BY JOHN I. NURNBERGER, JR., AND LAURA JEAN BIERUT

E I T I ••

Identifying genetic influences on vulnerability to alcoholaddiction can lead to more targeted treatments and helpthose at risk to make informed choices about their own lives

The tendency to become dependent on alcohol has longbeen known to run in families, which for some only added tothe social tigma attached to this complicated condition. Butto scientist, that apparent heritability uggesred that ornegenetic component underlying vulnerability to alcohol prob-lems was bing transmitted from generation to generation.

With rapid advances over the past 10 years in technologiesfor discovering and analyzing the fun tions of genes, re-searchers are now increasingly able to get at tb biologicalroots of complex disorders such as substance abu e and ad-diction. The power to examine patterns of inheritance inlarge populations, and to survey hundreds of thou ands oftiny variations in the genomes of each of those individuals,enable investigators to pinpoint specific gene that exerttrong or ubtle influence on a person's physiology and hi

or her re ulting risk for disea e.

46 5 CI E NT I Fie A MER I CAN

As i true of many otber human di orders, alcoholism doenot have a ingle cause, nor is it origin entirely genetic. Genescan play an important role, however, by affecting processesin the body and brain that interact with one another and withan individual's life experiences to produ e protection or sus-ceptibility. Tea ing the e effects apart is challenging, and todate fewer than a dozen gene that influence one's risk f r al-coholi m have been identified although more surely exi t.

Variants of each of the known genes only modestly alteran individual's vulnerability to alcohol, but many are com-mon in the general population and may have wider effect ondrinking habit, on other addictions or problematic behav-ior ,and on disorders uch as depression and anxiety. Findingthe genes involved in ou r re ponses to alcohol and under-standing their effects may thus illuminate a broader array ofconditions, too. Revealing the biological proce ses that can

APRIL 2007

~~o

'".c"~-e ~.s~~",~.o"'00.0_E-~- ~.~",~-- '" 0- 0 ~~!~~~'" 0'"0.

zo'"<r

Other enzyme that break down alcohol have al 0 been tudied for theirgenetic contribution to alcohol dependence. Alcohol dehydrogena e (ADH),the enzyme re pon ible for the fir t tep in the conver ion of alcohol to acet-aldehyde, for example, i actually produced by a family of gene, each ofwhich affect different properties of the enzyme. The gene mo t importantto alcohol metaboli m are the ADHl group and ADH4. Our own studie ofa U. . popu lation of European de ent have recently provided strong evidencethat variant in the ADH4 gene in particular enhance the risk of alcoholi min member of that population, alth ugh exactly how the e ADH4 variantsaffe tal ohol rnetaboli rn remain to be di covered.

AI oholi m i geneti ally comple , meaning that multiple genes are likelyto be involved, and their interaction with one another and with an individu-al's environment also have to be examined before a complete picture of theproce e that can lead to the disorder i a ernbled. People are also complex

and manife t problems with alcohol in di-verse ways, e pecially in the early stagesof disease, although cases come to re-semble one another clinically in the laterrage of illness. Thus, when inve tigat-

ing the biology of alcoholism, re earch-er must carefully define the problem-for example, distinguishing betweentrue dependence on alcohol and alcoholabu e, which i a Ie s medically severeyndrome.

A widely used psychiatric standardfor diagno ing dependence, be it on alco-

hol or another ub tance, requires that aper on have e perienced at least th ree of thefollowing ymptom within the preceding12 months: tolerance for large doses with-drawa I reaction 10 s of control over u e ofthe ub ranee, efforts to stop or cut down, agreat deal of time spent on the activity, giv-ing LIpother activities, and continued usedespite re ulting phy ical or p ychologicalproblems. People who meet these criteria of-ten have multiple ca e of alcoholism in theirfamilie . With the willing participation ofthe e ubjects, we and other re earchershave begun connecting individual ymp-torn with their phy iologicalorigin andultimately with the re ponsible genes.

Indeed, an important trategy in theearch for gene that affect a person's ri k

for alcohol dependence has been the exami-nation of endophenotypes, which are physi-cal trait -phenotype -that are not exter-nally visible but are measurable, and cantherefore be studied to ee whether certainpattern are more common in people with acom pie di order and may be linked to ri kfor that condition. The idea i grounded inan assumption that endophenotype can re-veal the biological bases for a disorder better

:-build and reinfor e al ohol addiction willmost certainly help to better target existingtreatment and devi e new ones to breakalcohol's hold.

Clues in Human Variations

,.

GENES POWERFULLY INFLUE CE aper on's phy iology by giving rise to some100,000 different type of protein, each ofwhich has a direct role in the daily func-tioning of the body and brain or in regulat-ing the activity of other gene. The strongconnection between variation in basicphysiology and an individual' su ceptibil-ity to alcohol problem is well illu tratedby the very first gene to be identified aaffecting the risk of developing alcoholdependence.

Decade ago researchers began in-vestigating the widely ob erved tenden-cy of per ons from Chinese ]apane e orother East Asian backgrounds to be-come "flu hed" when they drank an al-coholic beverage. Blood tests on ub-ject di playi ng th i effect showed in-creased levels of acetaldehyde, abreakdown product of alcohol, which rc-ulted in an uncomfortable en ation of warmth in the kin, palpitation and

weakne . By the 1980 inve tigator traced the reaction to an enzyme in-volved in alcohol metaboli m, aldehyde dehydrogena e, and eventually to thegene that encode it, ALDHI. The enzyme breaks down acetaldehyde butlight variations in the gene' D A code in the e ubject cau ed the enzyme

to work more slowly. When the e individual inge red alcohol, the acetalde-hyde-which may be toxic in high dose -wa building up in their bodies.

This ALDHI gene variant has since been found to be common in A ianpopulations-seen in 44 percent of Japanese 53 percent of Vietname e, 27percent of Koreans and 30 percent of hinese (including 45 percent of HanChinese)-yet it is rare in people of European de cent. A might be e p cted,people with this slow-metabolizing gene variant al 0 have a decrea ed ri k,by up to sixfold, for alcoholi rn, so it is an e ample of a genetic variation thatcan protect against developing the disorder.

People who meetcriteria for dependence

often have multiple casesof alcoholism

in their families.

• Dependence on alcohol is a complex and controversial disorder, butsusceptibility to it shows clear patterns of inheritance, which indicatesthat genes transmit some biological basis for greater vulnerability.

• Physiological traits, such as distinctive brain activity patterns inalcoholics and their children, help scientists pinpoint variant genes thataffect a person's responses to alcohol.

• Finding the genes that influence alcoholism and related disordersprovides insight into how the conditions develop, opens the way forbetter treatments, and allows individuals at high risk to make informedchoices about their own health and behavior.

48 SCIENTIFIC AMERICAN APRIL 2007

------------------

Chromosomal features known as markers that appear morefrequently in the affected relatives can flag potentiallysignificant stretches of DNA. Detailed investigation of thoseregions can then reveal a gene whose function affectsresponses to alcohol.

Identifying genes that influence a disorder as complex asalcoholism first involves linking the condition's traits tospecific regions on chromosomes. This "linkage analysis"is easiest in genetically similar groups, such as families, withmultiple members affected to some degree by the disorder.

Study Subjects ATCGATTGCACACACACACACA= ,t tGG TACG

Microsatellitemarker

Marker

• Alcohol.dependent• Unaffected

DNAsamplePatients Families

RECRUITMENTAlcoholics seeking treatmentand their willing relatives areinterviewed and diagnosedaccording to psychiatric criteriafor alcohol dependence. Allsubjects provide DNAsamples.

CHROMOSOME SURVEYResearchers scan every person's chromosomes forpatterns of repeated DNAknown as microsatellitemarkers. In one individual, an alternatingsequenceof the bases cytosine and adenine might repeat17 times, for example, whereas at the same locationanother relative has only 12 repeats of the sequence.

GENEASSDCIATIONCloser mapping ofthe DNAregion neara marker revealsspecific genes whoserole in the disordercan be investigated.

LINKAGE ANALYSISMarkers frequently found inpeople with a specific traitof the disorder, but lessoften in unaffected kin,flag a chromosomal regionlinked to that trait.

than behavioral ymptom because they repre ent a funda-mental phy ical trait that is more closely tied to it source ina gene variant. Although thi approach to tudying complexbehaviors was first proposed in the 1970 by p ychiatric re-earcher inve rigating chizophrenia, it ha recently proved

even more valuable with modern rool for a e ing bioi gicproce se and analyzing genetic data.

The brain's electrical activity pattern, for example, are aform of en do phenotype. Using electroencephalography (EEC)to detect such activity rh rough electrodes on the ca lp re-earcher can record patterns of neural firing. ophi ticated

computer algorithms can analyze the data to identify thebrain region where the signals are likely to have originated,offering additional clues to the type of cognitive proce ingtaking place. The overall brain waveform and pike in neu-ral activity in re ponse to pecific rirnuli seen in su h EECreadings are distinctive in different individual and ervea akind of neurol gical fingerprint. These pattern can al 0 re-flect the general balance between excitatory proces es withinthe brain, which render neurons more respon ive to signalingfrom other neurons and tho e that are inhibitory, makingneuron Ie s responsive.

Such electrophy iological pattern are highly heritableand they differ in characteristic ways in alcoholic and non-alcoholics, with excitation exceeding and overpowering inhi-bition in the alcoholic ubjects' brain. Thi imbalance or

"di inhibition," can also be een in the children of alcoholiand trongly predicts their own subsequent development of

www.sciam.com

heavy drinking and alcohol dependence, whi h ugge t thatthe e pattern are a marker for a biologically inherited pre-di po irion to alcoholi m. Moreover, the ignature patternmay point to the heritable vulnerability itself: disinhibition ibelieved to tem from a generalized lack of functioning in-hibitory neuron in the brain areas respon ible for judgmentand deci ion making, and people lacking the e inhibitory cir-cuit may be more prone t acting on impulse originating inlower brain region, su h a the amygdala.

l n the 1980 evid n e from several laboratories showingthat electrical activity in the brain could reveal a person' riskof alcohol dependence helped to stimulate the idea that anintensive earch for the gene underpinning alcoholi m-a so-ciated phenotype wa fea ible and worthwhile. With upporrfrom the arional ln titute on Icohol bu e and Alcohol-i m, the ollaborarive tudy on the eneric of Alcoholism(COCA) in which we are both participants, starred in 1989.The study currently involve eight research center acros theU.S. and thousand f alcoholics and their family memberswho have agreed to help in this ongoing investigation.

Family TiesAT COGA' OUT ET researcher at ite around the countrysought to identify familie everely affected by alcoholi m.Previou twin, adoption and family studie had indicated thatalcohol problem are trongly heritable-indeed, more than50 percent of the overall risk for alcoholi rn i attributable toinherited factors, which make family groups a powerful re-

SCIENTIFIC AMERICAN 49

:-

SIGNATURES IN THE BRAIN

Certain patterns of brain electrical activity serve as measurabletraits, known as endophenotypes, which reveal distinctivephysiological characteristics of alcoholics and others at high

The P300 ResponseMeasuring brain activity through electrodes on the scalpreveals a spike in signal strength (amplitude) between300 and 500 milliseconds after a stimulus, such as a flashof light. Known as P300, this distinctive evoked responseis significantly weaker in alcoholics, even when abstinent.than in nonalcoholics. Amuted P300 is also typical in thechildren of alcoholic parents, indicating that thisfunctional brain difference predates the onset of heavydrinking and is itself a risk factor for becoming alcoholic.

~30"0>b 20I~1O.E0..~ 0

risk forthe disorder. Investigators have used these signaturedifferences in brain function to uncover genes linked toalcoholism and related conditions.

AveragedResponses• Alcoholicmen • Nonalcoholicmen

.Children of • Childrenofalcoholicmen nonalcoholicmen

o 100 300 500 700 0 100 300 500 700TImeafter Stimulus(milliseconds)

Dissecting the ResponseP300 consists largely of neural signaling in low-frequency ranges known as deltaand theta, which are associated with awareness and decision making. Mapping the EEGreadings of nonalcoholic (below) and alcoholic (bottom) subjects by frequency revealsweaker signal strength in those bands among the alcoholics after 300 milliseconds.This trait was linked in family studies to both alcoholism and depression.

Averaged Responses10r---;;iiii_

_4 5e"0 E>~ 3 '"~ aI :::n

u 10'" 2 c"0 '".~ "CT

'"0.. u:E 5...

00

Nonllcohollc men

Theta

} Delta~=;::::=~~~==i

D 100 300 500 700

Timeafter Stimulus (milliseconds)Chromosome7

source for tracking specific trait and linking them to the rel-evant genes [see box all preceding page 1_

Some 1,200 subjects eeking treatment for alcohol depen-dence and their relative -more than 11,000 people in all-were exten ively interviewed. Among the e, 262 farnilie werefound to be "deeply affected," whi h mean that they includ-ed two or more fir t-degree relatives of the patient- uch aparent or ibling -who were al 0 diagno ed a al hol-de-pendent. The electrophysiological brain endophenorype ofboth affected and unaffected member of tho e familie wereas e sed, and the subjects underwent further interview toevaluate additional characreri tic that are a sociated withalcoholism risk and believed to be genetically influenced.The e tra it include "low respon e " mea n ing that the per 011

mu t con ume larger-than-average amounts of al ohol beforefeeling it ffects; previous experience of major depre ion;and certain drinking hi tory pattern, uch a a high maxi-

50 SCIENTIFIC AMERICAN

Linkage to a GeneReduced delta- and theta-frequency signalstrength in alcoholic subjects was also tracedto variants of CHRM2, a gene encoding a cellularreceptor for the neurotransmitter acetylcholine,which regulates neural excitability.

Alpha

CHRM2gene

Linkage analysis

mum number of drink ever con urned in a 24-hour period.The participant al 0 provided D A amples, which al-

lowed COCA scientists to examine the chromosomes of eachindividual and take note of di tinctive molecular feature,which can erve a markers for a potentially ignificant regionof a chromo orne. Marker appearing most frequently in fam-ily members exhibiting alcoholism-a ociated phenotypewould ugge t a cau allink between that region of a chromo-orne and the trait. Significant linkage were identified in thi

manner on hromo ome 1 2 4 and 7, and many years ofgenetic mapping sub equently pinpointed everal specificgene in tho e regions including ADH4 and CABRA2 00

chromo orne 4, a well a CHRM2 on chromosome 7. Otherre earch gr up tudying eparate populations have also doc-umented a sociation between a ri k for alcoholi m and the ehrornosornal region and gene, confirming their likely role

in the di order.

APRIL 2007

For in ra nce, a growing body of re-ea rch has revealed that orne variants of

gene that encode cell-surface dockingire for the protein GABA (gamma-ami-

nobutyric acid), which carrie ignal be-tween certain nerve cells, increa e vulner-ability to alcoholi m. GABA i the rno rcommon inhibitory neurotran miner inthe mammalian nervou y tern. It modu-lates the activity of neuron by binding toG BA-specific receptor in their cell mern-branes and literally inhibiting their re pon-ivene s to ignaling. One cia of the e re-

ceptors, known a GABAA, i made of pro-tein subunits arrayed around a channelthat admits chloride ions into the ell.Variation in the CA BRA2 gene, whichencodes one of the GABAA receptorubunits, have been found to trongly

influence an EEG endophenotype,known a the beta frequency, that ap-pears to playa role in mediating neuro-nal di inhibition.

euron that bear GABA receptorare e pecially abundant in the brain'frontal cortex, where a generalized 10of inhibition can cau e eizure ,and eizure di order are commonly treatedwith medication that boo t GAB activity, promoting inhibition. Ie gen-eralized los of GABA-induced inhibition, however, i thought to beinvolved in behavioral underconrrol or impul ivity, which is a feature of anumber of psychiatric di order including bipolar affe tive di order ub-ranee abuse and chronic conduct problem. tudie by A con ortiurn

member have demon trated that variant of the CA BRA2 g ne are linkedto alcoholism, a finding that ha ince been confirmed by at lea t four group.Interestingly, these variation in CABRA2 do n t change the protein true-ture of the GABAA re pror; instead they seem to modify production f thaffected protein ubunit, perhap redu ing the total number of functioningreceptor.

tudie are under way to identify exactly how thi ABA receptor genevariant affects disinhibition in the brain, but a conne tion b tween GABAactivity and alcohol dependence certainly make en e, becau e impul iviry

a feature of many ca e of alcohol dependence. That trait i particularly

a sociated with an early-on et form of addiction seen primarily in male.People with this kind of addiction are generally prone to "externalizing" dis-order that involve problematic behavior as oppo ed to "internalizing" di -order uch a anxiety and depre ion. Thu ,even without a genetic creenof uch a patient, under tanding the likely involvement of GABA in that ad-di tion pr fil can help target therapeuti approache.

nether neurotran mitrer highlighted in the development of al oholi mby the tudy of endophenorype i acetylcholine, which, like GABA, affectneuron widely di rributed through the central nervou system. euron thatre pond to a etylcholine-de cribed as cholinergic neurons-also have animportant role in modulating the overall balance between excitation and in-hibition in the brain. Our mea ure of brain respon e in COGA ubjectuncovered a connection to the chrornosorna I region contain ing the H R M2gene, which encode a particular type of cholinergic receptor known a the

M2 mu ca ri n ic acetylchol ine receptor( HRM2).

Activation of the CHRM2 receptoralter neuralsignalinginthe I w delraand theta frequencies which are associ-ated with cognitive function uch adeci ion making and attention [see boxall opposite page]. We were al 0 able tolink variant of the CHRM2 gene tothe clinical conditions of alcohol de-pendence and major depression. A

with CABRA2, the CHRM2 variantthat appear to influence the brain's electri-cal activity, alcoholism and depre ion donot eern to alter the tructure of the recep-tor protein but rather it manufacture.

Thi particular a sociation i excitingbecau e it confirms part of a hyporhe is ar-ticulated in 1976 by psychiatri t DavidJanowsky and hi colleagues at VanderbiltUniver iry regarding the brain's need tomaintain a fine balance between differentsignal-regulating proces es to function nor-mally. Janowsky's group propo ed thatmu carinic uper ensitivity-that is, an en-hanced effect of acetylcholine on the mus-arinic cholinergic receptors-in person

prone to depre ion and related conditionwa an underlying ource of imbalance inthe brain.

The recently discovered link betweenCH RM2 alcoholi m and depre ion ar thefir t to how a direct connection between apecific gene and uch hyper en itivity and

the e findings about the cholinergic y temprovide new targets for the development ofmore pecific pharmacological treatmentfor alcoholi m and depre ion. They al 0

under ore the need to under tand how ub-tie differences in phy iology can ontributeto a di order a cornple as addiction.

There are differentpaths to alcoholism

and differentpathways

underlying them.

JOHN I. NURNBERGER, JR., and LAURA JEAN BIERUT are psychiatric geneticists

who often collaborate to study the genetic influences on many forms of sub-

stance addiction as well as on mental illnesses such as depression and bipolar

disorder. Nurnberger is professor of psychiatry at Indiana University School of

Medicine. where he is also director of the Institute of Psychiatric Research. Bierut

is associate professor of psychiatry at Washington University in St. Louis and.

like Nurnberger. an investigator in the Collaborative Study on the Genetics of

Alcoholism [COGA). Both authors wish to acknowledge the late Henri Begleiter

and Theodore Reich. principal and co-principal investigators of COGAsince its

inception: "We are indebted to their leadership in the establishment and nurtur-

ing of COGAand acknowledge with great admiration their seminal scientific con-

tributions to the field."

www.sciam.com SCIENTIFIC AMERICAN 51

Insight, Not DestinyTHE OGA PROJECT ha been structured around farniliebut thi type f re earch ha al 0 trengthened under tandingof the relative importance of pecific gene variant a risk fac-tor in different erhni group. Thi i not to ay that certainethnicitic are more prone to al oholi m; in read like theALDHl gene ver ion that make many East ian intolerantof al ohol, certain of the genetic variant that contribute torisk arc much more prevalent in ome ethnic group than inother. The knowledge that uch genes are likely to be influ-encing dependence in patients belonging to one of the e p pu-lation i another tool that can be u d to as ess the nature ofan individual' problem and to tailor treatment accordingly.

Our research group recently discovered, for e ample, thatvariation in a gene encoding a receptor involved in taste per-ception, known a hTA 2R16, is significantly linked t alco-holism in the OGA subject. The ri k variant, which causesdecreased sensitivity to many bitter ta re compounds, i un-common in European American , whereas 4 ~ percent of Af-rican-Americans carry this ver ion, making it a much moreignificant risk factor in that population.

The genetic contribution to dependence idenri fied 0 faraffect many different a pects of human phy iology, from alco-hol rneraboli m to brain activity and ta te perception ju tin

Thegenes found so far to influence a person's risk of becomingalcohol-dependent represent awide variety of physiologicalprocesses, including breakdown of alcohol itself, balancedbrain function, taste and reward reinforcement. Variations inthe genes controlling these traits can protect people from,

E,AllON

ENCOOEO PROTEIN,FUNCTION

Non.ADH4;chromo.om.4

Alcohold.hydrog.n ••• ;.Icohol-m.t.bollzlng.nzym.

CHRNZ;chromo.om. 7

GABRG3;chromo.om.15

52 SCIENTIFIC AMERICAN

the e ample we have de cribed. The effect of each of thesegene by it elf i modest probably increa ing average risk by20 to 40 percent, and other as yet unidentified genes undoubt-edlyal 0 contribute to vulnerability to al ohol problems.

n important test to confirm and refine the e genetic find-ing i to ee how they influence people early in life, even be-fore the on er of heavy drinking, and whether the variant canpredi t the later development of alcoholism. COGA addedu h a pro pe tive arm to the rudy to follow young members

of the high-ri k familie . Initial re ulr have hown that inadole cent the ADH gene risk variant are indeed a sociatedwith early drinking and sub equent development of alcoholproblem. arriers of the HRM2 ri k variants, however, aremore likely to have early symptom f depres ion than drink-ing problem when they are adolescent. Youngsters with theCABRA2 risk variant more frequently display conduct prob-lem , uch a trouble with the poli e fighting and expulsionfrom hool rather than early drinking. In young adults, onthe other hand the GABA receptor gene risk variants do be-come associated with alcohol dependence.

The e findings reinforce the notion that there are differentpath to alcohol dependence and different physiological path-way underlying them. The A DH ri k variant may contributeto the development of alcoholism directly by promoting heavy

or predispose them to, responding to alcohol in ways thatenhance addiction. Someofthe same gene variants have alsobeen linked to other traits or disorders, which suggests thatcertain problems involving behavior, mood and dependencemay have overlapping origins.

GENEVARIANT EFFECT

LINKED TO OTHER TRAITSOR DISORDERS

Incr•••• d rl.k(c.rtaln varl.nt.)

APRIL 2007

drinking, whereas the CABRA2 variant predi po e a per onto conduct problems, which are themselve a ri k factor foralcoholi m. Meanwhile CHRM2 may act through depre ionand other internalizing yrnprorn to foster drinking.

A more genes are linked to the development of al oholdependence the e in ight will be u ed to improve tool forgauging an individual' ri k for developing alcoholi m andidentifying those with alcohol problem who may re pondbetter to pecific treatment. Doctor commonly con ider aper on' genetic profile and other family and environmentalrisk factor when combining medication and behavioral pre-cription for complex conditions uch a hyperten ion an-

cer and bipolar affective di order. Clinician are in the ea rlie tstage of u ing genetic variants to shape treatment deci ionfor alcoholi rn, and in the future we e pect to have molecularguideline to help develop such individualized trategie .

The recent genetic findings related to al oholi rn may al 0

sugge t ways to improve the prevention and treatment of m k-ing and other forms of substance dependence that are frequent-ly een in people with alcohol problems and tend to cluster inthe ame familie . Mood and anxiety di orders fall into thicategory a well, and the association between CHRM2 varia-tions, al oholi m and depression illu rrare how the e pr b-lern may tern in part from a common sour e. Improved un-derstanding of alcohol dependen e hould therefore help di -sect factors involved in the development of related condition.

Genetic is never de tiny, however. Gene may inrera twith pecific toxi environment, uch a abu e or neglect tore ult in problem for ome gene carriers but not for other.And if half of alcoholism ri k i heritable, the other half mu tderive from other source. obody gets to be al ohol-depen-dent without making ome poor choice, but clearly some peo-ple are more en itive to alcohol than other in the ame set ofcircum tance and scienri t are working to identify thesources of that vulnerability.

Critic have argued that genetic r earch into alcohol de-pendence and other forms of addiction, including smoking, inot co t-effective from a public health perspective. For in tance,orne claim that it would make more sen e to direct re ource

toward reducing the use of potentially addictive ubstancesa ross the board than to identify-and potentially stigmatize-the individual who would be mo t affected by such reducti ns.Undoubtedly, there i value in limiting the u e of alcohol, nico-tine and other mood-altering drugs in general. There i alsovalue, however in upporring individual elf-knowledge a itpertain to u epribility 0 that people can make informedchoice for them elve and in shaping a culture that regard thia a po itive goal.

enetic te ring is already providing opporrunitie for elf-a e rnent tbat were impos ible in the pa t and the demandfor genetic profiling will in rease in the coming year. Microar-ray, often called gene chips, can be u ed to detect a per n'gene variant a well as variations in gene activity and to pro-duce a series of medical p ychiatric and behavioral recommen-dation that the individual may take or leave as he or h wi h-

www.sciam.com

es. This u e of cienrific knowledge i urely ine itable e pe-ciallyinfreenation with apirali t cconornie .where itwill bemarket-driven and competitive. The cientific and academiccommunitie must therefore help guide thi proces by di tin-gui hing true phy iologi al relation from fal e claim and byencouraging ocially respon ible uses for the e discoverie .

The risks of smoking were first widely publicized by theSurgeon eneral's Report of 1964, and the combination of thatmedical information and social pre ure has reduced the prev-alence of moking ov rthe ub equent decades. An individual'sawarene of personal genetic medical risks may similarlyhang hi or her choice. The broader health and ocial effects

of rhi nev type of information may not be een qui kly, butthey could be quite profound over time. m

MORE TO EXPLOREThe Collaborative Study on the Genetics of Alcoholism: An Update.Howard J. Edenberg in Alcohol Reseorch Be Health, Vol. 26, No.3,pages 214-218; 2002.Available at www.niaaa.nih.gov/Publications/AlcohoIResearch

Evidence of Common and Specific Genetic Effects: Associationof the Muscarinic Acetylcholine Receptor M2 (CHRM2) Gene withAlcohol Dependence and Major Depressive Syndrome. Jen C.Wanget al. in Humon Molecu/orGenetics, Vol. 13, No. 17, pages 1903-1911;June 30, 2004.

Endophenotypes Successfully Lead to Gene Identification:Results from the Collaborative Study on the Genetics of Alcoholism.Oanielle M.Dick et al. in Behovior Genetics, Vol. 36, No. I,pages 112-126; January 2006.

SCIENTIFIC AMERICAN 53