burge et al. 2004 nramp in vivo

8/14/2019 Burge Et Al. 2004 Nramp in Vivo

1/11

INFECTION AND IMMUNITY, Mar. 2004, p. 16261636 Vol. 72, No. 30019-9567/04/$08.000 DOI: 10.1128/IAI.72.3.16261636.2004Copyright 2004, American Society for Microbiology. All Rights Reserved.

Mycobacterium-Inducible Nramp in Striped Bass (Morone saxatilis)Erin J. Burge,1* David T. Gauthier,1 Christopher A. Ottinger,2 and Peter A. Van Veld1

Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, College of William

and Mary, Gloucester Point, Virginia 23062,1

and U.S. Geological Survey, Leetown Science Center, National Fish Health Research Laboratory, Kearneysville, West Virginia 254302

Received 2 October 2003/Returned for modification 6 November 2003/Accepted 24 November 2003

In mammals, the natural resistance-associated macrophage protein 1 gene, Nramp1, plays a major role inresistance to mycobacterial infections. Chesapeake Bay striped bass (Morone saxatilis) is currently experiencingan epizootic of mycobacteriosis that threatens the health of this ecologically and economically importantspecies. In the present study, we characterized an Nramp gene in this species and obtained evidence that thereis induction following Mycobacterium exposure. The striped bass Nramp gene (MsNramp) and a 554-amino-acidsequence contain all the signal features of the Nramp family, including a topology of 12 transmembranedomains (TM), the transport protein-specific binding-protein-dependent transport system inner membranecomponent signature, three N-linked glycosylation sites between TM 7 and TM 8, sites of casein kinase andprotein kinase C phosphorylation in the amino and carboxy termini, and a tyrosine kinase phosphorylation sitebetween TM 6 and TM 7. Phylogenetic analysis most closely grouped MsNramp with other teleost Nramp genesand revealed high sequence similarity with mammalian Nramp2. MsNramp expression was present in all tissuesassayed by reverse transcription-PCR. Within 1 day of injection ofMycobacterium marinum, MsNramp expres-sion was highly induced (17-fold higher) in peritoneal exudate (PE) cells compared to the expression incontrols. The levels of MsNramp were three- and sixfold higher on days 3 and 15, respectively. Injection of

Mycobacterium shottsii resulted in two-, five-, and threefold increases in gene expression in PE cells over thetime course. This report is the first report of induction of an Nramp gene by mycobacteria in a poikilothermic

vertebrate.

Mycobacteriosis has been reported in more than 150 speciesof freshwater and marine fish worldwide, including striped bass(Morone saxatilis) (43). Chesapeake Bay is currently experienc-ing an epizootic of mycobacteriosis in striped bass that threat-

ens the health of an economically important commercial andrecreational fishery (32, 46) and has important consequencesfor production in aquaculture (33). The prevalence of splenicmycobacterial lesions and the prevalence of dermal mycobac-terial lesions in striped bass from Chesapeake Bay tributarieshave been reported to be as high as 62.7 and 28.8%, respec-tively (8). Diseased striped bass harbor multiple species ofMycobacterium, including Mycobacterium marinum, a knownfish and human pathogen (35, 64), and Mycobacterium shottsiisp. nov., which is also a member of the Mycobacterium tuber-culosis clade (47). Approximately 76% of mycobacterium-pos-itive striped bass sampled to date harbor M. shottsii, either asa monoinfection or as part of a coinfection with multiple My-cobacterium spp. (M. W. Rhodes, H. Kator, I. Kaattari, D.

Gauthier, W. Vogelbein, and C. Ottinger, Abstr. 103rd Gen.Meet. Am. Soc. Microbiol., abstr. Q-264, 2003). Gauthier et al.(21) investigated the relative pathogenicity of three Mycobac-terium spp. isolated from wild Chesapeake Bay fish for labo-ratory-reared striped bass and found that M. marinum causedacute peritonitis and extensive granulomatous inflammation.

In some cases, a secondary phase of reactivation disease wasobserved. The pathology in fish inoculated with M. shottsii orMycobacterium gordonae was considerably less severe than thepathology in fish inoculated with M. marinum, and secondary

disease did not occur. Both M. gordonae and M. shottsii, how-ever, did establish persistent infections in the spleen.Breeding studies with Mycobacterium-resistant (Bcgr) and

-susceptible (Bcgs) inbred mouse phenotypes resulted in iden-tification of a single dominant, autosomal gene (termed Bcg)responsible for increased resistance to mycobacteria during theearly stages of infection (27). Positional cloning of Bcg fromthe proximal region of mouse chromosome 1 led to the dis-covery of the gene for the natural resistance-associated mac-rophage protein (Nramp) (61). Vidal et al. demonstrated thatNramp transcripts were detected only in the reticuloendothe-lial organs (spleen and liver) of mice and were highly expressedin purified macrophages and macrophage cell lines from thesetissues. In addition, murine Nramp1 is highly upregulated fol-lowing infection with intracellular parasites (23, 26) and ad-ministration of lipopolysaccharide (LPS) and gamma inter-feron (25), and a strong synergistic effect is observed under thelatter conditions. Transfection of the resistant, wild-typeNramp1G169 allele in susceptible Nramp1G169D knockout micerestored resistance to Mycobacterium bovis BCG and Salmo- nella enterica serovar Typhimurium in the transgenic animals(26), while overexpression of Nramp1 by a cytomegaloviruspromoter-enhancer completely inhibited intracellular replica-tion ofS. enterica serovar Typhimurium in normally susceptiblemouse macrophages (24), indicating the crucial role of thisgene in resistance to intracellular parasites.

The mechanism of mycobacterial resistance due to Nramp1

* Corresponding author. Mailing address: Chesapeake Bay Hall,P. O. Box 1346, 1208 Greate Road, Department of Environmental and

Aquatic Animal Health, Virginia Institute of Marine Science, Glouces-ter Point, VA 23062. Phone: (804) 684-7234. Fax: (804) 684-7186.E-mail: [email protected].

Virginia Institute of Marine Science contribution no. 2577.

1626

byonOc

tober25,2009

iai.asm.org

Downloadedfrom
http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/http://iai.asm.org/


2/11

is not fully understood (4), but Nramp2 is known to take upiron from the intestinal brush border in mammals and has beenlinked to transferrin-independent iron transport into acidifiedendosomes in many different tissues (18, 31). One of the splice

variants of DCT1 (Rattus norvegicus Nramp2 homolog) con-tains an iron-responsive element (IRE) in the 3 untranslatedregion (UTR) (31). There is a very high degree of homology inall the transmembrane domains (TM) between Nramp1 andNramp2 (44), and a mutation in Nramp2 immediately C ter-minal of the loss-of-function mutation in Nramp1 TM 4 isassociated with microcytic anemia iron deficiency (54).

Nramp1 belongs to a small family of related proteins en-coded by genes that include two known murine genes, Nramp1and Nramp2, as well as related sequences in many other taxa(10). Nramp homologs have been found in many evolutionarilydistantly related groups, such as humans (11, 37), rats (31),birds (36), fish (15), insects (48), nematodes (57), plants (5),

yeast (45), and bacteria (42). Complete Nramp mRNA codingsequences for fi ve teleosts have been published recently (12,14, 15, 49, 52). Paralogs of Nramp seem to be present in two

teleost species, Oncorhynchus mykiss (15) and Takifugu ru-bripes (52), while single genes are present in other teleostspecies, including Cyprinus carpio (49), Ictalurus punctatus (12),Danio rerio (14), and M. saxatilis (this study). Expression stud-ies and phylogenetic analysis of fish have indicated that thenonteleost sequence similarity and tissue-specific expressionpatterns most closely resemble those of mammalian Nramp2.Little is known about the function of Nramp in teleosts, al-though in one study Chen et al. (12) demonstrated by usingNorthern hybridization and reverse transcription (RT)-PCRthat channel catfish ( I. punctatus) spleen NrampC levels wereelevated in response to LPS exposure in vivo in a dose-depen-dent fashion. Direct evidence of induction due to exposure of

fish to pathogens has not been reported previously.The purposes of the present study were to isolate and se-

quence striped bass Nramp homolog(s), to characterize thecoding sequence, to determine the tissue expression patterns,and to evaluate induction of the striped bass Nramp gene(MsNramp) in vivo after exposure to mycobacteria. Expression

was measured in several tissues by using real-time RT-PCR(see references 7, 53, and 59 for descriptions of recent appli-cations) following injection of M. marinum or M. shottsii intostriped bass. This report is the first report of induction of anNramp gene by an intracellular pathogen in a poikilothermicvertebrate.

MATERIALS AND METHODS

Experimental fish and maintenance. Striped bass (M. saxatilis) (500 to 2,000 g)

were collected from the York River, Chesapeake Bay, Va. (Virginia Marine

Resources permit 02-27 and VIMS Research on Animal Subjects Committee

permit 0101). The tissues of these fish were used for sequencing and normal

tissue expression ofMsNramp. The fish were maintained in 1,160-liter tanks with

flowthrough, sand-filtered water at the ambient temperature and salinity. Thetanks were lit with fluorescent lights adjusted to the local photoperiod. The fish

were fed daily to satiation with wild-caught small fish and crabs and were kept formore than 2 weeks prior to experimental use.

The striped bass used for the mycobacterial challenge and in vivo expression

experiments were obtained as fingerlings (1 year postspawn) from the VirginiaDepartment of Game and Inland Fisheries Vic Thomas Striped Bass Hatchery in

Brookneal, Va. The fish were reared until the mean weight was approximately200 g (2 years postspawn) in circular 1,000-liter tanks containing 21C well water

exchanged at a rate of 12 liters/min. The in flow water was degassed and oxygen-

ated to saturation, and the tank water was treated with 1% (wt/vol) NaCl each

time that the fish were handled to alleviate stress. The fish were fed trout chow

(Ziegler Bros, Gardner, Pa.). Tank illumination was provided by a combination

of fluorescent and natural light, with the former adjusted to the local photope-riod. Thirty striped bass (198.1 67.4 g) were randomly selected, separated into

three treatment groups, and moved to an isolation facility prior to infection with

mycobacteria.

RNA extraction and RT for cDNA: sequencing and tissue expression. Perito-

neal exudate (PE) cells were isolated from wild striped bass by a modi fication ofstandard techniques (51). Cells were elicited to the peritoneal cavity by injection

of adjuvant (100 l of Freunds incomplete medium) 7 to 10 days prior to

harvesting. Anesthetized fish were inoculated intraperitoneally with 10 ml of

ice-cold Leibowitzs L-15 medium containing 100 U of penicillin-streptomycinper ml and 100 U of sodium heparin per ml. After 10 min, lavage fluid was

withdrawn through a ventral incision (51). Anterior kidney, brain, heart, gill,

gonad, intestine, liver, muscle, and spleen samples (approximately 100 mg each)

were dissected from the fish and either stored in RNAlater (Ambion) or ex-

tracted immediately. Total RNA was isolated with TRIzol (Invitrogen) used

according to the manufacturers protocol. The integrity of the total RNA wasassessed by electrophoresis in 1% denaturing formaldehydeagarose gels. The

RNA quality and concentration were determined by UV spectrophotometry at

260 and 280 nm, with background correction for protein contamination at 320

nm. The total RNA was resuspended in RNA Storage Solution (Ambion) and

stored at 80C until it was used. RT of 5 g of RNA was accomplished by using

SuperScript II RNase H

reverse transcriptase and oligo(dT12-18) (Invitrogen)priming according to the manufacturers recommendations.

Amplification of MsNramp cDNA. Primers and hybridization probes used in

standard PCR, RT-PCR, RNA ligase-mediated rapid amplification of cDNAends (RACE), and sequencing analyses are listed in Table 1. An initial 262-bp

fragment of striped bass MsNramp was obtained by using primers NrampA and

NrampB, which were derived from consensus mammalian sequences (12), and

striped bass PE cDNA. Fragments 5 and 3 of this initial fragment were obtained

by using combinations of striped bass-specific MsNramp primers (MsNramp736

and MsNramp1020), which were developed by sequencing RT-PCR products,

and primers developed for O. mykiss Nramp (MDNMP1F, MDNMP4,

OmNramp1263, OmNramp1463) (15). PCR parameters were empirically deter-

mined for each primer set, and the PCRs were performed with thermocyclers

from MJ Research, Inc. The PCR mixtures (final volume, 50 l) contained (final

concentrations) 1.0 U of Platinum Taq High Fidelity DNA polymerase, each

deoxynucleoside triphosphate at a concentration of 0.2 mM, 2 mM MgSO4, 1

PCR buffer (Invitrogen), each primer at a concentration of 0.2

M, and 1 to 2

lof cDNA template. A total of 1,242 bp of MsNramp sequence was generated in

this manner. Tissue expression ofMsNramp was shown by amplification of cDNAfrom a variety of tissues (see above) by using primer sets (NrampA plus

MDNMP4, MDNMP1F plus OmNramp1463, and MsNramp736 plus

MsNramp1020). MsNramp-positive tissues were visualized by 1% agarose gel

electrophoresis and ethidium bromide staining.

RNA ligase-mediated RACE. The 5 and 3 ends of MsNramp cDNA were

amplified by RACE, based on procedures developed by Frohman et al. (20). The

5 and 3 ends ofMsNramp were isolated by using a GeneRacer kit (Invitrogen).

For the 5 end, 5 g of RNA from mycobacterium-inoculated striped bass PE

cells was dephosphorylated with calf intestinal phosphatase, and the 5 cap

structure was removed by using tobacco acid pyrophosphatase. An RNA oligo-

nucleotide sequence was ligated to the dephosphorylated, decapped 5 end of

striped bass mRNA, and the hybrid molecule was reverse transcribed by using

SuperScript II RT. RACE-ready 3 cDNA was obtained by RT of 5 g of PE cells

RNA by using the GeneRacer Oligo dT primer, a modified oligo(dT) primer witha 36-nucleotide tail complementary to the 3 poly(A) tail of full-length mRNA.

RACE-ready first-strand cDNA was treated with RNase H to remove the RNAtemplate.

The RACE PCR mixture for 5 MsNramp consisted of 1 l of RACE-ready 5

cDNA, 0.6 M GeneRacer 5 primer (complementary to the GeneRacer RNA

oligonucleotide ligated to 5 cDNA), 0.2 M gene-specific primer 5RACE1, eachdeoxynucleoside triphosphate at a concentration of 0.2 mM, 1 PCR buffer, 2

mM MgSO4 and 2.5 U of Platinum Taq DNA polymerase. The cycling param-

eters for a touchdown PCR program were as follows: 94C for 2 min, 94C for 0.5min, and 72C for 1 min for five cycles; 94C for 0.5 min and 70C for 1 min for

five cycles; 94C for 0.5 min and 68C for 1.5 min for 25 cycles; and 68C for 10min.

The 3 RACE PCR mixture for MsNramp consisted of reaction components

similar to those in the 5 RACE PCR mixture, with the following exceptions: 1

l of RACE-ready 3 cDNA, 0.6 M GeneRacer 3 primer [complementary to

the 36-nucleotide tail of the oligo(dT) primer], and 0.2 M primer 3RACE1, 0.2

VOL. 72, 2004 Nramp INDUCTION IN STRIPED BASS 1627

byonOc

tober25,2009

iai.asm.org

Downloadedfrom


3/11

M primer 3RACE2, or 0.2 M primer 3RACE4. The cycling parameters for

primer 3RACE1 were as follows: 94C for 2 min; 94C for 0.5 min and 72C for2 min for five cycles; 94C for 0.5 min and 70C for 2 min for five cycles; 94C for

0.5 min, 65C for 0.5 min, and 68C for 2 min for 25 cycles; and 68 C for 10 min.Multiple products were obtained in the reaction initiated with primer 3RACE1,

so a nested PCR was performed by using the standard PCR components along

with 0.2 M GeneRacer 3 nested primer, 0.2 M primer 3RACE2, and 1 l of

the 3RACE1-amplified products. The conditions for this reaction were opti-

mized as follows: 94C for 2 min; 94C for 0.5 min, 65C for 0.5 min, and 68C for

2 min for 25 cycles; and 68C for 10 min. Primer 3RACE4 was used to confirmthat a full-length 3 sequence was obtained after 3RACE2 products were se-quenced. The reaction conditions and cycling parameters were identical to those

used for primer 3RACE1.

Cloning. Putative internal MsNramp fragments were blunt-end cloned into

pSTBlue-1 by using T4 DNA ligase and were transformed into Escherichia coli

strain NovaBlue competent cells for blue-white screening (Clonetech). Trans-

formants were grown on Luria broth (LB) agar plates with kanamycin selection

for plasmid uptake and X-Gal (5-bromo-4-chloro-3-indolyl--D-galactopyrano-

side)-IPTG (isopisopropyl--D-thiogalactopyranoside) screening for transforma-

tion. Insert-containing white colonies were amplified in LB, and their plasmidswere isolated by using PERFECTprep spin columns (533, Inc.). Screening of

clones was accomplished by using MsNramp-specific PCR or vector primers thatyielded products of the expected insert size. RACE PCR products were cloned

into pCR4-TOPO with topoisomerase I by using single deoxyadenosine residues

added by Taq polymerase during amplification with a TOPO TA cloning kit(Invitrogen). Insert-containing vector molecules were transformed into E. coli

TOP10, thereby disrupting the lethal gene ccdB. Insert-containing transformants

were screened for insert size by performing vector-specific PCR. Transformants

containing complete 5 and 3 inserts were amplified in LB, and plasmids wereisolated with a Qiaprep Spin miniprep kit (Qiagen).

Sequencing. MsNramp fragments were bidirectionally determined with a Li-

Cor 4000L DNA sequencer by the dideoxy chain termination method by using a

ThermoSequenase cycle sequencing kit according to the manufacturer s instruc-

tions (Amersham Biosciences). Plasmid DNA (1 to 2 g) and 3 pmol of the

fluorescent primers M13F (forward) and M13R (reverse) were used in thesequencing reaction (LI-COR Biosciences). At least 10 clones were sequenced

for each fragment.

Sequence analysis. MsNramp fragments were aligned and edited in Se-

quencher (version 4.1; Gene Codes Corp.). Full-length cDNA nucleotide and

deduced amino acid sequences were analyzed to determine similarity to previ-

ously published sequences by using GenBank resources (http://www.ncbi.nlm.nih

.gov/GenBank/index.html). Searches for similar sequences were performed by

using the Basic Local Alignment Tool (BLAST) algorithms (1). Multiple-se-

quence alignment was performed by using ClustalX (version 1.81) (58). Potential

microsatellite sequences were detected with the Tandem Repeats Finder soft-

ware (version 3.21) (6), and polyadenylation signals were analyzed by using

polyadq (55). The amino acid sequences of the following proteins were used in

the alignment and phylogenetic analyses: Bos taurus Nramp1 (GenBank acces-

sion number U12852), C. carpio NRAMP (AJ133735), D. rerio DMT1

(AF529267), Drosophila melanogaster malvolio (U23948), Gallus gallus

NRAMP1 (U40598), Homo sapiens NRAMP1 (L32185), H. sapiens NRAMP2

(NP_000608), I. punctatus NrampC (AF400108), Macaca fascicularis(AF153279), M. saxatilis MsNramp (AY008746), Mus musculus Nramp1

(AAA39838), M. musculus Nramp2 (AAC42051), O. mykiss Nramp

(AF048760), O. mykiss Nramp (AF048761), Ovis aries NRAMP (U70255),

Pimephales promelas Nramp (AF190773), R. norvegicus DCT1 (AAC53319), T.

rubripes Nramp (AJ496549), and T. rubripes Nramp (AJ496550). TM were

predicted by using HMMTOP (version 2.0) (60), and a motif analysis was per-

formed by using the PROSITE reference library (34).

Phylogenetic analysis. A phylogenetic analysis was conducted by using the

MEGA software (version 2.1) (39). An optimal tree was constructed by using the

pairwise distance model and neighbor joining (50). Indels were removed from

the multiple-sequence alignment, and the reliability of the trees was assessed by

examining 10,000 bootstrap replicates. Drosophila malvolio (48) was used as an

outgroup.

Mycobacteria. M. marinum (Virginia Institute of Marine Science strain M30)

(M. W. Rhodes, I. Kaattari, S. Kotob, H. Kator, W. K. Vogelbein, E. Shotts, and

S. Kaattari, Fish Health Sect. Am. Fish. Soc. Annu. Conf., abstr. Q-423, 2000)and M. shottsii (Virginia Institute of Marine Science strain M175 [ ATCC

700981]) (46) were isolated from splenic tissue of Chesapeake Bay striped bass

and grown as described by Gauthier et al. (21). Briefly, mycobacteria were

inoculated into Middlebrook 7H9 medium with oleate-albumin-dextrose-cata-

lase enrichment and 0.05% polyoxyethylenesorbitan monooleate (Tween 80) and

grown until the log phase (10 days). Cultures were pelleted by centrifugation at

12,000 g for 20 min and washed once in phosphate-buffered saline (PBS) with

0.05% Tween 80 (PB). Washed cultures were resuspended in PB, vortexed

vigorously with glass beads (diameter, 500 m) for 2 min, and filtered through

Whatman no. 1 paper to reduce clumping and obtain a homogeneous suspen-

sion. The absorbance at 590 nm was adjusted with PB to 0.05 (concentration,

approximately 107 CFU/ml), and the preparation was diluted 10-fold prior to

injection with PBS. Effluent water from the isolation facility was treated for a

minimum contact time of 20 min with hypochlorite maintained at a diluted final

concentration of 100 mg/liter after the fish were infected with mycobacteria.

TABLE 1. Primers used in tissue-specific RT-PCR, RNA ligase-mediated RACE, real-time RT-PCR, and sequencing

Primer Sequence (5 3 3)Source (reference or accession

no.)

NrampA GGAAGCTGTGGGCCTTCAC Consensus mammalian (12)NrampB CTGCCGATGACTTCCTGCAT Consensus mammalian (12)OmNramp1263 CCCCTCCGCCTATCTTCCACACCAGTCC O. mykiss (AF054808)OmNramp1463 CCCGCTCCATCGCCATCTTCCCCAC O. mykiss (AF054808)

MDNMP1F GCCCCATAATATCTACCTGCACTC O. mykiss (15)MDNMP4 GGTGCCCGTCATGGTAGAGCTCTG O. mykiss (15)5RACE1 TCAGCCAAAGGATGACCCGAGGAAC M. saxatilis (AY008746)3RACE1 TCTGACCTTCACCAGTCTGACATC M. saxatilis (AY008746)3RACE2 CACTTACTCGGGGCAGTTTGTTATG M. saxatilis (AY008746)3RACE4 GATACCGTCCTCCTACCAACATACTG M. saxatilis (AY008746)MsNramp736 TTGTCGTAGCGGTCTT M. saxatilis (AY008746)MsNramp1020 GGGACCACCGTAGGTTTA M. saxatilis (AY008746)5MsNramp942f GCTGGACAGAGTTCCACCA-f a M. saxatilis (AY008746)3MsNrampRed963p LCRed640-ACAGGCACTTACTCGGGG-pb M. saxatilis (AY008746)T3 ATTAACCCTCACTAAAGGGA Invitrogen Corp.T7 TAATACGACTCACTATAGGG Invitrogen Corp.GeneRacer 5 primer CGACTGGAGCACGAGGACACTGA Invitrogen Corp.GeneRacer 3 primer GCTGTCAACGATACGCTACCGTAACG Invitrogen Corp.GeneRacer 3 nested CGCTACGTAACGGCATGACAGTG Invitrogen Corp.M13F IRDye 800 CACGACGTTGTAAAACGAC LI-COR Biosciences

M13R IRDye 700 GGATAACAATTTCACACAGG LI-COR Biosciencesa f, fluorescein.b LCRed640, LightCycler Red 640 dye; p, phosphate.

1628 BURGE ET AL. INFECT. IMMUN.

byonOc

tober25,2009

iai.asm.org

Downloadedfrom


4/11

Infection. Immediately before introduction of striped bass into the isolation

facility, fish were separated into three groups (10 fish each), anesthetized by

using 100 mg of Finquel (MS-222; Argent Chemical) per liter, weighed, and

inoculated intraperitoneally with 1.5 ml of a diluted mycobacterial suspension or

sterile PBS. Group 1 fish received 1.5 ml of PBS; group 2 fish received 1.4 106

CFU ofM. marinum; and group 3 fish received 0.93 106

CFU ofM. shottsii. Inorder to model mycobacterial infections as they might appear in a wild popula-

tion (i.e., a long-term, chronic condition with low initial doses), the mycobacterial

doses were adjusted to ensure that fish received a sublethal challenge that

corresponded to approximately 5,000 CFU/g. Previous work indicated that the

doses used were sublethal and would establish chronic infections (21). The doses

injected were calculated by plating mycobacteria on Middlebrook agar.

Sampling. Three fish from each group were randomly selected 1, 3, and 15days postinoculation, anesthetized with a lethal dose of Finquel (500 mg/liter),

and dissected to remove tissues for measurement of MsNramp. All media and

reagents used for sample preparation and storage were obtained from Sigma

Chemical unless indicated otherwise. Samples (100 to 200 mg) of anterior kid-

ney, spleen, and white muscle were removed, rinsed once in phenol-red free

Hanks balanced salt solution (HBSS), and stored in RNAlater. Samples in RNA

storage buffer were kept overnight at 4C and stored at 20C, as recommendedby the manufacturer. PE cells were isolated as described above, without the use

of Freunds incomplete medium. PE cells were washed once in L-15 mediumcontaining 2% fetal bovine serum (Invitrogen), penicillin-streptomycin, and 10 Uof sodium heparin per ml and were counted with a Reichert Brightline hema-

cytometer. The viability as assessed by trypan blue exclusion was greater than

95% for all fish sampled. An aliquot containing 2 107 PM was removed forRNA extraction, washed once in HBSS, and resuspended in RNAlater. An

aliquot containing 5 106 cells in HBSS was adhered to individual glass slides

by using a cytospin (Shandon, Inc., Pittsburgh, Pa.) at 700 g for 7 min. Cytospin

slides were either fixed in methanol (10 s) and stained with Wright-Giemsa stain

or fixed in 1% paraformaldehyde (10 min) and stained by the Ziehl-Neelsenacid-fast technique (41). The remaining cells were fixed in 1.5% glutaraldehyde0.1 M sodium cacodylate0.15 M sucrose (pH 7.2) for 1 h for electron micros-

copy.

Electron microscopy. Glutaraldehyde-fixed cells were postfixed for 1 h in 1%

OsO40.1 M sodium cacodylate. The cells were dehydrated with a g raded ethanolseries (10 to 100% ethanol) by using 15 min per step, with 1 h of en bloc staining

with saturated uranyl acetate at the 70% ethanol step. Dehydration was followed

by three 30-min incubations in 100% propylene oxide, and cells were embedded

in Spurrs resin. Ultrathin sections (thickness, 90 nm) were prepared with aReichert-Jung ultramicrotome, mounted on Formvar-coated copper grids, and

stained with Reynolds lead citrate for 7 min. Stained sections were examinedwith a Zeiss CEM902 transmission electron microscope.

RNA extraction for induction of MsNramp in vivo. PM were removed from

RNAlater by dilution with 1 volume of HBSS and centrifugation at 4,000 g for

5 min. Anterior kidney, spleen, and white muscle samples were removed from

storage buffer, and 100-mg subsamples were taken just prior to extraction. Total

RNA was isolated and evaluated as previously described. The integrity and

quality of total RNA were assessed as previously described.

Real-time semiquantitative RT-PCR. Two gene-specific primers and two gene-specific hybridization probes were used to measure PCR product formation in

real time (Table 2) (63). This procedure was performed by using the Roche

Molecular Biochemicals LightCycler system and the appropriate primers and

hybridization probes developed by using LightCycler Probe Design software

(version 1.0; Idaho Technologies, Inc). All reagents were prepared at 4 C in lowlight to minimize nonspecific amplification and fluorophore degradation.

The PCR mixture consisted of water, manganese acetate (final concentration,

4.25 mM), hybridization probes (each at a concentration of 0.2 M), primers

(each at a concentration of 0.5 M), and a LightCycler RNA master hybridiza-

tion probe enzyme mixture. To initiate the reaction, 500 ng of sample RNA was

added to each capillary, and LightCycler cycling was begun immediately. RNA

samples were quantified immediately before use by spectrophotometric detec-

tion at 260 and 280 nm, and the values were corrected for protein concentrationat 320 nm. RNA sample concentrations calculated by spectrophotometry were

reproducible within 5%.

RT was performed at 61C for 20 min, and this was followed by primarydenaturation of the RNA-cDNA hybrid at 95C for 30 s. The amplification

reaction consisted of 45 cycles of denaturation at 95 C for 1 s, annealing andhybridization at 54C for 15 s, and elongation at 72C for 11 s. Each cycle was

followed by fluorescence monitoring with the LightCycler at 640 nm. Two am-plification reactions were performed for each RNA sample. Data collection andpreliminary analyses were conducted by using the LightCycler data analysis

software (version 3.3).

Real-time RT-PCR analysis. MsNramp expression was quantified by calculat-

ing the percent increase or decrease in transcript number in mycobacterium-

infected tissues or cells compared to the transcript number in sham-injected

controls. Six replicates of each of five RNA concentrations (1,000, 500, 250, 100,

and 50 ng of RNA) were amplified two or three times for each tissue type, and

a mean efficiency of PCR (PCRE) was calculated (Table 2). The PCRE wascalculated as follows: PCRE 101/slope, where 1 PCRE 2.

The slopes for anterior kidney, PM, spleen, and white muscle were measured

by linear regression of the crossing points of the six replicates against the RNA

concentration. The crossing point of a real-time RT-PCR is the point during

amplification at which fluorescence of a sample increases above the background

fluorescence. This point on the amplification curve is proportional to the amountof starting template (MsNramp) in the sample. A percent difference is then

calculated as follows: percent difference (PCRECp 100) 100 (22), where

Cp (control sample crossing point experimental sample crossing point).

Statistical analysis. To calculate crossing points and the slope for PCRE,

linear regression was performed by using the LightCycler software (version 3.3).

Intra- and interassay variations were analyzed by single-factor analysis of vari-

ance ( 0.05), linear regression, Students t test, and power analysis of theexperimental system (22). Each time point sample (1, 3, and 15 days postinocu-

lation) was analyzed by single-factor analysis of variance, and multiple compar-

isons were performed by using Tukeys multiple comparison ( 0.05 and 0.01) in SAS (version 8.0; SAS Institute, Cary, N.C.), with Kramer s modification

for unequal sample sizes where appropriate.

Nucleotide and amino acid accession number. The M. saxatilis MsNramp

nucleotide and deduced amino acid sequences have been deposited in the Gen-

Bank database under accession number AY008746.

RESULTS

MsNramp is a 3,530-bp gene encoding a 554-amino-acid

protein. M. saxatilis PE cell cDNA for MsNramp was isolatedby using combinations of consensus mammal-, trout-, andstriped bass-specific primers (Table 1). Internal coding regionsequences were obtained by using primers NrampA and

NrampB, primers NrampA and MDNMP4, and primersMDNMP1F and OmNramp1463. A total of 1,242 bp of theinternal coding region was sequenced in this manner. Theinternal fragments were used to design primers 5RACE1,3RACE1, 3RACE2, and 3RACE4 for use in 5 and 3 RACE-PCR. 5 RACE, performed with primers 5RACE1 and theGeneRacer 5 primer (Invitrogen), produced a 620-bp productthat included a 183-bp 5 UTR and the translation start codonat position 184. 3 RACE fragments contained a TAG termi-nation codon at position 1848 and a 1,682-bp 3 UTR. Com-pilation and alignment of all the fragments produced by RT-PCR and RACE demonstrated that MsNramp is a 3,530-bpgene with a 1,665-nucleotide single open reading frame encod-ing a 554-amino-acid polypeptide (Fig. 1). There are three

TABLE 2. Tissue-specific constitutive expression of MsNramp

TissueCp for controls(avg SEM)a

PCREb

Fold differencecompared withwhite musclec

Anterior kidney 21.01 0.29 1.72 85PE cells 23.54 0.18 1.80 28Spleen 18.90 0.32 1.70 240

White muscle 29.20 0.32 1.72 NAa The average crossing point (Cp) was calculated from nine control fish (three

fish per time point); the crossing point is the cycle during ampli fication (45 totalcycles) at which fluorescence rises above the background level. The values for alltissues types are significantly different (P 0.01).

b PCRE is the efficiency of the PCR for each tissue type.c The fold difference was calculated by using PCRE

Cp. NA, not applicable.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


5/11

regions of tandem repeats in the 3 UTR, at positions 1876 to1890 (consensus pattern TTCCTCT), 2050 to 2071 (AATCAGAA), and 2949 to 2971 (GTGTGATAAAAT). Two prospec-tive, atypical polyadenylation signals are present at position3425 (nonamer) and position 3436 (hexamer) and are followedclosely by a poly(dA) tail that is at least 32 nucleotides long.

Striped bass MsNramp has all the important motifs and

regulatory elements of mammalian Nramp. The deducedamino acid sequence of striped bass MsNramp shows that thisprotein has a minimum molecular mass of 61,157 and contains

12 putative membrane-spanning domains composed of highlyhydrophobic amino acids (Fig. 2). Analysis of the protein to-pology predicted that the amino and carboxy termini existbelow the membrane with alternating internal and externalloops of hydrophilic amino acids. MsNramp contains threepotential amino-linked glycosylation sites in the external loopbetween TM 7 and TM 8. Two potential phosphorylation sitesrelated to protein kinase C, along with two casein kinase phos-phorylation signatures, are located in the amino terminus, anda single protein kinase C site and two additional casein kinase

FIG. 1. Striped bass MsNramp nucleotide and MsNramp amino acid sequences (GenBank accession number AY008746). Included are the183-bp 5 UTR, the 1,665-bp open reading frame, and the 1,682-bp 3 UTR. The numbers on the right indicate nucleotide and amino acid positions.The brackets indicate the ATG translation start codon (position 184) and the TAG termination codon (position 1848). Single-letter amino aciddesignations are located under the second nucleotide of the corresponding codons. The arrows indicate primer binding (see Table 1 and 2 for

sequences). The motifs in boxes are potential microsatellite tandem repeats, the shaded areas indicate polyadenylation signals, and the double boxindicates the poly(dA) tail.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


6/11

FIG.2.C

lustalXaminoacidalignmentofselectedNramphomologs.Abbreviations:Ms,M.sa

xatilisMsNramp;TrB,T.rubripesNramp

;Dr,D.rerioNramp;Cc,C.carpio

Nramp;Ip,I

.punctatusNramp;OmB,O.mykissNramp

;Hs2,H.sapiensNramp2;Mm2,M.musculusNramp2.AccessionnumbersarelistedinMaterialsandMethods.Periods

indicateaminoacididentitycomparedtothestripedbasssequence.TheresiduessurroundedbythicklinesarepotentialproteinkinaseC(P

KC)phosphorylationsites,andthe

areasinboxesarecaseinkinase(CK)motifs.Thepolypeptidesthatareindoubleboxesandshad

edareputativeTM

numberedconsecutive

ly.Thecross-hatchedareabetween

TM

6andT

M7isaconsensustyrosinekinase(TK)motif,andthesequencessurroundedbyb

rokenlinesareamino-linkedglycosylation

signatures(N-gly).Theconsensus

binding-protein-dependenttransportsysteminnermem

branecomponentsignature(transport)isindicatedbywhitetypeonablackbackground.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


7/11

motifs are present in the carboxy-terminal end. A single ty-rosine kinase site is located between TM 6 and TM 7. Each ofthe potential phosphorylation sites is located within hydro-

philic amino acid subsequences predicted to be intracellular. Ahighly conserved binding-protein-dependent transport systeminner membrane component signature, a prominent feature ofmurine Nramp1 and the proteins encoded by members ofseveral other iron transporter and channel gene families (13),is located in the intracellular region between TM 8 and TM 9.Unlike the C. carpio homolog (49) and other Nramp2 isoforms(31, 40) but similar to channel catfish NrampC (12), no iden-tifiable iron-responsive regulatory-binding-protein site (IRE)consensus sequence (CNNNNNCAGUG) (9) was identified inthe striped bass 3 UTR.

Alignment and phylogenetic analysis group striped bass

MsNramp with other teleost and mammalian Nramp2 pro-

teins.The striped bass

MsNrampnucleotide and MsNrampamino acid sequences were aligned with the sequences of other

vertebrate homologs (Nramp1 and Nramp2) (Fig. 2) in orderto examine potentially important distinguishing characteristics.Three distinct clades were evident in the phylogenetic analysisof Nramp nucleotide and Nramp amino acid sequences. Ver-tebrate Nramp1 clustered in one subgroup, while all teleostsequences clustered with mammalian Nramp2 proteins. Nrampsequences of the Cyprinidae and both paralogs from rainbowtrout formed a separate clade within the teleost sequences.MsNramp was phylogenetically most similar to T. rubripesNramp (Fig. 3).

MsNramp mRNA is expressed in several tissues but at vari-

able levels. Anterior kidney, brain, heart, gill, female and male

gonad, intestine, liver, muscle, PE, peripheral blood leukocyte,and spleen samples were positive for MsNramp mRNA tran-scripts as determined by qualitative RT-PCR with three primer

sets for three male and female striped bass (data not shown).PCR performed with total RNA prior to cDNA generationconfirmed that no genomic DNA contamination was present inthe mRNA samples. For each tissue 5 g of RNA was ana-lyzed. Constitutive expression of MsNramp in striped bass tis-sues was variable, as determined by real-time semiquantitativeRT-PCR. The average crossing points for the different tissuetypes of control striped bass demonstrated that there werelarge constitutive differences in MsNramp expression. Compar-ison of constitutive expression (Table 2) in different tissuesrevealed that expression ofMsNramp was lowest in white mus-cle. The levels of expression were approximately 28-, 85-, and240-fold higher in PE, anterior kidney, and spleen samples,

respectively. Analysis of variance and Tukeys multiple-com-parison test showed that each tissue type was significantly dif-ferent from each of the other tissue types (P 0.01).

Cytology and ultrastructure confirmed that infection of PE

cells occur within 1 day of injection of mycobacteria. To con-firm that striped bass exposed to Mycobacterium harbored my-cobacteria intracellularly within 1 day after infection, light mi-croscopy and transmission electron microscopy were used toexamine PE cells. All infected and control fish survived to theend of the experiment (15 days), and no outward manifesta-tions of disease were apparent. Fish inoculated with M. mari-num had gross inflammation of visceral fat and mesenteries at15 days postinfection, whereas sham-inoculated fish and M.shottsii-inoculated fish displayed no gross inflammation.

FIG. 3. Phylogenetic analysis of teleost and mammalian Nramp proteins. The numbers at the nodes are bootstrap values obtained after 10,000resampling efforts. The GenBank accession number for each taxon is indicated, and the relative genetic distances are indicated by the scale barand the branch lengths. The Nramp1 and Nramp2 proteins form two distinct clades, and all teleost sequences group with Nramp2.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


8/11

Wright-Giemsa-stained cytospin preparations showed thatperitoneal lavages were composed primarily of macrophages(50%), along with various numbers of lymphocytes andthrombocytes and low numbers of granulocytes. Ziehl-Neelsenstaining indicated that both M. marinum and M. shottsii werephagocytosed by PE cells within 1 day after injection. Electronmicroscopy revealed mycobacteria within membrane-limitedphagosome macrophages (Fig. 4).

MsNramp in M. marinum-inoculated striped bass is highly

induced. A primary objective of this study was to document theinduction of MsNramp in fish exposed to M. marinum and M.shottsii (Fig. 5). The expression of MsNramp in PE cells of

striped bass infected with M. marinum (Fig. 5B) was 1,701.0% 14.02% higher than the expression in control PE cells within1 day after injection. The levels of MsNramp in PE cells con-tinued to be elevated after 3 and 15 days, and the levels ofexpression were 412.46% 10.00% and 623.47% 66.66% ofthe level of expression in the control, respectively. Anteriorkidney (Fig. 5A) MsNramp expression in fish exposed to M.marinum did not differ significantly from control expressionuntil 15 days, when the anterior kidney level of expression was130.31% 10.58% of the level of expression in the control. Nosignificant increases were seen in spleen or white muscle sam-ples on any day (data not shown).

M. shottsii induces expression of MsNramp in striped bass

PE cells.PE cells of striped bass inoculated with

M. shottsii

expressed MsNramp at levels that were 216.47% 9.86%,461.34% 20.79%, and 311.89% 21.45% of the controllevels on days 1, 3, and 15, respectively (Fig. 5B). No significantinduction of MsNramp was seen in anterior kidney samples(Fig. 5A) at any time after injection. The expression in thespleen was depressed at 3 days (P 0.05) compared with theexpression in day 3 controls, but by 15 days the levels ofMsNramp in spleen samples were statistically similar for con-trol and M. shottsii-inoculated fish. The results for white mus-cle were more variable than the results for the other tissues,although the values were much lower, and depression ofMsNramp transcription was observed at day 1 (P 0.01) (datanot shown).

DISCUSSION

In this study, we examined the in vivo expression of the M.saxatilis homolog of the Nramp gene (MsNramp) during expo-sure to mycobacteria. We found that striped bass MsNramptranscription is significantly upregulated (17-fold) in PE cellsfollowing infection with M. marinum. M. shottsii also inducedexpression, although not to the degree seen with M. marinum.Induction of expression was rapid (less than 24 h) and longlasting (more than 15 days) in PE cells. The long-lasting natureof the induction may have been the result of mycobacterialreplication, additional infection of previously nave PE cells,

and/or long-lasting induction within individual PE cells. Stim-ulation of mouse bone marrow-derived macrophages with LPSand gamma interferon has shown that there is rapid inductionof Nramp1, which peaks at 12 h (3), while functional alleles ofmurine Nramp1 have a bacteriostatic effect on Mycobacteriumavium-containing phagosomes for at least 10 days (19). In themurine model, Nramp1 is recruited to the membrane of thephagolysosome during the initial stages of mycobacterial infec-tion (29), where it maintains the fusiogenic properties of thiscompartment (19). It is likely, based on the high sequencesimilarity between mammalian and striped bass homologs andon the pattern of induction seen for mycobacterium-infectedPE cells, that striped bass uses the gene product in a similarfashion.

PE cells offishes consist of an enriched population of highlyactivated phagocytes that serve as important mediators of theimmune response to infection within the peritoneal cavity (16).

Assuming that the elevated levels of MsNramp expression inperitoneal preparations is of macrophage origin, lower totallevels ofMsNramp in anterior kidney and spleen samples fromfish inoculated with mycobacteria would be expected as theproportion of macrophages in these tissues is significantlylower than the proportion of PE cells. Trafficking of mycobac-teria by infected PE cells may account for the late increase inMsNramp expression observed in anterior kidney samples. Pre-vious work has shown that well-developed granulomas are notpresent histologically in anterior kidney samples 2 weeks after

FIG. 4. (a) M. marinum (arrow) within a striped bass macrophage. (b) M. shottsii (arrowheads) within striped bass macrophages. Mycobacteriaare contained within a membrane-limited phagosome and are surrounded by electron-opaque material. The images were obtained 24 h afterinjection. Bars 1 m.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


9/11

intraperitoneal injection of mycobacteria (21). In the samestudy the workers did observe small numbers of acid-fast my-cobacteria within inflammatory foci of anterior kidney andspleen samples 2 weeks after intraperitoneal injection. Longer-term analysis of MsNramp expression may indicate that asinfection occurs within the anterior kidney and spleen, differ-entiation and activation of resident macrophages are accom-panied by upregulation of this gene.

The conserved features of MsNramp include a topology of12 TM, N- and C-terminal phosphorylation sites, extracyto-

plasmic glycosylation, and the binding protein-dependenttransport system inner membrane component signature. Thetransport signature is implicated in ATP-binding related totransport functions (2) and is found in several gene families

whose members encode iron transporters and channels (13).Alternative splicing has been identified in several Nramp2 ho-mologs, including human (40), mouse and rat (56), macaque(65), and channel catfish (12) homologs. In the mammalianNramp studies, alternative splicing was shown to correspond toalternate C-terminal amino acids, distinctive subcellular or tis-sue expression, and the presence or absence of an IRE. IREsare stem-loop RNA structures often found in genes that areposttranscriptionally regulated by cellular iron concentrations,as Nramp2 (DCT1) appears to be in rats (30). Channel cat fish

splice variants resulted in a single, non-IRE-encoding open

reading frame, irregardless of which transcript was translated.

No genetic evidence for a second locus or alternative splicing

was found for the striped bass homolog, and preliminary work

with polyclonal antisera directed against the C-terminal 20

amino acids of channel catfish NrampC resulted in identifica-tion of a single band in striped bass but two separate bands in

channel catfish (Charles Rice, Clemson University, personal

communication).

In summary, isolation of important disease resistance loci

and characterization of gene products are important prelimi-nary steps toward a greater understanding of disease resistance

in economically valuable finfish (17). Genes responsible for

innate resistance to intracellular pathogens are likely candi-

dates for selective breeding in aquaculture (62) and enhance

our understanding of the evolution of innate immunity in ver-

tebrates. This study demonstrated that striped bass contain a

highly conserved natural resistance-associated macrophage

protein, MsNramp, that has a high level of homology to mam-

malian Nramp2 and has all the hallmark features of the pro-

teins encoded by the Nramp gene family described for humans

(37, 38) and mice (28, 61). MsNramp is induced in vivo in PE

cells within 1 day of injection ofMycobacterium spp. This is the

FIG. 5. Expression ofM. saxatilis MsNramp as measured by real-time RT-PCR 1, 3, and 15 days after inoculation of M. marinum or M. shottsii.(A) Anterior kidney (AK) results; (B) PE cell results. Note the difference in scale. The data are the means standard errors of the means ofduplicate measurements for three fish per tissue per time point. One asterisk and two asterisks indicate that values are significantly different (P 0.05 and P 0.01, respectively) from the corresponding control values (uninfected group), as determined by multiple comparison with the Tukeytest or the Kramer modification of Tukeys test for unequal sample sizes.


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


10/11

first report of induction of an Nramp gene from fish exposed tointracellular pathogens.

ACKNOWLEDGMENTS

We thank the staff of the laboratory of John Graves for technicalassistance with sequencing, Martha Rhodes and Howard Kator forcultures ofM. marinum and M. shottsii, Corinne Audemard and Seon-

Sook An for LightCycler assay development, Courtney E. Harris forstatistical analysis, and Stephen L. Kaattari for editorial comments anda critical review.

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403410.

2. Ames, G. F. 1986. Bacterial periplasmic transport systems: structure, mech-anism, and evolution. Annu. Rev. Biochem. 55:397425.

3. Atkinson, P. G. P., J. M. Blackwell, and C. H. Barton. 1997. Nramp1 locusencodes a 65 kDa interferon--inducible protein in murine macrophages.Biochem. J. 325:779786.

4. Bellamy, R. 2003. Susceptibility to mycobacterial infections: the importanceof host genetics. Genes Immun. 4:411.

5. Belouchi, A., M. Cellier, T. Kwan, H. S. Saini, G. Leroux, and P. Gros. 1995.The macrophage-specific membrane protein Nramp controlling natural re-sistance to infections in mice has homologues expressed in the root system ofplants. Plant Mol. Biol. 29:11811196.

6. Benson, G. 1999. Tandem repeats finder: a program to analyze DNA se-quences. Nucleic Acids Res. 27:573580.

7. Blaschke, V., K. Reich, S. Blaschke, S. Zipprich, and C. Neumann. 2000.Rapid quantitation of proinflammatory and chemoattractant cytokine ex-pression in small tissue samples and monocyte-derived dendritic cells: vali-dation of a new real-time RT-PCR technology. J. Immunol. Methods 246:7990.

8. Cardinal, J. L. 2001. Mycobacteriosis in striped bass, Morone saxatilis, fromVirginia waters of Chesapeake Bay. M.S. thesis. College of William andMary, Virginia Institute of Marine Science, Gloucester Point, Va.

9. Casey, J. L., M. W. Hentze, D. M. Koeller, S. W. Caughman, T. A. Rouault,R. D. Klausner, and J. B. Harford. 1988. Iron-responsive elements: regula-tory RNA sequences that control mRNA levels and translation. Science240:924928.

10. Cellier, M., A. Belouchi, and P. Gros. 1996. Resistance to intracellularinfections: comparative genomic analysis of Nramp. Trends Genet. 12:201204.

11. Cellier, M., G. Govoni, S. Vidal, T. Kwan, N. Groulx, J. Liu, F. Sanchez, E.

Skamene, E. Schurr, and P. Gros. 1994. Human natural resistance-associ-ated macrophage protein: cDNA cloning, chromosomal mapping, genomicorganization, and tissue-specific expression. J. Exp. Med. 180:17411752.

12. Chen, H., G. C. Waldbieser, C. D. Rice, B. Elibol, W. R. Wolters, and L. A.Hanson. 2002. Isolation and characterization of channel catfish natural re-sistance associated macrophage protein gene. Dev. Comp. Immunol. 26:517531.

13. Dassa, E., and M. Hofnung. 1985. Sequence of gene malG in E. coli K12:homologies between integral membrane components from binding protein-dependent transport systems. EMBO J. 4:22872293.

14. Donovan, A., A. Brownlie, M. O. Dorschner, Y. Zhou, S. J. Pratt, B. H. Paw,R. B. Phillips, C. Thisse, B. Thisse, and L. I. Zon. 2002. The zebrafish mutantgene chardonnay (cdy) encodes divalent metal transporter 1 (DMT1). Blood100:46554659.

15. Dorschner, M. O., and R. B. Phillips. 1999. Comparative analysis of twoNramp loci from rainbow trout. DNA Cell Biol. 18:573583.

16. Enane, N. A., K. Frenkel, J. M. OConnor, K. S. Squibb, and J. T. Zelikoff.1993. Biological markers of macrophage activation: applications for fishphagocytes. Immunology 80:6872.

17. Fjalestad, K. T., T. Gjedrem, and B. Gjerde. 1993. Genetic improvement ofdisease resistance in fish: an overview. Aquaculture 111:6574.

18. Forbes, J. R., and P. Gros. 2001. Divalent-metal transport by NRAMPproteins at the interface of host-pathogen interactions. Trends Microbiol.9:397403.

19. Frehel, C., F. Canonne-Hergaux, P. Gros, and C. De Chastellier. 2002. Effectof Nramp1 on bacterial replication and on maturation of Mycobacteriumavium-containing phagosomes in bone marrow-derived mouse macrophages.Cell. Microbiol. 4:541556.

20. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production offull-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. 85:89989002.

21. Gauthier, D. T., M. W. Rhodes, W. K. Vogelbein, H. Kator, and C. A.Ottinger. 2003. Experimental mycobacteriosis in striped bass Morone saxa-tilis. Dis. Aquat. Organisms 54:105117.

22. Gentle, A., F. Anastasopoulos, and N. A. McBrien. 2001. High-resolutionsemi-quantitative real-time PCR without the use of a standard curve. Bio-Techniques 31:502508.

23. Gomes, M. S., and R. Appelberg. 2002. NRAMP1- or cytokine-inducedbacteriostasis of Mycobacterium avium by mouse macrophages is indepen-dent of the respiratory burst. Microbiology 148:31553160.

24. Govoni, G., F. Canonne-Hergaux, C. G. Pfeifer, S. L. Marcus, S. D. Mills,D. J. Hackam, S. Grinstein, D. Malo, B. B. Finlay, and P. Gros. 1999.Functional expression of Nramp1 in vitro in the murine macrophage lineRAW264.7. Infect. Immun. 67:22252232.

25. Govoni, G., S. Gauthier, F. Billia, N. N. Iscove, and P. Gros. 1997. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in

vitro and in vivo. J. Leukoc. Biol. 62:277286.26. Govoni, G., S. Vidal, S. Gauthier, E. Skamene, D. Malo, and P. Gros. 1996.

The Bcg/Ity/Lsh locus: genetic transfer of resistance to infections inC57BL/6J mice transgenic for Nramp1 Gly169 allele. Infect. Immun. 64:29232929.

27. Gros, P., E. Skamene, and A. Forget. 1981. Genetic control of naturalresistance to Mycobacterium bovis (BCG) in mice. J. Immunol. 127:24172421.

28. Gruenheid, S., M. Cellier, S. Vidal, and P. Gros. 1995. Identification andcharacterization of a second mouse Nramp gene. Genomics 25:514525.

29. Gruenheid, S., E. Pinner, M. Desjardins, and P. Gros. 1997. Natural resis-tance to infection with intracellular pathogens: the Nramp1 protein is re-cruited to the membrane of the phagosome. J. Exp. Med. 185:717730.

30. Gunshin, H., C. R. Allerson, M. Polycarpou-Schwarz, A. Rofts, J. T. Rogers,F. Kishi, M. W. Hentze, T. A. Rouault, N. C. Andrews, and M. A. Hediger.2001. Iron-dependent regulation of the divalent metal ion transporter. FEBSLett. 509:309316.

31. Gunshin, H., B. Mackenzie, U. V. Berger, Y. Gunshin, M. F. Romero, W. F.

Boron, S. Nussberger, J. L. Gollan, and M. A. Hediger. 1997. Cloning andcharacterization of a mammalian proton-coupled metal-ion transporter. Na-ture 388:482488.

32. Heckert, R. A., S. Elankumaran, A. Milani, and A. Baya. 2001. Detection ofa new Mycobacterium species in wild striped bass in the Chesapeake Bay.J. Clin. Microbiol. 39:710715.

33. Hedrick, R. P., T. McDowell, and J. Groff. 1987. Mycobacteriosis in culturedstriped bass from California. J. Wildl. Dis. 23:391395.

34. Hofmann, K., P. Bucher, L. Falquet, and A. Bairoch. 1999. The PROSITEdatabase, its status in 1999. Nucleic Acids Res. 27:215219.

35. Hoyt, R. E., J. E. Bryant, S. F. Glessner, F. C. Littleton, Jr., R. W. Sawyer,R. J. Newman, D. B. Nichols, A. P. Franco, Jr., and N. R. Tingle, Jr. 1989.M.marinum infections in a Chesapeake Bay community. Va. Med. 116:467470.

36. Hu, J., N. Bumstead, D. Burke, F. A. P. D. Leon, E. Skamene, P. Gros, andD. Malo. 1995. Genetic and physical mapping of the natural resistance-associated macrophage protein 1 (NRAMP1) in chicken. Mamm. Genome6:809815.

37. Kishi, F. 1994. Isolation and characterization of human Nramp cDNA.Biochem. Biophys. Res. Commun. 204:10741080.

38. Kishi, F., and M. Tabuchi. 1998. Human natural resistance-associated mac-rophage protein 2: gene cloning and protein identification. Biochem. Bio-phys. Res. Commun. 251:775783.

39. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molec-ular evolutionary genetics analysis software. Bioinformatics 17:12441245.

40. Lee, P. L., T. Gelbart, C. West, C. Halloran, and E. Beutler. 1998. Thehuman Nramp2 gene: characterization of the gene structure, alternativesplicing, promoter region and polymorphisms. Blood Cells Mol. Dis. 24:199215.

41. Luna, L. G. (ed.). 1968. Manual of histologic staining methods of the ArmedForces Institute of Pathology, 3rd ed. McGraw-Hill, New York, N.Y.

42. Makui, H., E. Roig, S. T. Cole, J. D. Helmann, P. Gros, and M. F. Cellier.2000. Identification of the Escherichia coli K-12 Nramp orthologue (MntH)as a selective divalent metal ion transporter. Mol. Microbiol. 35:10651078.

43. Nigrelli, R. F., and H. Vogel. 1963. Spontaneous tuberculosis in fishes and inother cold-blooded vertebrates with special reference to Mycobacterium for-tuitum Cruz from fish and human lesions. Zoologica (New York) 48:131143.

44. Pinner, E., S. Gruenheid, M. Raymond, and P. Gros. 1997. Functionalcomplementation of the yeast divalent cation transporter family SMF byNRAMP2, a member of the mammalian natural resistance-associated mac-rophage protein family. J. Biol. Chem. 272:2893328938.

45. Portnoy, M. E., X. F. Liu, and V. C. Culotta. 2000. Saccharomyces cerevisiaeexpresses three functionally distinct homologues of the nramp family ofmetal transporters. Mol. Cell. Biol. 20:78937902.

46. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogel-bein, M. M. Floyd, W. R. Butler, F. D. Quinn, C. Ottinger, and E. Shotts.2001. A unique Mycobacterium species isolated from an epizootic of stripedbass ( Morone saxatilis). Emerg. Infect. Dis. 7:896899.

47. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogel-bein, F. Quinn, M. M. Floyd, W. R. Butler, and C. A. Ottinger. 2003.Mycobacterium shottsii sp. nov., a slowly growing species isolated from Ches-apeake Bay striped bass ( Morone saxatilis). Int. J. Syst. Evol. Microbiol.53:421424.

48. Rodrigues, V., P. Y. Cheah, K. Ray, and W. Chia. 1995. malvolio, the Dro-sophila homologue of mouse NRAMP-1 (Bcg), is expressed in macrophages


byonOc

tober25,2009

iai.asm.org

Downloadedfrom


11/11

and in the nervous system and is required for normal taste behaviour. EMBOJ. 14:30073020.

49. Saeij, J. P. J., G. F. Wiegertjes, and R. J. M. Stet. 1999. Identification andcharacterization of a fish natural resistance-associated macrophage protein(NRAMP) cDNA. Immunogenetics 50:6066.

50. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406425.

51. Secombes, C. J. 1990. Isolation of salmonid macrophages and analysis oftheir killing activity, p. 137154. In T. C. Fletcher, D. P. Anderson, B. S.

Roberson, and W. B. van Muiswinkel (ed.), Techniques in fish immunology,vol. 1. SOS Publications, Fair Haven, N.J.

52. Sibthorpe, D. 2002. Molecular evolution of the solute carrier family 11(SLC11) protein in the pufferfish, Fugu rubripes. Ph.D. thesis. University ofCambridge, Cambridge, United Kingdom.

53. Stordeur, P., L. F. Poulin, L. Craciun, L. Zhou, L. Schandene, A. de Lava-reille, S. Goriely, and M. Goldman. 2002. Cytokine mRNA quantification byreal-time PCR. J. Immunol. Methods 259:5564.

54. Su, M. A., C. C. Trenor III, J. C. Fleming, M. D. Fleming, and N. C. Andrews.1998. The G185R mutation disrupts function of the iron transporterNramp2. Blood 6:21572163.

55. Tabaska, J. E., and M. Q. Zhang. 1999. Detection of polyadenylation signalsin human DNA sequences. Gene 231:7786.

56. Tabuchi, M., N. Tanaka, J. Nishida-Kitayama, H. Ohno, and F. Kishi. 2002. Alternative splicing regulates the subcellular localization of divalent metaltransporter 1 isoforms. Mol. Biol. Cell 13:43714387.

57. The C. elegans Sequencing Consortium. 1998. Genome sequence of the

nematode C. elegans: a platform for investigating biology. Science 282:20122018.

58. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1997. The ClustalXWindows interface: flexible strategies for multiple sequence alignment aidedby quality analysis tools. Nucleic Acids Res. 22:46734680.

59. Torres, M. J., A. Criado, J. C. Palomares, and J. Aznar. 2000. Use ofreal-time PCR and fluorimetry for rapid detection of rifampin and isoniazidresistance-associated mutations in Mycobacterium tuberculosis. J. Clin. Mi-crobiol. 38:31943199.

60. Tusnady, G. E., and I. Simon. 2001. The HMMTOP transmembrane topol-ogy prediction server. Bioinformatics 17:849850.

61. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, and P. Gros. 1993. Naturalresistance to infection with intracellular parasites: isolation of a candidatefor Bcg. Cell 73:469485.

62. Wiegertjes, G. F., R. J. M. Stet, H. K. Parmentier, and W. B. van Muiswinkel.1996. Immunogenetics of disease resistance in fish: a comparative approach.Dev. Comp. Immunol. 20:365381.

63. Wittwer, C. T., M. G. Herrmann, A. A. Moss, and R. P. Rasmussen. 1997.Continuous fluorescence monitoring of rapid cycle DNA amplification. Bio-Techniques 22:130131, 134138.

64. Zeligman, I. 1972. Mycobacterium marinum granuloma. A disease acquiredin the tributaries of Chesapeake Bay. Arch. Dermatol. 106:2631.

65. Zhang, L., T. Lee, Y. Wang, and T. W. Soong. 2000. Heterologous expression,functional characterization and localization of two isoforms of the monkeyiron transporter Nramp2. Biochem. J. 349:289297.

Editor: F. C. Fang


byonOc

tober25,2009

iai.asm.org

Downloadedfrom

burge et al. 2004 nramp in vivo

Documents