Brief Communication: Discouraging Prospects for AncientDNA From India

S. SIVA KUMAR,1,2 IVANE NASIDZE,1 S.R. WALIMBE,3AND MARK STONEKING1*1Max Planck Institute for Evolutionary Anthropology,Leipzig, D-04103 Germany2Centre for Cellular and Molecular Biology, Hyderabad, 500007 India3Department of Archaeology, Post-Graduate Institute, Deccan College,Yerawada, Pune, 411029 India

KEY WORDS amino acid; racemization; human DNA; skeletalremains

Tremendous biological and cultural vari-ability is manifested in the prehistoric andcontemporary populations of India (Majum-der, 1998). For example, the “People of In-dia” project of the Anthropological Survey ofIndia has recently identified as many as4,694 living communities in India (Singh,1998). Molecular genetic analyses are begin-ning to provide interesting insights into thestructure, history, and relationships of In-dian populations (Bamshad et al., 1996,1998; Majumder et al., 1999; Mountain etal., 1995; Watkins et al., 1999). To date,such analyses have been restricted to con-temporary populations; further contribu-tions could be expected from ancient DNAstudies (Handt et al., 1996; Kumar et al.,1999; Stoneking, 1995), if ancient speci-mens with suitable amounts of surviving,authentic DNA can be found and analyzed.

Authenticating DNA from human re-mains is complicated by contamination ofspecimens with extraneous human DNAfrom people who have handled the speci-mens, as well as from the laboratory proce-dures involved in processing specimens forDNA analysis. Typically, only a minority ofancient specimens contain sufficient au-thentic DNA for analysis (Handt et al.,1996; Poinar et al., 1996; Stone and Stonek-ing, 1999), and distinguishing such speci-mens from false positives due to contamina-tion is a difficult challenge. Hence, attentionhas focused on developing proxy measuresthat give some independent indication of

the likelihood that authentic ancient DNAwould be found in a specimen, and a partic-ularly promising approach is amino-acid ra-cemization (Poinar et al., 1996). Accordingto this approach, the same environmentalconditions that lead to DNA degradation inancient specimens also lead to racemization(change from the L-form to the D-form) ofamino acids, with the total amount of aminoacids and the rate of racemization of aspar-tic acid (Asp) correlating empirically withDNA degradation (Poinar et al., 1996). Inparticular, only specimens with a D/L Aspratio of 0.12 or less have yielded authenticDNA (Poinar et al., 1996; H. Poinar, per-sonal communication). Moreover, contami-nation of the specimen with exogenousamino acids is readily detected as a differ-ence in the overall amino-acid compositioncompared to that expected for collagen, theprimary protein in bone. We therefore ex-amined the amino-acid composition and ra-cemization for 61 human bone and teethspecimens that range in age from100–6,500 years BP, from 21 sites in south-ern and central India (Fig. 1).

Grant sponsor: Deutsches Akademisches Austauschdienst.Permanent address of S. Siva Kumar: School of Environmen-

tal Sciences, Jawaharlal Nehru University, New Delhi, India.*Correspondence to: Mark Stoneking, Max Planck Institute

for Evolutionary Anthropology, Inselstrasse 22, D-04103Leipzig, Germany. E-mail: stoneking@eva.mpg.de

Received 3 January 2000; accepted 26 April 2000.

AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 113:129–133 (2000)

© 2000 WILEY-LISS, INC.

METHODS AND RESULTSSpecimens (bone or tooth) were scraped

with a scalpel, and 10–25 mg of the result-ing powder were hydrolyzed, derivatized,and analyzed by high-pressure liquid chro-

matography (HPLC), as described previ-ously (Poinar et al., 1996). The amino-acidcontent (based on eight amino acids) wasquite low in all specimens (average, 400ppm; range, 0–4,970 ppm). By contrast, a

Fig. 1. Map of India, indicating approximate locali-ties (in parentheses are number of samples, and approx-imate age in years): 1, Bhimbetka (4, 5,000); 2, Langh-naj (4, 4,500); 3, Bagor (4, 2,000–6,500); 4, Tekkalakota(1, 4,000); 5, Budihal, (1, 3,600); 6, Daimabad (1, 3,000);7, Kaothe (2, 3,800); 8, Chandoli (1, 3,000); 9, Walki (1,2,800); 10, Nevasa (1, 3,000); 11, Inamgaon (22, 2,600–

3,200); 12, Majurjhari (6, 2,400); 13, Kodumanal (3,2,400); 14, S. Pappinayanakanpatti (1, 2,300); 15, Mi-nakshipuram (1, 2,200); 16, Balathal (1, 1,000); 17,Kuntasi (2, 1,000 and 1,200); 18, Navadatuli (2, 1,400and 1,500); 19, Kalpi (1, age uncertain); 20, Khandili (1,100); and 21, Padri (1, 1,500).

130 S.S. KUMAR ET AL.

modern bone yielded about 110,000 ppm,while the Feldhofer Neandertal bone fromwhich authentic DNA was obtained yieldedabout 83,000 ppm (Krings et al., 1997). For-ty-nine of the ancient Indian specimens(75%) gave D/L Asp ratios of 0.2 or greater,and only six specimens (9%) gave D/L Aspratios of 0.1 or less (the range most compat-ible with successful DNA retrieval). How-ever, while glycine typically predominatesin bone proteins, as shown in Figure 2 for amodern bone, for all of the ancient Indianspecimens the glycine content was greatlyreduced, averaging just 2.5% (range, 0.4–15.7%); results from a 100-year-old boneand a 3,800-year-old bone are shown in Fig-ure 2.

Given the overall low amino-acid contentand reduced amount of glycine for all of theancient Indian specimens, it is probablethat the amino-acid results do not reflectendogenous proteins, but rather contami-

nating amino acids, most likely of bacterialorigin. Therefore, even the specimens withlow D/L Asp ratios would not be expected toyield authentic DNA. We nevertheless didattempt to extract DNA from the 3,800-year-old specimen whose amino-acid resultsare shown in Figure 2; this bone came fromthe Kaothe site and had a total amino-acidcontent of 2,600 ppm and a D/L Asp ratio of0.07. DNA was extracted from 0.25 g of pow-der as previously described (Hoss andPaabo, 1993), and PCR was performed usinghuman mtDNA primers L16209 andH16271 (Stone and Stoneking, 1998) for 50cycles (initial denaturation for 5 min at95°C, followed by denaturation for 30 sec at95°C, annealing for 30 sec at 55°C, and ex-tension for 30 sec at 72°C) in a 50-ml reac-tion containing 1 3 AmpliTaq Gold (Perkin-Elmer Cetus) buffer; 2.5 mM MgCl2; 200 mMeach dATP, dGTP, dCTP, and dTTP; 40 mgbovine serum albumin (Boehringer Mann-

Fig. 2. Amino-acid profiles (mole percent for eight amino acids) of a modern bone (Krings et al., 1997),a 100-year-old bone, and a 3,800-year-old bone.

ANCIENT DNA FROM INDIA 131

heim); 0.2 mM each primer; and 2.5 UAmpliTaq Gold (Perkin-Elmer Cetus). PCRwas performed a total of four times on thisextract, but no products were obtained (Fig.3). The procedures used to reduce labora-tory contamination have been described(Handt et al., 1994), and all extraction andPCR controls were consistently negative. Inour hands these primers are capable of rou-tinely detecting 10–100 mtDNA copies froma dilution series of human genomic DNA(Fig. 3). Addition of 2,000 copies of mtDNAto a PCR containing the ancient templateresulted in a product (Fig. 3), indicatingthat the extract from the ancient specimenwas not inhibiting the PCR.

Moreover, the same extraction and PCRconditions were attempted on a 13,000-year-old ground sloth bone, using the following

primers: TCGACAAACCCCGATAGACCT(forward); and CCCATCTCTTTCCACCCCAT(reverse). These primers amplify a 152-bpfragment of the 12S rRNA gene and weredesigned by M. Hofreiter to be specific forground sloth mtDNA. The resulting PCRproduct was cloned and sequenced, and thesequence that was obtained was identical tothe previously published sequence from thisbone (Hoss et al., 1996). It therefore does seemas if our extraction and PCR conditions wouldhave been capable of detecting any authenticDNA that was present in the ancient Indianspecimens.

CONCLUSIONS

We thus conclude that there is insuffi-cient DNA surviving in these ancient In-dian specimens for analysis. Even furthertechnical developments in extracting DNAfrom ancient specimens are unlikely to im-prove the situation, as the amino-acidanalysis indicates that little if any endog-enous protein remains in the specimens,and hence there is unlikely to be any sur-viving DNA. Since these specimens allcame from open-air sites, it is quite likelythat the tropical conditions (in particular,exposure to heat and moisture) have led torapid deterioration of the remains, as wasobserved previously (Holland et al., 1993).Based on our results, further destructiveanalysis of remains from similar sites inIndia is not warranted; attempts to obtainancient DNA from India should insteadfocus on sites in nontropical environmentsand/or cave sites.

ACKNOWLEDGMENTS

We thank M. Hofreiter for the 12S rRNAprimers and the dilution series of humanDNA, and H. Poinar, A. Stone, and S. Paabofor valuable discussion. S.S.K. was sup-ported by a scholarship from the DeutschesAkademisches Austauschdienst.

LITERATURE CITED

Bamshad M, Fraley AE, Crawford MH, Cann RL, BusiBR, Naidu JM, Jorde LB. 1996. mtDNA variation incaste populations of Andhra Pradesh, India. HumBiol 68:1–28.

Bamshad MJ, Watkins WS, Dixon ME, Jorde LB, RaoBB, Naidu JM, Prasad BVR, Rasanayagam A, Ham-

Fig. 3. PCR products obtained with primers L16209and H16271 (expected size, 105 bp). Lane 1, molecularsize marker (50-bp ladder, Boehringer Mannheim);lane 2, approximately 1,000 human mtDNA copies;lane 3, approximately 100 human mtDNA copies; lane4, DNA extract from the ancient bone; lane 5, extrac-tion control (control extracted in parallel with the spec-imen, but containing no source of DNA); lanes 6–9,PCR controls (controls consisting of all PCR componentsbut no added DNA); lane 10, DNA extract as in lane 4,spiked with approximately 2,000 copies of humanmtDNA.

132 S.S. KUMAR ET AL.

mer MF. 1998. Female gene flow stratifies Hinducastes. Nature 395:651–652.

Handt O, Richards M, Trommsdorff M, Kilger C, Si-manainen J, Georgiev O, Bauer K, Stone A, Hedges R,Schaffner W, Utermann G, Sykes B, Paabo S. 1994.Molecular genetic analyses of the Tyrolean Ice Man.Science 264:1775–1778.

Handt O, Krings M, Ward RH, Paabo S. 1996. Theretrieval of ancient human DNA sequences. Am JHum Genet 59:368–376.

Holland MM, Fisher DL, Mitchell LG, Rodriguez WC,Canik JJ, Merril CR, Weedn VW. 1993. MitochondrialDNA sequence analysis of human skeletal remains—identification of remains from the Vietnam War. JForensic Sci 38:542–553.

Hoss M, Paabo S. 1993. DNA extraction from Pleisto-cene bones by a silica-based purification method. Nu-cleic Acids Res 21:3913–3914.

Hoss M, Dilling A, Currant A, Paabo S. 1996. Molecularphylogeny of the extinct ground sloth Mylodon dar-winii. Proc Nat Acad Sci USA 93:181–185.

Krings M, Stone A, Schmitz RW, Krainitzki H, Stonek-ing M, Paabo S. 1997. Neandertal DNA sequencesand the origin of modern humans. Cell 90:19–30.

Kumar SS, Subramanian V, Walimbe SR, Singh L.1999. Current trends in ancient DNA studies—a re-view. Curr Sci 76:879–885.

Majumder PP. 1998. People of India: biological diversityand affinities. Evol Anthropol 6:100–110.

Majumder PP, Roy B, Banerjee S, Chakraborty M, DeyB, Mukherjee N, Roy M, Thakurta PG, Sil SK. 1999.

Human-specific insertion deletion polymorphisms inIndian populations and their possible evolutionaryimplications. Eur J Hum Genet 7:435–446.

Mountain JL, Hebert JM, Bhattacharya S, UnderhillPA, Ottolenghi C, Gadgil M, Cavalli-Sforza LL. 1995.Demographic history of India and mtDNA-sequencediversity. Am J Hum Genet 56:979–992.

Poinar HN, Hoss M, Bada JL, Paabo S. 1996. Aminoacid racemization and the preservation of ancientDNA. Science 272:864–866.

Singh KS. 1998. The people of India: diversities andlinkages. In: Balasubramanian D, Rao NA, editors.The Indian human heritage. Hyderabad, India: Uni-versity Press. p 78–86.

Stone AC, Stoneking M. 1998. mtDNA analysis of aprehistoric Oneota population: implications for thepeopling of the New World. Am J Hum Genet 62:1153–1170.

Stone AC, Stoneking M. 1999. Analysis of ancient DNAfrom a prehistoric Amerindian cemetery. PhilosTrans R Soc London [Biol] 354:153–159.

Stoneking M. 1995. Ancient DNA: how do you knowwhen you have it and what can you do with it? Am JHum Genet 57:1259–1262.

Watkins WS, Bamshad M, Dixon ME, Rao BB, NaiduJM, Reddy PG, Prasad BVR, Das PK, Reddy PC, GaiPB, Bhanu A, Kusuma YS, Lum JK, Fischer P, JordeLB. 1999. Multiple origins of the mtDNA 9-bp dele-tion in populations of South India. Am J Phys An-thropol 109:147–158.

ANCIENT DNA FROM INDIA 133