Proc. Natl. Acad. Sci. USAVol. 87, pp. 8350-8354, November 1990Biochemistry

Bleomycin-induced DNA lesions at mutational hot spots:Implications for the mechanism of double-strand cleavage

(apurlnlc/apyrlimdinic sites/oxddative mutagens/cdosely opposed lesions/endonuclease Ill)

ROBERT J. STEIGHNER* AND LAWRENCE F. POVIRKtDepartment of Pharmacology and Toxicology, Medical College of Virginia, Virginia Commonwealth University, Richmond, VA 23298

Communicated by Arthur B. Pardee, July 30, 1990 (received for review April 30, 1990)

ABSTRACT Using various end-labeled, defined-sequenceDNA substrates, we examined bleomycin-induced damage atseveral G'C base pairs which correspond to mutational hotspots. The most frequent lesions detected were single-strandbreaks and single apu inic/apyrimidinic (AP) sites at the Cresidue, suggesting that this was the primary site of damage.Strand breaks and AP sites also occurred, but less frequently,at a secondary damage site-i.e., the directly opposed Gresidue in the complementary strand. However, damage at thesecondary site occurred only when a strand break was presentat the primary site, and AP sites at the primary site were neveraccompanied by closely opposed damage in the complementarystrand. Thus, formation of a strand break at the primarydamage site was a necessary though not sufficient condition forattack at the secondary site. Similar patterns were seen at othersequences attacked by bleomycin, although primary and sec-ondary sites were sometimes staggered by one nucleotideposition rather than directly opposed. These and other resultssuggest a mechanism of double-strand cleavage in which bleo-mycin Is reactivated during formation of the first strand break,and the reactivated drug subsequently attacks the complemen-tary strand at a specific position which is not normally a site ofbleomycin-induced cleavage. Regeneration of activated bleo-mycin could result from a reaction between Fe(w)'bleomycinand a 4'-peroxyl derivative of deoxyribose, both producedduring formation of the strand break.

The fact that bleomycin produces double-strand breaks withsingle-hit kinetics suggests that these lesions result from asingle interaction between bleomycin and DNA (1, 2). How-ever, the chemistry of activated bleomycin (3, 4) gives nosuggestion of bifunctionality, and the mechanism of double-strand cleavage has remained uncertain. We recently showedthat most bleomycin-induced double-strand breaks consist ofa "primary" site, which follows the normal G-Y (Y =pyrim-idine nucleoside) specificity characteristic of bleomycin-induced single-strand cleavage, and a secondary site (in theopposite strand), which is seldom a G-X sequence and isusually a site where single-strand cleavage is rare (2). Inaddition to double-strand breaks, bleomycin induces forma-tion of apurinic/apyrimidinic (AP) sites with closely opposedstrand breaks, and these bivalent lesions have been impli-cated in bleomycin-induced mutagenesis in A phage (5, 6). Toclarify the mechanism by which bleomycin effects concom-itant damage to both DNA strands, we have examined thedetailed structure of bivalent lesions induced by bleomycin atspecific sites in defined-sequence DNA substrates, particu-larly those corresponding to mutational hot spots.

MATERIALS AND METHODSMaterials. Recombinant plasmids were constructed by

cloning either a synthetic 25-mer (pc1245, Fig. 1 Upper) or the

538-base-pair (bp) Nsi I fragment ofA DNA (pcI538) in the PstI site of pUC19. Various restriction fragments were 3'-end-labeled with the Klenow fragment ofDNA polymerase and anappropriate deoxynucleoside [a-32P]triphosphate or were 5'-end-labeled with T4 polynucleotide kinase and [y-32P]ATP,as described previously (2). Bleomycin A2 was a gift ofW. T.Bradner (Bristol Laboratories) and Fe(III)*bleomycin A2 wasprepared as described (5). Escherichia coli endonuclease IIIwas a gift of R. P. Cunningham (State University of NewYork, Albany).Bleomycin-DNA Reactions. Reaction mixtures, usually 0.1

ml, contained calf thymus DNA at 20 gg/ml, a small amount(

Biochemistry: Steighner and Povirk

230 213 4iv v

240 1 250 2604

Proc. Natl. Acad. Sci. USA 87 (1990) 8351

*

1 2 3

A7V

*w. w~~~w r .s~~

v &*go

.CCGGG.... CCTGCACCTTCA&TCGCCAGAGMATCTGCAGGCATGCAAGCT..

.GGCCC.... GGACGTGGAAGTTAGCGGTCTCTTTAGACGTCCGTACGTTCGA..t A3 t

2A

*

1 2 3B ,,,

14 AK

AyaI PStI PStI indIIIpUC19 ------ lambda cI ---- -- pUC19-

pCI245140

4

120 1305 4 32 1 145I, , ,

ACAAGATGGGGATGGGGCAGTCAGGCGTTGG ...... TGTTCTACCCCTACCCCGTCAGTCCGCAACC*

t A t *A5 t 3 21

4

pcI538

FIG. 1. (Upper) Bleomycin-induced damage in plasmid pc1245,which contains the base-pair 245 hot spot. Boldface numbers indicatesites of closely opposed damage in opposite strands and correspondto numbered bands on nondenaturing gels (Fig. 2). At all threenumbered sites, both double-strand breaks and putrescine-sus-ceptible sites (presumably AP sites) with closely opposed breakswere formed. For the AP sites with closely opposed breaks, arrows( t ) indicate the nucleotide where the break was formed (the primarysite), while triangles (A) indicate the nucleotide where the AP siteoccurred (the secondary site). At site 2, either lesion could occur ineither strand. Asterisks (*) indicate positions of end-labeling; 5'-end-labeled fragments were used to distinguish direct breaks fromcleaved AP sites, while 3'-end-labeled fragments were used todetermine the pairing of sites of concurrent damage in top and bottomstrands, as described previously (2). The synthetic insert is shown inboldface. Numbering of nucleotide positions is relative to the cIgene, even for sequences outside the insert. (Lower) Bleomycin-induced damage to bases 115-145 of the cI gene in the plasmidpcl538. Symbols are as in Upper, with lesions characterized asdescribed for pc1245. Sites 1, 3, 4, and 5 were strong sites of closelyopposed damage, while site 2 was a weak site. Sites 1 and 3, basepairs 143 and 140, are mutational hot spots. There was one exceptionto the usual selection rules for primary and secondary sites in thisfragment: The T-G-A at base 136, bottom strand, was sometimes aprimary site; a few other T-G-A sequences in other fragments werealso weak primary sites. End-labeling was at base 100 (BstNI site) orat base 172 (Sal I site in pUC19 polylinker).

formed at the same sequence positions as the direct double-strand breaks. Consistent with this proposal, endonucleaseIII, a type I AP endonuclease, also increased the intensity ofall but a few bands (discussed below). To distinguish whichstrand contained the putative AP site in these double closelyopposed damages, 3' termini of direct and putrescine-dependent double-strand breaks were examined. Cleavage ofAP sites by putrescine leaves a 3'-phosphate terminus whichcan be converted to a 3'-hydroxyl by the 3'-phosphataseactivity of T4 polynucleotide kinase. For short fragments,this 3'-hydroxyl terminus can be distinguished from a 3'-phosphoglycolate terminus (characteristic of a direct strandbreak) by differential mobilities of the fragments on sequenc-ing gels (8).When band 1 from the fragment labeled at the HindIII site

and treated with bleomycin alone was eluted and run on adenaturing sequencing gel, a single band was seen corre-sponding to cleavage at the G at position 245 in the bottomstrand (Fig. 3, site 1). The band ran just ahead of theMaxam-Gilbert marker, consistent with a 3'-phosphoglyco-late terminus (10, 11). When band 1 was isolated from thesample treated with bleomycin plus putrescine, a similar butsomewhat broadened band was seen on the denaturing gel.When this sample was treated with 3'-phosphatase, a second,slower-migrating, less-intense band appeared, suggestingconversion of a 3'-phosphate to a 3'-hydroxyl terminus (Fig.

SITE

2

0 4

FIG. 2. Direct, putrescine-dependent, and endonuclease III-dependent site-specific double-strand cleavage by bleomycin in5'-end-labeled fragments of pcI245, as determined by nondenaturinggel electrophoresis. An 80-bp fragment labeled at the HindIlI site atbase pair 271 (A), or a 159-bp fragment labeled at the AvaI site at basepair 208 (B) was treated with 1 AiM bleomycin, passed through aCM-25 Sephadex column to remove bleomycin, and then given notreatment (lane 1) or treated with putrescine (lane 2) or with endo-nuclease III (lane 3). Numbered bands correspond to numbered sitesof closely opposed damage shown in Fig. 1 Upper; since the twolabeling sites lie on opposite sides of these cleavage sites, the orderof fragments is reversed in A and B. Full-length DNA appears at thetop of the gel in A but is not shown in B. Putrescine treatmentincreased the intensity of all bands. Densitometric scans indicatedincreases in band 1 of 28% ± 6% (SD, n = 6) for the fragment labeledat Hindill and 37% + 19%o (n = 11) for that labeled atAva I. Increasesin bands 2 and 3 were somewhat greater, approaching 2-fold.Endonuclease III produced increases in band intensities comparableto those seen with putrescine, except for band 1 in A and band 3 inB (see text). Analysis of eluted bands is shown in Figs. 3 and 4.

3, lane 4). This result suggests that bleomycin induced lesionsconsisting of an AP site at the G at position 245 plus a closelyopposed strand break; treatment with putrescine would con-vert these lesions to double-strand breaks bearing a 3'-

; ot: *.~1 2 A 3 4 A

G G

G

G -*0 2

A_ _~~~~G

T_ T~~~~~~~C

- aGd1op T

a 40C 1 2 3 A 4 5 6 C 7 8 9 A 10 11 12 C 13 14 AT G T G T G

FIG. 3. Sequencing gel analysis of cleavage sites and termini ofclosely opposed damages in pcI245, with label at the 5' terminus atthe HindIII site (bottom strand in Fig. 1). Samples in even-numberedlanes were treated with 3'-phosphatase just before sequencing gelanalysis. Lanes 1-6 show band 1 eluted from the gel shown in Fig.2A, for samples treated with bleomycin only (lanes 1 and 2),bleomycin plus putrescine (lanes 3 and 4), or bleomycin plus endo-nuclease III (lanes 5 and 6). Lanes 7 and 8 show the eluted shoulderband from the endonuclease Ill-treated sample; because bands inlanes 7 and 8 were very faint, a longer exposure of the same gel hasbeen superimposed. Lanes 9-14 show single-strand breaks and singleAP sites in the remaining full-length fragment for samples treatedwith bleomycin only (lanes 9 and 10), bleomycin plus putrescine(lanes 11 and 12), or bleomycin plus endonuclease III (lanes 13 and14). Numbered cleavage sites correspond to those shown in Fig. 1Upper. (Inset) Similar experiment in which the same initial fragmentwas treated with bleomycin (lanes 1 and 2) or bleomycin plushydrazine (lanes 3 and 4) and band 1 (lanes 2 and 4) or the remainingfull-length fragment (lanes 1 and 3) was isolated from a nondenaturinggel and run on a sequencing gel (without 3'-phosphatase treatment).Splitting of bands into doublets in the hydrazine-treated samples isdue to formation of a 3'-pyridazinylmethyl derivative upon cleavageof AP sites by hydrazine. CT and AG lanes are Maxam-Gilbertsequencing markers.

210*1

*

Dow

nloa

ded

by g

uest

on

June

26,

202

1

8352 Biochemistry: Steighner and Povirk

phosphate terminus where this AP site had been cleaved.Two additional results confirmed that the 3'-phosphate ter-minus was derived from an AP site. First, when the sameinitial fragment was treated with bleomycin plus endonucle-ase III, no increase in intensity of band 1 was seen; instead,a slower migrating shoulder band appeared (Fig. 2A, lane 3).This band presumably represents a double-strand break withan AP site remaining attached to the 3' end (retarding itsmigration), as expected for AP site cleavage by endonucleaseIII (12). When the shoulder band was eluted and treated withbutylamine to remove the cleaved AP site, subsequent treat-ment with 3'-phosphatase apparently converted most of it to3'-hydroxyl (Fig. 3, lane 8). Second, when same initialsubstrate was treated with bleomycin plus hydrazine, mate-rial from band 1 generated two bands on the sequencing gel,one consistent with a phosphoglycolate terminus, and a lessintense band migrating one nucleotide more slowly, charac-teristic of the pyridazinylmethyl derivative (7) producedwhen bleomycin-induced AP sites are cleaved by hydrazine(Fig. 3 Inset). In addition to confirming the presence ofan APsite, this result suggests that the AP site has the unique4'-ketone, 1'-aldehyde structure characteristic of bleomycin-induced AP sites (3, 4), since only this type of oxidized APsite can form a pyridazinylmethyl derivative.

In contrast, when a fragment 5'-end-labeled at the Ava Isite was treated with bleomycin, bleomycin plus putrescine(Fig. 2), or bleomycin plus hydrazine (not shown), materialfrom band 1 gave a single band on nondenaturing gels, eitherwith or without 3'-phosphatase treatment (Fig. 4, site 1),suggesting that it contained only molecules with phospho-glycolate termini. The mobility of this band indicated cleav-age at the C at base 245 (top strand in Fig. 1 Upper), directlyopposite the cleavage in the bottom strand. Since putrescine(as well as endonuclease III) consistently increased theintensity of band 1, putrescine-susceptible lesions (presum-ably AP sites) with closely opposed strand breaks must havebeen induced, but the putative AP sites must have alwaysoccurred in the complementary (bottom) strand (Figs. 1 and5).

,-SC1-

d o -oc A

a a

C

A-- A

2-C40qpa&w

G_m-a3-T g -

C

C

w

A-A 1 2 3 4 CG T

A 56 7 8G T

CGCCG

TCT

ACTTCC

A

C-2G

T-3C

FIG. 4. Sequencing gel analysis of cleavage sites and termini ofclosely opposed damages in pcI245, with label at the 5' terminus atthe Ava I site (top strand in Fig. 1 Upper). Samples in even-numberedlanes were treated with 3'-phosphatase. Lanes 1-4 show bands 1, 2,and 3 eluted from the gel shown in Fig. 2B, for DNA treated withbleomycin alone (lanes 1 and 2) or bleomycin plus putrescine (lanes3 and 4). Lanes 5-8 show the remaining full-length fragment forsamples treated with bleomycin alone (lanes 5 and 6) or bleomycinplus putrescine (lanes 7 and 8) (lanes 5-8 were intentionally under-exposed to show the doublet at site 1). Arrows correspond tocleavage sites indicated in Fig. 1 Upper.

DNA molecules containing only single-strand breaks orlone AP sites will still migrate on nondenaturing gels at theposition of full-length undamaged DNA. Thus, these singlelesions could be specifically analyzed by eluting full-lengthDNA and assaying for cleavage on sequencing gels. Analysisof the full-length DNA 5'-end-labeled at the Ava I site (Fig.4, lanes 5-8) suggested that the C at base 245 (site 1) was aprominent site for both direct single-strand breaks and loneAP sites, as indicated by the splitting of the band at thisposition into a doublet with 3'-phosphatase treatment. Incontrast, analysis of the full-length DNA 5'-end-labeled at theHindIII site (Fig. 3) revealed, for the sample treated withbleomycin alone, only a weak band at the G at base pair 245(lane 9). This band was completely eliminated by 3'-phosphatase treatment (the resulting 3'-hydroxyl fragmentwould comigrate with the much stronger band at the C atposition 244), implying that it consisted exclusively of 3'-phosphate-ended molecules. Thus, no single-strand breakswith 3'-phosphoglycolate ends were formed at site 1 in thisstrand. The small amount of 3'-phosphate-ended moleculesprobably reflected AP sites with directly opposed breaks,since the band was largely eliminated in the samples treatedwith putrescine or endonuclease III. Thus, virtually no singlelesions were induced by bleomycin at position 245 in thisstrand.

In summary, four types of lesions appear to be produced bybleomycin at base pair 245: single-strand breaks at the C, loneAP sites at the C, direct double-strand breaks involving theC and directly opposed G, and AP sites at the G accompaniedby strand breaks at the C (Fig. 5). Thus, at this and otherpositions (see below) of closely opposed damage, the primary(G-Y) site incurred extensive single-strand damage as well,while the secondary (non-G-Y) site incurred damage only inthe context of closely opposed damage to the primary site.For example, a similar distribution of lesions was seen at

site 3, base pairs 231-232 (see Fig. 1 Upper). Analysis ofband3 derived from DNA 5'-end-labeled at the Ava I site sug-gested both phosphate and phosphoglycolate 3' termini in theputrescine-treated sample (Fig. 4), implying the presence ofAP sites at the T at base pair 231 (top strand), accompaniedby closely opposed breaks. Experiments with DNA 5'-end-labeled at the HindIII site suggested that putrescine-dependent double-strand breaks at site 3 had exclusivelyphosphoglycolate ends in the bottom strand (not shown). TheC residue in the bottom strand was a major site for singlelesions (Fig. 3), while damage at the T residue in the topstrand occurred almost exclusively in the context of doubleclosely opposed lesions (Fig. 4). Thus, the C behaved as aprimary site (as expected from its G-Y context), while the Tbehaved as a secondary site.

Site 2, base pairs 233-234, is a special case in that both theC at base pair 233 (top strand) and the T at base pair 234(bottom strand) are potential primary sites in G-Y sequences,and analysis of full-length fragments confirmed that singlelesions occurred relatively frequently at both these nucleo-tides (Figs. 3 and 4). Analysis of band 2 from nondenaturinggels suggested that, for AP sites with closely opposed strandbreaks occurring at site 2, the AP site was sometimes in thetop strand (Fig. 4) and sometimes in the bottom strand (notshown). This result suggests that both nucleotides couldserve either as a primary site or as a secondary site.

Several additional sites of closely opposed damage wereexamined in a 30-bp region of the plasmid pcI538, spanningbase pairs 115-145 of the A cI gene (Fig. 1 Lower). Base pairs140 and 143, which are mutational hot spots (9), were bothprominent sites of directly opposed damage. At the C-G-C-Csequence (Fig. 1, site 4, bottom strand) at base 140, the samefour types of lesions were detected as were found at theC-G-C-C at base 245 (see Fig. 5). Analogous types of lesionswere seen at the C-G-T-T sequence at base 143 (Fig. 1, site

Proc. Natl. Acad. Sci. USA 87 (1990)

Dow

nloa

ded

by g

uest

on

June

26,

202

1

Proc. Natl. Acad. Sci. USA 87 (1990) 8353

5' - - 1PP1P1° - - 3'T C G C C AA G C G G T

3' - - 1W444$4- - 5'

or Ncoo-

T C G C C A T C G C AA G C G G T A G C G G T

+ Secondary Attackcoo-

T C G C C AA G C G G T

* or

No Further Reaction

coo- vcoo-

T C G C C A T C G C C AA G C G G T A G C G T

$f/Ptittt-ooc

+ Base Propenal Release +coo- coo-

99 /p/Tfpjp9T C G C A T C G C AA G C G T A G C G T-ooc

FIG. 5. Proposed mechanism for production of closely opposeddamages by bleomycin. Activated bleomycin first abstracts hydro-gen from C-4' at the primary site (top strand). The CA-' radicalpartitions into either an AP site or a strand break. If an AP site isformed, no further reaction occurs. If a strand break is formed, then,a significant fraction of the time, a secondary attack by bleomycinabstracts hydrogen from the directly opposed nucleotide in thecomplementary strand. This C-4' radical likewise partitions intoeither a strand break or an AP site, and base propenal releaseproduces either a double-strand break with 5'-phosphate and 3'-phosphoglycolate termini or a strand break at the primary siteaccompanied by an AP site at the secondary site. If the break occursat the primary site but there is no secondary attack, the base propenalis likewise lost to leave a single-strand break with a 3'-phos-phoglycolate terminus (not shown). The proposal that base propenalrelease occurs after single-strand or double-strand cleavage is basedon kinetic studies (13). The fact that there are not closely opposeddamages involving an AP site at the primary site (top strand) suggeststhat bleomycin can be reactivated during formation of a strand breakbut not during formation of an AP site.

3, top strand) and at the T-G-C-C at base 132 (Fig. 1, site 1,bottom strand), with primary-type damage occurring at the(underlined) pyrimidine and secondary-type damage at thedirectly opposed purine. One additional C-G-C-C hot spot,occurring at base pair 188 of cI, was examined in another

Table 1. Bleomycin-induced mutations and classification ofmutable sites in the cI gene

Sites Sites MutantsClassification of sites available hit Mutants per site

Primary and secondaryDirectly opposed* 15 4 17 1.13Staggeredt 6 1 1 0.16

Primary onlyt 13 4 5 0.38Secondary only§ 15 3 5 0.33Neither 71 0 0 (0.00)*Analogous to base pair 245, site 1 in pc1245 (see Fig. 1 Upper).tAnalogous to base pair 234, site 2 in pc1245.tAnalogous to base pair 232, site 3 in pc1245.§Analogous to base pair 231, site 3 in pc1245.

recombinant plasmid, with results identical to those obtainedfor base pairs 140 and 245. Characterization of these andother positions of closely opposed damage in all three plas-mids confirmed that, with few exceptions, the same fourtypes of lesions were produced: single-strand breaks at theprimary site, lone AP sites at the primary site, double-strandbreaks involving the primary and secondary sites, and APsites at the secondary site accompanied by strand breaks atthe primary site (Fig. 5). Most importantly, for AP sites withclosely opposed breaks, the putative AP site invariablyoccurred at the secondary site. Thus, the model of double-strand cleavage developed below, based on lesions seen atC-G-C-C sequences, should apply generally to nearly allbleomycin-induced double-strand breaks. As described pre-viously (2), the secondary site is virtually always eitherdirectly opposite the primary site or opposite the base oneposition downstream; the choice between these two positionsfollows a hierarchy of sequence-dependent selection rules.Table 1 classifies all base pairs in positions 1-250 of cI at

which base substitutions have been shown to produce aclear-plaque phenotype (14), in terms of whether they wouldbe expected to be primary or secondary sites of bleomycin-induced damage, according to the sequence selection rulesdiscussed above and in ref. 2. Most mutations occurred atsequence positions where AP sites and strand breaks wouldbe directly opposed, a classification which includes the hotspots at base pairs 140, 143, 188, and 245 (9). Some of themutations occurred at positions which could only be second-ary sites, including all mutations occurring at non-G-Y se-quences. Some mutations also occurred at G-Y sequenceswhich could only be primary sites. Remarkably, not a singlemutation was detected at any of the remaining 71 positions incI which would not be potential primary or secondary sites ofbleomycin attack.

DISCUSSIONMechanism of Double-Strand Cleavage. Analysis of the

lesions induced at primary and secondary cleavage sitescomprising bleomycin-induced double-strand breaks (Fig. 5)reveals several important features. First, the chemistry ofthelesions at both sites is highly characteristic of specific attackby activated bleomycin at C-4'. Second, presence ofa strandbreak at the primary site is a necessary condition for attackat the secondary site. Third, the secondary site exhibits analtered specificity, virtually always occurring at one of twonucleotide positions opposite the primary break, and usuallyviolating the characteristic G-Y specificity of the drug. Allthese results can be explained by hypothesizing that (i) attackat the primary site occurs first and (ii) attack at the secondarysite, and its altered specificity, are consequences of theformation of a strand break at the primary site. The simplestmodel incorporating these features is one in which bleomycinis sometimes reactivated during formation ofthe strand break

Biochemistry: Steighner and Povirk

Dow

nloa

ded

by g

uest

on

June

26,

202

1

8354 Biochemistry: Steighner and Povirk

at the primary site, allowing the drug to attack the secondarysite in the complementary strand without ever dissociatingfrom DNA. In addition to explaining the types of lesionsinduced at primary and secondary sites, both separately andin concert (Fig. 5), this model accounts for the single-hitkinetics of double-strand cleavage (1), since only one bindingevent between DNA and bleomycin is required.A precise mechanism for bleomycin reactivation is difficult

to propose, since it is necessarily dependent on the uncertainevents (3, 4) occurring between formation of "activatedbleomycin" (bleomycin ferric peroxide) and abstraction fromC-4'. In particular, the actual abstracting species is unknown,although high-valence bleomycin-iron-oxo species (4) andspecies formally equivalent to a sequestered hydroxyl radical(15) have been proposed.One possible reactivation mechanism is an addition reac-

tion between Fe(III)-bleomycin, which is the final bleomycinproduct formed after strand cleavage, and a 4'-peroxidederivative of deoxyribose, which is a nearly obligatory in-termediate in the strand cleavage reaction (16). It has beendemonstrated that organic peroxides can combine with andreactivate Fe(III)-bleomycin (15). The one uncertainty in thismechanism is whether the putative deoxyribose-peroxo-iron-bleomycin conjugate would still decay to form theobserved 3'-phosphoglycolate terminus at the primary site.Products formed from organic peroxides used to activatebleomycin have been identified (15), but it is difficult toextrapolate these results to the rather different structure ofthe putative peroxide intermediate at C-4'.An alternative reactivation mechanism is a reaction be-

tween the putative 4'-peroxyl radical intermediate at theprimary site (16) and the immediate bleomycin-iron-oxoproduct of the primary abstraction, that is, a simple recaptureof the abstracted hydrogen by the peroxyl radical, directlyregenerating the abstracting bleomycin species. This mech-anism would be analogous to the "propagation" step in lipidperoxidation (17), but like the first mechanism, its likelihooddepends on the exact nature of the bleomycin species presentimmediately before and after abstraction. It should be notedthat both of the proposed models require the formation of4-peroxyl intermediates, which are generated only when astrand break is produced; thus, either model could explainthe apparent failure of bleomycin to be reactivated when APsites are formed at the primary site.

Recently, Keller and Oppenheimer (18) synthesized shortDNA duplexes containing a one-base gap with 3'- and 5'-phosphate termini (a structure very similar to a bleomycin-induced strand break) and showed that bleomycin preferen-tially attacked sites opposite the gap. In general terms, theseresults agree with our proposal that the presence of a breakat the primary site restricts the placement of the secondarybreak to a few closely opposed nucleotide positions. How-ever, the detailed specificity of secondary cleavage seen withthese synthetic substrates is not always consistent with thatseen with bleomycin alone (e.g., breaks with 3'-overhangsare sometimes seen with the synthetic substrates). Further-more, kinetic studies (13) show that bleomycin-induced dou-ble-strand cleavage occurs much faster than base-propenalrelease, implying that secondary attack must occur before thegap and the 5'-phosphate terminus are formed. Thus, thesynthetic substrates appear to be useful though imperfectmodels for intermediates in double-strand cleavage.

Role of Bivalent Lesions in Mutagenesis. Studies with re-packaged A phage suggest that although AP sites with closely

opposed strand breaks constitute a minor component ofbleomycin-induced DNA lesions, they may play a major rolein mutagenesis (6). This proposal is confirmed by sequencespecificity data (Table 1), which reveal that some bleomycin-induced base substitutions occur at sequence positions whichcan only be secondary sites of bleomycin attack. Further-more, at sequence positions where potential primary andsecondary sites are directly opposed, most (11/15) of thesubstitutions were transversions (9), suggesting that theyresulted from bypass of an AP site at the purine (secondarysite) rather than the pyrimidine (primary site) at these se-quence positions. Since AP sites at these purines occur onlyin the context of a directly opposed strand break, this resultsuggests that such bivalent lesions rather than lone AP siteswere responsible for most of these mutations. It appears thatdirectly opposed lesions may be more mutagenic than stag-gered lesions.

Bivalent Lesions and Cytotoxicity. Although the evidence isnot conclusive, double-strand breaks are believed to be theprimary cause of bleomycin-induced cytotoxicity (1). Thedetailed mechanisms for repair of double-strand breaks arenot known, but they could depend critically on the structureof the termini. The cleaved bleomycin-induced AP site rep-resents a unique terminus which preliminary studies suggestis relatively resistant to enzymes that normally remove 3'blocks (e.g., E. coli endonuclease IV and exonuclease III).Thus, double-strand breaks with this terminus may be par-ticularly difficult to repair and therefore highly cytotoxic.

This work was supported by Grant CA40615 from the NationalCancer Institute.

1. Povirk, L. F. (1983) in Molecular Aspects ofAnti-cancer DrugAction, eds. Neidle, S. & Waring, M. (Macmillan, London), pp.157-181.

2. Povirk, L. F., Han, Y. H. & Steighner, R. J. (1989) Biochem-istry 28, 8508-8514.

3. Hecht, S. M. (1986) Acc. Chem. Res. 19, 383-391.4. Stubbe, J. & Kozarich, J. W. (1987) Chem. Rev. 87, 1107-1136.5. Povirk, L. F. & Houlgrave, C. W. (1988) Biochemistry 27,

3850-3857.6. Steighner, R. J. & Povirk, L. F. (1990) Mutat. Res. 240,

93-100.7. Sugiyama, H., Xu, C., Murugesan, N., Hecht, S. M., van der

Marel, G. A. & van Boom, J. H. (1988) Biochemistry 27,58-67.8. Royer-Pokora, B., Gordon, L. K. & Haseltine, W. A. (1981)

Nucleic Acids Res. 9, 4595-4609.9. Povirk, L. F. (1987) Mutat. Res. 180, 1-9.

10. D'Andrea, A. D. & Haseltine, W. A. (1978) Proc. Natl. Acad.Sci. USA 75, 3608-3612.

11. Takeshita, M., Grollman, A. P., Ohtsubo, E. & Ohtsubo, H.(1978) Proc. Natl. Acad. Sci. USA 75, 5983-5987.

12. Lindahl, T. (1982) Annu. Rev. Biochem. 51, 61-87.13. Burger, R. M., Projan, S. J., Horwitz, S. B. & Peisach, J.

(1986) J. Biol. Chem. 261, 15955-15959.14. Hutchinson, F. & Wood, R. D. (1988) in DNA Repair: A

Laboratory Manual of Research Procedures, eds. FriedbergE. C. & Hanawalt, P. C. (Dekker, New York), Vol. 3, pp.219-233.

15. Padbury, G., Sligar, S. G., Labeque, R. & Marnett, L. J. (1988)Biochemistry 27, 7846-7852.

16. Giloni, L., Takeshita, M., Johnson, F., Iden, C. & Grollman,A. P. (1981) J. Biol. Chem. 256, 8608-8615.

17. Mead, J. F. (1976) in Free Radicals in Biology, ed. Pryor,W. A. (Academic, New York), Vol. 1., pp. 51-68.

18. Keller, T. L. & Oppenheimer, N. J. (1987) J. Biol. Chem. 262,15144-15150.

Proc. Natl. Acad. Sci. USA 87 (1990)

Dow

nloa

ded

by g

uest

on

June

26,

202

1