: Biosci. 50, 365–372.

Bitan-Banin, G., Ortenberg, R., and Mevarech, M. (2003). Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J. Bacteriol. 185, 772-778.

Brandman, O. and Hegde, R.S. (2016). Ribosome-associated protein quality control. Nat. Struct. Mol. Biol. 23, 7-15.

Brandman, O., Stewart-Ornstein, J., Wong, D., Larson, A., Williams, C.C., Li, G.W., Zhou, S., King, D., Shen, P.S., Weibezahn, J., Dunn, J.G., Rouskin, S., Inada, T., Frost, A. and Weissman, J.S. (2012). A ribosome-bound quality control complex triggers degradation of nascent peptides and signals translation stress. Cell 151, 1042-1054.

Burroughs, A.M. and Aravind, L. (2014). A highly conserved family of domains related to the DNA-glycosylase fold helps predict multiple novel pathways for RNA modifications. RNA Biol. 11, 360-372.

Page 49: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

49

Choe, Y.J., Park, S.H., Hassemer, T., Körner, R., Vincenz-Donnelly, L., Hayer-Hartl, M. and Hartl, F.U. (2016). Failure of RQC machinery causes protein aggregation and proteotoxic stress. Nature 531, 191-195.

Choy, J.S., Aung, L.L. and Karzai, A.W. (2007). Lon protease degrades transfer-messenger RNA-tagged proteins. J. Bacteriol. 189, 6564-6571.

Defenouillère, Q., Yao, Y., Mouaikel, J., Namane, A., Galopier, A., Decourty, L., Doyen, A., Malabat, C., Saveanu, C., Jacquier, A. and Fromont-Racine, M. (2013). Cdc48-associated complex bound to 60S particles is required for the clearance of aberrant translation products. Proc. Natl. Acad. Sci. USA 110, 5046-5051.

Dennis, P.P. (1997). Ancient ciphers: translation in Archaea. Cell 89, 1007-1010.

Dimitrova, L.N., Kuroha, K., Tatematsu, T. and Inada, T. (2009). Nascent peptide-dependent translation arrest leads to Not4p-mediated protein degradation by the proteasome. J. Biol. Chem. 284, 10343-10352.

Doherty, A.J., Serpell, L.C. and Ponting, C.P. (1996). The helix-hairpin-helix DNA-binding motif: a structural basis for non-sequence-specific recognition of DNA. Nucleic Acids Res. 24, 2488-2497.

Dyall-Smith, M. (2009). The halohandbook: protocols for haloarchaeal genetics. http://www.haloarchaea.com/resources/halohandbook

Fan, J.Y., Cui, Z.Q., Wei, H.P., Zhang, Z.P., Zhou, Y.F., Wang, Y.P. and Zhang, X.E. (2008). Split mCherry as a new red bimolecular fluorescence complementation system for visualizing protein–protein interactions in living cells. Biochem. Biophys. Res. Commun. 367, 47-53.

Flynn, J.M., Levchenko, I., Seidel, M., Wickner, S.H., Sauer, R.T. and Baker, T.A. (2001). Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. USA 98, 10584-10589.

Gottesman, S., Roche, E., Zhou, Y. and Sauer, R.T. (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. Genes Dev. 12, 1338-1347.

Hartman, A.L., Norais, C., Badger, J.H., Delmas, S., Haldenby, S., Madupu, R., Robinson, J., Khouri, H., Ren, Q., Lowe, T.M., Maupin-Furlow, J.A., Pohlschroder, M., Daniels, C., Pfeiffer, F., Allers, T. and Eisen, J. (2010). The complete genome sequence of Haloferax volcanii DS2, a model archaeon. PLoS One 5, e9605.

Herman, C., Thévenet, D., Bouloc, P., Walker, G.C. and D'Ari, R. (1998). Degradation of carboxy-terminal-tagged cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev. 12, 1348-1355.

Page 50: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

50

Hilal, T. and Spahn, C.M. (2015). Ribosome rescue and protein quality control in concert. Mol. Cell 57, 389-90.

Humbard, M.A., Miranda, H.V., Lim, J.M., Krause, D.J., Pritz, J.R., Zhou, G., Chen, S., Wells, L. and Maupin-Furlow, J.A. (2010). Ubiquitin-like small archaeal modifier proteins (SAMPs) in Haloferax volcanii. Nature 463, 54-60.

Ito-Harashima, S., Kuroha, K., Tatematsu, T., and Inada, T. (2007). Translation of the poly(A) tail plays crucial roles in nonstop mRNA surveillance via translation repression and protein destabilization by proteasome in yeast. Genes Dev. 21, 519-524.

Javor, B.J. (1984). Growth potential of halophilic bacteria isolated from solar salt environments: carbon sources and salt requirements. Appl. Environ. Microbiol. 48, 352-360.

Karzai, A.W., Susskind, M.M. and Sauer, R.T. (1999). SmpB, a unique RNA-binding protein essential for the peptide-tagging activity of SsrA (tmRNA). EMBO J. 18, 3793-3799.

Keiler, K.C., Waller, P.R. and Sauer, R.T. (1996). Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science 271, 990-993.

Keiler, K.C. (2015). Mechanisms of ribosome rescue in bacteria. Nat. Rev. Microbiol. 13, 285-297.

Large, A., Stamme, C., Lange, C., Duan, Z., Allers, T., Soppa, J. and Lund, P.A. (2007). Characterization of a tightly controlled promoter of the halophilic archaeon Haloferax volcanii and its use in the analysis of the essential cct1 gene. Mol. Microbiol. 66, 1092-1106.

Letzring, D.P., Dean, K.M. and Grayhack, E.J. (2010). Control of translation efficiency in yeast by codon-anticodon interactions. RNA 16, 2516-2528.

Li, X., Hirano, R., Tagami, H. and Aiba, H. (2006). Protein tagging at rare codons is caused by tmRNA action at the 3' end of nonstop mRNA generated in response to ribosome stalling. RNA 12, 248-255.

Lu, J. and Deutsch, C. (2008). Electrostatics in the ribosomal tunnel modulate chain elongation rates. J. Mol. Biol. 384, 73-86.

MacNeill, S.A. (2001). Understanding the enzymology of archaeal DNA replication: progress in form and function. Mol. Microbiol 40, 520-529.

Mansouri, S., Kutky, M. and Hudak, K.A. (2012). Pokeweed antiviral protein increases HIV-1 particle infectivity by activating the cellular mitogen activated protein kinase pathway. PLoS One 7, e36369.

Page 51: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

51

Marteinsson, V.T., Birrien, J.L., Reysenbach, A.L., Vernet, M., Marie, D., Gambacorta, A., Messner, P., Sleytr, U.B., and Prieur, D. (1999). Thermococcus barophilus sp. nov., a new barophilic and hyperthermophilic archaeon isolated under high hydrostatic pressure from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 49 Pt 2, 351-359.

Maupin-Furlow, J.A. (2013). Archaeal proteasomes and sampylation. Subcell Biochem. 66, 297-327.

Mevarech, M., Frolow, F., and Gloss, L.M. (2000). Halophilic enzymes: proteins with a grain of salt. Biophys. Chem. 86, 155-164.

Mullakhanbhai, M.F., and Larsen, H. (1975). Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Arch. Microbiol. 104, 207-214.

Oren, A., and Truper, H.G. (1990). Anaerobic growth of halophilic archaeobacteria by reduction of dimethylsulfoxide and trimethylamine N-oxide. FEBS Microbiol. Lett. 70, 33-36.

Oren, A. (1991). Anaerobic growth of halophilic archaeobacteria by reduction of fumarate. J. Gen. Microbiol. 137, 1387-1390.

Palade, G.E. (1955). A small particulate component of the cytoplasm. J. Biophys. Biochem. Cytol. 1, 59-68.

Peck, S.C. (2006). Analysis of protein phosphorylation: methods and strategies for studying kinases and substrates. Plant J. 45, 512-522.

Pisareva, V.P., Skabkin, M.A., Hellen, C.U., Pestova, T.V. and Pisarev, A.V. (2011). Dissociation by Pelota, Hbs1 and ABCE1 of mammalian vacant 80S ribosomes and stalled elongation complexes. EMBO J. 30, 1804-1817.

Ramakrishnan, V. (2002). Ribosome structure and the mechanism of translation. Cell 108, 557-572.

Ramrath, D.J., Yamamoto, H., Rother, K., Wittek, D., Pech, M., Mielke, T., Loerke, J., Scheerer, P., Ivanov, P., Teraoka, Y., Shpanchenko, O., Nierhaus, K.H. and Spahn, C.M. (2012). The complex of tmRNA-SmpB and EF-G on translocating ribosomes. Nature 485, 526-529.

Reed, C.J., Lewis, H., Trejo, E., Winston, V. and Evilia, C. (2013). Protein adaptations in archaeal extremophiles. Archaea 2013: 373275.

Page 52: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

52

Reuter, C.J., and Maupin-Furlow, J.A. (2004). Analysis of proteasome-dependent proteolysis in Haloferax volcanii cells, using short-lived green fluorescent proteins. Appl. Environ. Microbiol. 70, 7530-7538.

Reuter, C.J., Uthandi, S., Puentes, J. and Maupin-Furlow, J.A. (2010). Hydrophobic carboxy-terminal residues dramatically reduce protein levels in the haloarchaeon Haloferax volcanii. Microbiology 156, 248-255.

Ring, G and Eichler, J. (2004). In the Archaea Haloferax volcanii, membrane protein biogenesis and protein synthesis rates are affected by decreased ribosomal binding to the translocon. J. Biol. Chem. 279, 53160-53166.

Rodrigo-Brenni, M.C. and Hegde, R.S. (2012). Design principles of protein biosynthesis-coupled quality control. Dev. Cell 23, 896-907.

Sanz, J., Marin, I., Urena, D. and Amils, R. (1993). Functional analysis of seven ribosomal systems from extremely halophilic archaea. Can. J. Microbiol. 39, 311-317.

Schleper, C., Puehler, G., Holz, I., Gambacorta, A., Janekovic, D., Santarius, U., Klenk, H.P., and Zillig, W. (1995). Picrophilus gen. nov., fam. nov.: a novel aerobic, heterotrophic, thermoacidophilic genus and family comprising archaea capable of growth around pH 0. J. Bacteriol. 177, 7050-7059.

Shalgi, R., Hurt, J.A., Krykbaeva, I., Taipale, M., Lindquist, S. and Burge, C.B. (2013). Widespread regulation of translation by elongation pausing in heat shock. Mol. Cell 49, 439-452.

Shao, S., Brown, A., Santhanam, B. and Hegde, R.S. (2015). Structure and assembly pathway of the ribosome quality control complex. Mol. Cell 57, 433-444.

Shao, X and Grishin, N.V. (2000). Common fold in helix-hairpin-helix proteins. Nucleic Acids Res. 28, 2643-2650.

Shen, P.S., Park, J., Qin, Y., Li, X., Parsawar, K., Larson, M.H., Cox, J., Cheng, Y., Lambowitz, A.M., Weissman, J.S., Brandman, O. and Frost, A. (2015). Rqc2p and 60S ribosomal subunits mediate mRNA-independent elongation of nascent chains. Science 347, 75-78.

Shoemaker, C.J., Eyler, D.E. and Green, R. (2010). Dom34:Hbs1 promotes subunit dissociation and peptidyl-tRNA drop-off to initiate no-go decay. Science 330, 369-372.

Shoemaker, C.J. and Green, R. (2011). Kinetic analysis reveals the ordered coupling of translation termination and ribosome recycling in yeast. Proc. Natl. Acad. Sci. USA 108, 1392-1398.

Page 53: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

53

Sobell, H.M. (1985). Actinomycin and DNA transcription. Proc. Natl. Acad. Sci. USA 82, 5328-5331.

Soppa, J. (2006). From genomes to function: haloarchaea as model organisms. Microbiology 152, 585-590.

Svidritskiy, E., Ling, C., Ermolenko, D.N. and Korostelev, A.A. (2013). Blasticidin S inhibits translation by trapping deformed tRNA on the ribosome. Proc. Natl. Acad. Sci. USA 110, 12283-12288.

Takei, K., Nakamura, K., Toki, T., Tsunogai, U., Miyazaki, M., Miyazaki, J., Hirayama, H., Nakagawa, S., Nunoura, T., and Horikoshi, K. (2008). Cell proliferation at 122 C and isotopically heavy CH4 production by a hyperthermophilic methanogen under high-pressure cultivation. Proc. Natl. Acad. Sci. USA 105, 10949–10954.

Tholstrup, J., Oddershede, L.B. and Sørensen, M.A. (2012). mRNA pseudoknot structures can act as ribosomal roadblocks. Nucleic Acids Res. 40, 303–313.

Verma, R., Oania, R.S., Kolawa, N.J. and Deshaies, R.J. (2013). Cdc48/p97 promotes degradation of aberrant nascent polypeptides bound to the ribosome. Elife 2, e00308.

Watson, J.D. and Crick, F.H. (1953). Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid. Nature 171, 737-738.

Weis, F., Bron, P., Giudice, E., Rolland, J.P., Thomas, D., Felden, B. and Gillet, R. (2010). tmRNA-SmpB: a journey to the centre of the bacterial ribosome. EMBO J 29, 3810-3818.

Wendoloski, D., Ferrer, C., and Dyall-Smith, M.L. (2001). A new simvastatin (mevinolin)-resistance marker from Haloarcula hispanica and a new Haloferax volcanii strain cured of plasmid pHV2. Microbiology 147, 959-964.

Woese, C.R. and Fox, G.E. (1977). Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc. Natl. Acad. Sci. USA 74, 5088-5090.

Woese, C.R., Kandler, O., and Wheelis, M.L. (1990). Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA 87, 4576-4579.

Yonashiro, R., Tahara, E.B., Bengtson, M.H., Khokhrina, M., Lorenz, H., Chen, K.C., Kigoshi-Tansho, Y., Savas, J.N., Yates, J.R., Kay, S.A., Craig, E.A., Mogk, A., Bukau, B. and Joazeiro, C.A. (2016). The Rqc2/Tae2 subunit of the ribosome-associated quality control (RQC) complex marks ribosome-stalled nascent polypeptide chains for aggregation. Elife 5, e11794.

Page 54: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

54

Zhou, G., Kowalczyk, D., Humbard, M.A., Rohatgi, S., Maupin-Furlow, J.A. Proteasomal components required for cell growth and stress responses in the haloarchaeon Haloferax volcanii. J. Bacteriol. 190, 8096-8105.

Page 55: By QINYIN LINGufdcimages.uflib.ufl.edu/UF/E0/05/04/61/00001/LING_Q.pdfAugust 2016 Chair: Julie A. Maupin-Furlow Major: Microbiology and Cell Science The ribosome is one of the oldest

55

BIOGRAPHICAL SKETCH

Qinyin Ling grew up in Tongling, Anhui, China. He graduated from Tongling NO.1

High School in 2009. He attended Nanjing Agricultural University from 2009 to 2013 as

an undergraduate student, majored in biological sciences. Upon completion of his

undergraduate degree, he went on to graduate school at the University of Florida, and

he was expected to graduate with his Master of Science in microbiology and cell

science.