biology unit 5 overview
DESCRIPTION
TRANSCRIPT
![Page 1: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/1.jpg)
2nd time lucky
Biology Unit 5
![Page 2: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/2.jpg)
Caution massive chapter, approach with care
Responding to the environment
![Page 3: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/3.jpg)
Receptors detect stimuli – different receptors detect diff stimuli
Effectors are cells that bring about a response to a stimulus, theses include muscle cells and glands
Receptors and effectors communicate via the nervous system or hormonal system
Receptors
![Page 4: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/4.jpg)
The nervous system is made up of a network of neurones
1. The sensory neurone sends electrical impulses from the receptors to the CNS
2. Motor neurones from the CNS to effectors
3. Relay neurones transmits between the sensory and motor neurones
Neurones
![Page 5: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/5.jpg)
How a response is caused
StimulusI.e.. waving
Receptors Light receptors in eye detect the wave
CNS Info is processed and a plan Is made
Effectors Muscle cells are stimulated by motor neurones
Response Muscles contract and you wave back
![Page 6: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/6.jpg)
Nervous system The Nervous system is split up
Peripheral system – made up to neurones that connect the CNS to rest of the body
Somatic system – controls conscious activity such as running
Autonomic system – unconscious activities, has two divisions
Sympathetic system – flight or flight mechanism, stimulates effectors, heightens awareness
Parasympathic system – inhibits effectors, slows down responses and calms the body
![Page 7: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/7.jpg)
When a electrical impulse reaches the end of a neurone, neurotransmitters are secreted directly into the cells, so the response is localised
The transmitters are quickly removed so the response is short lived
The impulses are very fast causing the response to be rapid, allowing for quick reactions
Communication
![Page 8: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/8.jpg)
A gland is a group of cells specialised to secret hormones
Hormones are ‘chemical messengers’ normally are proteins or peptides
The glandes can be stimulated by a change in conc of a substance or by electrical impulses
Hormonal system
![Page 9: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/9.jpg)
How it works
Stimulus Low blood glucose
Receptors on pancreases cells detect the change
Hormone Glucagon released into blood
EffectorsTarget cells in liver detect glucagon and convert glycogen to glucose
Response Glucose is released into the blood
Hormones diffuses into blood, all over the body but will only bind to specific receptors on target cells
Slower response and last longer
![Page 10: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/10.jpg)
When a receptor is resting there's a difference in charge, this is the potential difference
The potential diff when a cell is resting is its resting potential
When a stimulus is detected the membrane becomes more permeable and Na+ floods into cell
This changes the potential diff
The change of the potential diff due to a stimulus is the generator potential
The bigger the stimulus the bigger the generator potential
If its big enough (+40v) an AP will be triggered, this can only happen if the threshold value is reached
AP are all one size so stimulus strength is measured by AP frequency
Action Potentials (AP)
![Page 11: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/11.jpg)
Detect mechanical stimuli such as pressure
Found in the skin
Contain an sensory nerve ending wrapped in lamellae
When its stimulated the lamellae deform and press on nerve ending
This in turn caused the Na+ channels to deform and open, causing an AP
Pacinian Corpuscles
![Page 12: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/12.jpg)
Light enters the eye thru the pupil, the iris controls how much light enters
Light rays are focused by the lens of the retina which contain photoreceptors
Nerve impulses from the photoreceptors are taken to the brain by the optic nerve, the optic nerve causes a blind spot, where no photoreceptors are found
The eyes
![Page 13: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/13.jpg)
Light enters the eye, hits the photoreceptors and is absorbed by light sensitive pigments
The light bleaches the pigments causing a chemical change and altering the membrane permeability of the Na channels
If the threshold value is reached then a impulse is sent along the bipolar nerve, which connects to the optic nerve and then the brain
Photoreceptors
![Page 14: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/14.jpg)
Rods are a type of photoreceptor (other is cones)
They are very sensitive to light this Is due to summation many rods join to one neurone so many weak potentials is enough to reach the threshold value
However because of this they have low visual acuity, so two very close objects cant be told apart
Only back and white colour
Rods
![Page 15: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/15.jpg)
Less sensitive as one cone is joined to one neurone, more light is needed for a AP
High visual acuity as cones are packed close together, so when light hits two cones two AP are sent
They can see in colour due to the fact there are three types, red, green and blue sensitive
Cones
![Page 16: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/16.jpg)
When a neurones resting the outside of the membrane is more +ive than the inside, as that’s where the most ions are
The membrane is polarised (diff in v)
This is called the resting potential (-70v)
This is maintained by the Na/K pump (2k is pumped in and 3Na out) this uses ATP
This creates a electrochemical gradient
K is able to diffuse back out of cell via the permeable membrane
Neurones
![Page 17: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/17.jpg)
1) Stimulus – excites the cell membrane allowing Na+ channels to open, and Na+ diffuses into the cell
2) Depolarisation – potential diff reaches -55v and more channels open
3) Repolarisation – at +30v Na close and K open and K diffuses of the neurone
4) Hyperpolarisation – K+ channels are slow to shut and there's an overshoot
5) Resting potential – ion channels reset, the Na/K pump returns the membrane to its resting potential
AP – what happens
![Page 18: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/18.jpg)
1
2
3
4
5
![Page 19: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/19.jpg)
When a AP occurs, some of the Na+ that enter the neurone diffuse sideways
This causes the Na+ channels in the next region of the neurone to open and Na+ to diff in
This causes a wave of depolarisation along the neurone, as the wave moves away the membrane is in its refractory period, and cant fire an AP
AP along a Neurone
![Page 20: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/20.jpg)
During this period the ion channels are recovering and cant be opened
This acts as a time delay between one AP and the next, insuring that they don’t overlap but are discrete impulses
Also insures that impulses are unidirectional (one way)
Refractory Period
![Page 21: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/21.jpg)
Once the threshold value is reached the an AP will always happen
If the threshold isn't reached then there will be no AP fired
A bigger stimulus WONT cause a bigger AP but will cause them to fire MORE FREQUENTLY
All – Or Nothing
![Page 22: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/22.jpg)
Some neurones have a myelin sheath, this is an electrical insulator, made of Schwann cells
Between the cells are bare bits called the nodes of Ranvier, Na+ are conc at nodes
In a myelinated neurone depolarisation only occurs at the nodes, the cytoplasm conducts enough charge to depolarise the next node (salutatory conduction), makes everything very fast
Myelination
![Page 23: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/23.jpg)
AP are quicker along axons with a larger diameter because there’s less resistance to the flow of ions
With less resistance the depolarisation reaches other parts of the neurone cell membrane quicker
The speed of condition increases with temperature, as ions diffuse faster
However at 40* the proteins denature and speed decreases
Axon Diameter and Temp
![Page 24: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/24.jpg)
A synapse is a junction between 2 neurones or an effector
Gap between them is the synaptic cleft
The presynaptic neurone has a swelling called the synaptic knob, which contains neurotransmitters
When an AP reaches the knob it causes the neurotransmitters to be released into the cleft and to bind to specific receptors on postsynaptic neurone
When neurotransmitters bind to receptors they can cause a AP on postsynaptic neurone (or hormonal reactor, or muscle contraction)
Unidirectional
Neurotransmitters are then removed for cleft so response doesn't continue
Synapses
![Page 25: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/25.jpg)
AP reaches the knob of the presynaptic neurone, this stimulates voltage gated Ca ion channels to open
Ca diffuse into the knob, causing the synaptic vesicles to fuse with the presynaptic membrane
ACh is then released into the cleft (exocytosis)
ACh diffuses across the cleft to bind to specific receptors on the postsynaptic membrane
This causes Na channels to open, resulting in an AP
ACh is removed from cleft by enzyme acetylchlolinesterase, and broken down, the products are then reabsorbed by the prestnaptic neurone
ACh
![Page 26: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/26.jpg)
Synapse between a muscle cell and a motor neurone
ACh binds to nicotinic cholinergic receptors
The post synaptic has many folds (clefts) which store enzymes
Also membrane has more receptors
AP always triggers a response in muscle cell
Neuromuscular junctions
![Page 27: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/27.jpg)
Excitatory – depolarise the postsynaptic causing AP if threshold reached (ACh is an example)
Inhibitory – hyperpolarise the postsynaptic (potential diff more –ive) preventing an AP, GABA is an example it opens the K gates.
Neurotransmitters
![Page 28: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/28.jpg)
Spatial
Many neurones connect to one neurone, similar to rods in the eye
Small amount of transmitter is released and altogether a AP is reached
However if a inhibitory transmitter is released there may be no overall AP
Temporal
When two or more impulses arrive in quick succession
AP is then more likely as more transmitter is released into the synaptic cleft
Spatial summation and Temporal summation
![Page 29: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/29.jpg)
Some drugs are the same shape as neurotransmitters , they active receptors so more AP (nicotine mimics ACh)
Some block receptors so they cant be activated, this can result in paralyses (curare)
Some inhibit the enzyme that breaks down the transmitters, which can lead to loss of muscle control (nerve gas)
Some drugs can stimulate the release of neurotransmitters from the presynaptic so more receptors are active (amphetamines)
Some inhibit the release of neurotransmitters from the presynaptic so fewer receptors are active (alcohol)
Drugs
![Page 30: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/30.jpg)
Used for movement
Made up of bundles of cells called muscle fibres, cell membrane of fibres is called the sarcolemma
Bits of the sarcolemma fold in and stick to sarcoplasm, there called transverse tubules and they help to spread out the electrical impulses
Sarcoplasmic reticulum runs thru sarcoplasm, it stores and release Ca
Muscle fibres contain a lot of mitochondria to supply ATP
They are multinucleate (many nuclei)
Muscle fibres have lots of myofibrils, which are made of protein and highly specialised
Muscles - Skeletal
![Page 31: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/31.jpg)
Thick myofilaments are made of myosin
Shown as dark bands in pics
Thin myofilaments are made of actin
They are shown as light bands in pics
Myofibrils
![Page 32: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/32.jpg)
A myofibril is made up of many short sarcomeres
The ends are marked with a Z-line
The centre is the M-line
Around the M-line is the H-zone which contains only myosin filaments
Con.
![Page 33: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/33.jpg)
Myosin and actin slide over each other to make the muscles contract
The sarcomeres return to their original length after contraction
I band gets shorter as does H zone
A band doesn't change but contains more actin
The Z lines get closer together
Sliding Filament Theory
![Page 34: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/34.jpg)
Myosin filaments have globular heads that are hinged so they can move back and forth
Each myosin has a binding site for actin and ATP
Actin has binding sites for myosin (actin-myosin binding sites)
In a resting muscle the actin-myosin binding site is blocked by Tropomyosin which is held in place by troponin
To myofilaments cants slide past each other as the myosin head cant bind to the actin myosin binding site on the actin
Myosin and Tropomyosin
![Page 35: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/35.jpg)
When an AP from a motor neurone stimulates a muscle cell it depolarises the sarcolemma, depolarisation spreads down the T-tubules to the sarcoplasmic reticulum
This causes the release of Ca ions into the sarcoplasm
Ca binds to troponin causing it to change shape removing the Tropomyosin from the actin-myosin binding site on the actin
This exposes the binding site, allowing myosin head to bind
This forms a actin-myosin cross bridge
Ca ions also activate ATPase which breaks down ATP providing energy for contraction
This energy moves the myosin head pulling the actin filament along (think rowing)
Muscle contraction
![Page 36: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/36.jpg)
ATP also provides the energy to break the cross bridge, so once its moved the myosin detaches from the actin
The head then reattaches to a different binding site further along the actin, forming a new cross bridge
The cycle will continue as long as the Ca is present
Con
![Page 37: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/37.jpg)
When Ca ions leave their binding site and are moved back via active transport into the sarcoplasmic reticulum
The troponin molecules return to their original shape and the Tropomyosin with them blocking the actin-myosin binding site
And the actin filaments slide back to their original position
Stopping contraction
![Page 38: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/38.jpg)
Twitch
Slow twitch muscles Fast twitch muscles
Muscles fibres contract slowly Muscles fibres contract quickly
Used for posture Used for fast movement
Good for endurance activities Good for bursts of speed and power
Work for a long time (don’t tire easily)
Tire very quickly
Energy is released slowly through aerobic respiration, lots of mitochondria
Energy is released quickly by anaerobic respiration using glycogen
Red due to lots of myoglobin White due to less myoglobin
![Page 39: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/39.jpg)
SAN generate electrical impulses that cause the heart to contract
The rate the SAN contracts is controlled by the medulla in the brain
Animals alter their HR to respond to stimuli
Stimuli are detected by pressure receptors and chemical receptors
Pressure receptors are called baroreceptors and are found in the aorta and the vena cava, the are stimulated by high or low blood pressure
Chemical receptors are chemoreceptors and found in the aorta, carotid artery and medulla, they monitor CO2 and pH levels
Control of heart rate
![Page 40: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/40.jpg)
How does it workStimulus
Receptor Neurone and transmitter
Effector Response
High blood pressure
Baro-receptors
Impulses to medulla, along parasympathic. ACh released bind to SAN
Cardiac muscles
HR slows blood pressure drops
Low blood pressure
Baro-receptors
Impulses to medulla along sympathetic, release noradrenaline binds to SAN
Cardiac muscles
HR increases blood pressure rise
High O2 and pH
Chemo-receptors
Impulses to medulla along parasympathic, ACh binds to SAN
Cardiac muscles
HR slows pH returns to norm
Low O2 and pH
Chemo-receptors
Impulses to medulla along sympathetic, noradrenaline binds to SAN
Cardiac muscles
HR increases pH returns to nom
![Page 41: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/41.jpg)
When the body responds to a stimulus without making a conscious decision to respond
Very fast and time isn't wasted deciding on a course of action
Helps avoid damage
Relay neurones can override the reflex arc
Reflexes
![Page 42: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/42.jpg)
Thermorecpetors in skin detect the heat stimulus
The sensory neurone carries impulses to the relay neurone
Relay to motor
Motor to effectors (muscle)
Muscle contracts preventing burns
Reflex Arcs
![Page 43: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/43.jpg)
Taxes – when an organism moves away or towards a stimulus (woodlice away from light – photo taxis)
Kinases – random movement by a non-directional stimulus (woodlice and humidity, more movement the more humidity)
Taxis and Kinesis
![Page 44: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/44.jpg)
A chemical messenger that acts locally
Secreted from cells
Their target cells are next to where chemical mediators are produced
Only have to travel a short distance, rapid response
Chemical Mediators
![Page 45: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/45.jpg)
Histamines
Stored in mast cells and basophils
Released in response to body being injured or infected
It increases the permeability of the capillaries of the capillaries nearby to allow more immune system cells into the area
Prostaglandins
Group of chemical mediators that are produced by most cells of the body
Involved in inflammation, fever, blood pressure regulation and clotting
Histamine and Prostaglandins
![Page 46: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/46.jpg)
Tropism is a response of a plant to a directional stimulus
Plants respond by regulating their growth
+ive tropism towards stimulus and –ive away from stimulus
Phototropism is a response to light
Geotropism is a response to gravity
Tropism - Plants
![Page 47: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/47.jpg)
Chemicals that can speed up or slow down growth in the plant
Produced in the growing regions of the plant and move to where they're needed
Auxins stimulate growth of shoots by cell elongation
High conc of Auxins inhibits root growth
Auxins that’s produced in the tips of shoots in flowering plants
IAA is moved around the plant to control tropisms, it moves by either active transport or the phloem
Uneven amounts of IAA cause uneven growth
This means shoots can grow towards the light and up
Growth factors and IAA
![Page 48: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/48.jpg)
Lot of new stuff, but a lot smaller than last chapter
Homeostasis
![Page 49: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/49.jpg)
Temperature and pH need to be kept constant for similar reasons mainly its about enzymes and to high temp to pH enzymes will denature bringing metabolic functions to a halt. Optimum pH is normally around 7 and optimum temperature around 37*
Glucose concentration also needs to be regulated if the concentration is to high then the water potential of blood is reduced to a point where water molecules diffuse out of cells into the blood by osmosis causing the cells to shrivel and die, if blood glucose is to low then cells are unable to carry out certain functions as there isn't enough glucose to produce ATP
Homeostasis
![Page 50: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/50.jpg)
Homeostatic systems involve receptors, a communication system and effectors
Receptors detect when a level is to high or low and the info Is communicated via the nervous system or hormonal system to effectors, the effectors then work to counteract the change
The mechanism that restores everything to normal is called –ive feedback
However –ive feedback only works within certain limits if the change is to great then the effectors may not be able to correct the change
This is how people die of hypothermia
Negative Feedback
![Page 51: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/51.jpg)
• More than one mechanism gives more control over changes in your internal environment than just the one mechanism
• Having multiple –ive feedback mechanisms means you can actively increase or decrease a level returning it to normal
• Just the one feedback mechanism means all you can do is turn it ‘on’ or ‘off’ so you can only change a level in one direction. Think like slowing a car although letting go of the accelerate helps the brake makes it happen faster and is more effective, it gives you more control
Multiple –ive Feedback is handy
![Page 52: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/52.jpg)
Some changes trigger a +ive feedback which amplifies the change, the effectors respond to further increase the level away from the normal, can be used to rapidly activate something such as blood clotting in a cut. Or it can kill you, if homeostatic system breaks down
1. Hypothermia is low body temp (below 35*)
2. It occurs when heat is lost from the body faster than it can be produced
3. As temp falls the brain doesn't work properly and shivering stops, and temp falls further
4. +ive feedback takes the body even further away from normal and will continue to decrease until your dead
Positive Feedback
![Page 53: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/53.jpg)
Temperature Control Ectotherms – Reptiles Endotherms - Mammals
Cant control body temp internally, they control temp by changing their behaviour
Control their body temp internally by homeostasis and also by behaviour
Their internal temp is dependant on the external temp (surroundings)
Internal temp is less effected by the external temps (within certain limits)
Their activity level depends on the external temp – more active at higher temp and less active a lower ones
Their activity level is largely independent of external temp (certain limits)
Have a variable metabolic rate and generate lil heat themselves
Have a constantly high metabolic rate and generate a lot of heat form metabolic reactions
![Page 54: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/54.jpg)
Changing Body Temp Heat loss Heat production Heat conservation
Sweating – water evaporates off skin removing heat
Shivering – muscles contract in spasms, more respiration more heat production
Less sweating
Hairs lie flat – less air trapped heat can be lost easily
Hormones – adrenaline is released increases metabolism, more heat
Hairs stand up – erector pili muscles contract, hairs stand up, air becomes trapped
Vasodilation – arterioles near surface of the skin dilate, more blood flows, more heat is lost by radiation
Vasoconstriction – arterioles constrict blood flow to surface less heat lost by radiation
![Page 55: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/55.jpg)
The hypothalamus is the part of the brain that maintains body temperature, it receives both external and internal information from Thermorecpetors on the skin and in the blood
The Thermorecpetors send impulses along a sensory neurone to the hypothalamus which in turn sends info along the motor neurone to effectors
The neurones are part of the autonomic nervous system so its all done unconsciously
The effectors then return the body back to normal temp (-ive feedback)
Hypothalamus
![Page 56: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/56.jpg)
Maintaining Body Temp
Normal Temp 37*
Thermorecpetors detect change
Hypothalamus sends info to effectors
Vasodilation, sweating, hairs lie flat
Heat lost, temp drops
Thermorecpetors detect change
Hypothalamus sends info to effectors
Vasoconstriction, shivering, hairs stand up, adrenaline released
Heat gain, temp increases
![Page 57: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/57.jpg)
• All cells need a constant energy supply to work, so blood glucose must be carefully controlled
• The concentration is usually 90mg per 100cm3 of blood, and is monitored in the pancreases
• The blood glucose levels rise after eating and fall after exercise
• The hormonal system controls blood glucose concentration using insulin and glucagon, both a secreted by the islets of Langerhans
• Beta cells secret insulin
• Alpha cells secret glucagon
Blood Glucose
![Page 58: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/58.jpg)
1. Insulin binds to specific receptors on the cell membranes of liver cells and muscle cells
2. It increase the permeability of the cell membrane to glucose, so they can take more up
3. It also activates enzymes that convert glucose to glycogen (glycogenesis)
4. Cells are able to store glycogen in their cytoplasm as an energy source
5. The rate of respiration, so more glucose is used up
Insulin
![Page 59: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/59.jpg)
1. Glucagon binds to specific receptors on the cell membranes of liver cells
2. Glucagon activates enzymes that break down glycogen to glucose (glycogenolysis)
3. Glucagon promotes the formation of glucose from fatty acids and amino acids (gluconeogenesis)
4. Also decrease the rate of respiration in cells
Glucagon
Glycogen Glucose Fatty acids and a.a.
Glycogenesis
Glycogenolysis
Gluconeogenesis
![Page 60: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/60.jpg)
• Hormone that’s secreted from your adrenal glands, above the kidneys
• Secreted when there's a low concentration of glucose in your blood, when stressed or exercising
• Adrenaline binds to receptors in the cell membrane of liver cells, it activates glycogenolysis (glycogen to glucose) and inhibits glycogenesis
• It activates glucagon secretion and inhibits insulin secretion, increasing glucose concentration
• Gets the body ready for action, by making more glucose available for muscles to respire
• Both adrenaline and glucagon can activate to glycogenolysis inside the cell even though they bind to the outside of the cell
Adrenaline
![Page 61: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/61.jpg)
• Adrenaline and glucagon bind to their specific receptors and activate and enzyme called adenylate cyclase
• Activates adenylate cyclase converts ATP into a chemical signal called a ‘second messenger’
• The second messenger cAMP
• cAMP activates a cascade that break down glycogen into glucose (glycogenolysis)
Glycogenolysis
![Page 62: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/62.jpg)
Type 1
1. Beta cells in islets of Langerhans don’t produce any insulin
2. After eating blood glucose levels stay high, hyperglycaemia is caused can result in death
3. It can be treated by regular injections of insulin, but needs to be controlled or it can cause hypoglycaemia
Type 2
4. Occurs latter in life as a result of obesity
5. Beta cells don’t produce enough insulin or the body doesn't respond properly to the insulin
6. Can be controlled by controlled eating and weight loss
Diabetes
![Page 63: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/63.jpg)
Also known as the oestrous cycle lasts for around 28 days, it involves
• A follicle developing in the ovary
• Ovulation – when the egg is released
• The uterus lining becoming thicker so that the fertilised egg can be implanted
• A structure called the corpus luteum developing in the remains of the follicle
If there's no fertilisation the uterus lining breaks down and leaves the body through the vagina, this the end of the cycle and being of another
Menstrual Cycle
![Page 64: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/64.jpg)
Four main hormones involved
1. FSH – produced by pituitary gland, stimulated the follicle to develop
2. LH – produced by pituitary gland, stimulates ovulation and corpus luteum to develop
3. Oestrogen – stimulates the uterus lining to thicken, secreted by the ovaries
4. Progesterone – maintains thick uterus lining, ready for embryo, secreted by the ovaries
Each one inhibits or stimulated the other as you will see in next slide
Control of Menstrual Cycle
![Page 65: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/65.jpg)
Stimulation and inhibition
FSH
OESTROGEN
LH
PROGESTRONE
![Page 66: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/66.jpg)
1. FSH stimulates follicle development, oestrogen is released from follicle, FSH stimulates ovaries to produce oestrogen
2. Oestrogen stimulated the uterus lining to thicken, oestrogen inhibits FSH
3. High oestrogen stimulates pituitary gland to release LH and FSH
4. Ovulation is stimulated by LH (follicle ruptures and egg is released), ruptured follicle turns into corpus luteum, the corpus luteum releases progesterone
5. Progesterone inhibits FSH and LH release, the uterus lining is maintained by progesterone, if no embryo implants the corpus luteum breaks down and stops releasing progesterone
6. FSH and LH conc increase because they are no longer inhibited, the uterus breaks down and you bleed
Concentration Change
![Page 67: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/67.jpg)
1. FSH stimulates the ovary to release oestrogen, which inhibits further release of FSH, this prevents any more follicle development
2. LH stimulates the corpus luteum to develop, which produced progesterone, which inhibits the release of LH. This prevents more follicle development when corpus luteum is developing, and insures that the uterus breaks down if no embryo implants
3. Oestrogen stimulates release of LH, LH stimulates release of oestrogen and so on, allowing ovulation to happen
-ive and +ive feedback
![Page 68: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/68.jpg)
Bitch of a chapter, but starts of easy
DNA and RNA
![Page 69: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/69.jpg)
• DNA is a polynucleotide, its made from a phosphate, pentose sugar, and a nitrogenous base (ATGC)
• The sugar is called a Deoxyribosugar
• DNA nucleotides join together to form polynucleotide strands, has a sugar phosphate backbone
• 2 DNA stands join together forming H-bonds forming a double helix
• 3 bases form a triplet code and code for a amino acid (a.a), these a.a join together forming a protein, the sequence of DNA bases codes for proteins
• DNA cant leave the nucleus so is copied onto RNA which are found in the cytoplasm, this is called transcription
DNA – from GCSE
![Page 70: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/70.jpg)
• The sugar is a ribosugar not a Deoxyribosugar
• Forms a single strand
• T is replaced with U
• Two types, mRNA and tRNA
• tRNA is a single stranded polynucleotide that’s folded into a clover due to H-bonds, contains an anticodon (3 bases) and a a.a binding site. Found in the cytoplasm of a cell. Carries a.a. that are used to make proteins
• mRNA is a single polynucleotide strand, is made in the nucleus during transcription, and carries the genetic code out of the nucleus to the cytoplasm where its used to make proteins
RNA the Basics
![Page 71: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/71.jpg)
1. RNA polymerase attaches to the DNA at the being of a gene
2. The H-bonds between the two DNA strands break and the helix unwinds
3. One of the strands is then used as a template to make an mRNA strand
4. The RNA polymerase lines up free RNA nucleotides alongside the template strand, specific base pairing insures that the mRNA is a complementary copy of the DNA
5. Once the nucleotides have paired up with their specific bases on the DNA strands there joined together forming mRNA
6. Once the RNA polymerase moves on, the H-bonds reform
7. When RNA polymerase reaches a stop signal, It detaches from the DNA
8. mRNA moves out of the nucleus through the nuclear pore
Transcription
![Page 72: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/72.jpg)
• Genes in eukaryotic DNA contain sections that don’t code for a.a.
• These sections of DNA are called introns and aren't needed, its only exons that form mRNA
• mRNA with introns is called pre-mRNA
• Introns are spliced from pre-mRNA, and exons are joined together forming mRNA
• The mRNA then leaves the nucleus for translation
mRNA Splicing
![Page 73: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/73.jpg)
1. mRNA attaches itself to a ribosome and tRNA molecules carry a.a to the ribosome
2. A tRNA molecules with an anticodon that’s complementary to the first codon on the mRNA, attaches itself to the mRNA by specific base pairing
3. A second tRNA molecule attaches itself to the next codon on the mRNA in the same way
4. The two a.a attached to the tRNA molecules are joined by a peptide bond, and the first tRNA molecule moves away
5. A third tRNA molecules binds to the next codon on the mRNA, it’s a.a binds to the first two, and second tRNA molecules moves away
6. The process continues forming a polypeptide chain, until it reaches the stop codon and protein moves away from the ribosomes
Translation
![Page 74: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/74.jpg)
• The genetic code is the sequence of base triplets in mRNA which code for specific a.a
• In the genetic code each base triplet is read in sequence, separate from the triplet before and after, the code is none overlapping
• Code is degenerate, there are more possible combinations of triplets than a.a so AGC and ATT could code for the same a.a
• Some triplets are stop sequences which end the production of a protein and are found at the being and end of mRNA
• The genetic code is universal ATT codes for same a.a in all organisms
Genetic Code
![Page 75: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/75.jpg)
• All cells carry the same genes, but the structure and function of the cells differs, because not all the genes in a cell are expressed therefore not all the proteins are made,
• The transcription of genes is controlled by protein molecules called transcription factors
1. Transcription factors move from the cytoplasm to the nucleus
2. Where they bind to specific DNA sites near the start of their target genes
3. They can control expression by controlling the rate of transcription
4. Some transcription factor (activators) increase the rate of transcription, by aiding RNA polymerase and others (repressors) decrease the rate of transcription, by blocking the RNA polymerase
Regulation of Transcription and Translation
![Page 76: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/76.jpg)
The expression of a gene can be controlled by other molecules like oestrogen
• Oestrogen can bind to a transcription factor, forming a oestrogen-oestrogen receptor complex
• The complex then moves from the cytoplasm into the nucleus where it binds to specific DNA sites near the start of the target gene
• The complex can either act as an activator or as a repressor
• Whether the complex act as one or the other depends in the type of cell and the target gene
• So the level of oestrogen in a particular cells affects the rate of transcription of certain genes
Oestrogen
![Page 77: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/77.jpg)
• Short, double stranded RNA molecules that can interfere with the expression of a specific gene
• Their bases are complementary to specific sections of a target gene and mRNA that’s formed from it
• siRNA can interfere with both the transcription and translation of genes
• It affects translation by RNA interference
1. In the cytoplasm siRNA an associated proteins bind to target mRNA
2. The proteins cut up the mRNA into sections so it can no longer be translated
3. Preventing the expression of the gene as its protein can no longer be made
siRNA
![Page 78: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/78.jpg)
Mutations are caused by changes to the base sequence, generally during DNA replication there's two main types
1. Substitution – ATT to AGT this isn't always bad if the sub happens in an intron or as the genetic code is degenerate it may not affect the a.a.
2. Deletion – ATT to just AT, this is worse as the whole chain is affected, not as bad towards end of chain as fewer a.a are affected
Mutations
![Page 79: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/79.jpg)
Mutations occur spontaneously, but something's can increase the rate of mutations these are known as mutagenic agents
UV, ionising radiation and certain chemicals are mutagenic agents, they can increase the rate of mutation in several ways
• Acting as a base – base analogs (chemicals) can sub for a base during replication changing the base sequence
• Altering bases – some chemicals can delete or alter bases
• Changing the structure of DNA – some radiation can change the structural properties of DNA, making DNA replication difficult
Mutagenic agents
![Page 80: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/80.jpg)
Some mutations can cause genetic disorders such as cystic fibrosis
Some mutations can increase the likelihood of developing certain cancers (BRCA1 increases the chances of breast cancer)
If a sex cell (gamete) containing a mutation for a genetic disorder is fertilised, the mutation will be present in the fetes
Hereditary Mutations
![Page 81: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/81.jpg)
Mutations that occurs after fertilisation are called acquired mutations, if these mutations occur in cells that control the rate of cell division then it can cause uncontrolled cell division and therefore a tumour or cancer
There are two types of cell that control cell division
1. Tumour suppressor genes – can be inactivated if a mutation in the DNA sequence occurs, it slows cell division by producing proteins that stop cells or cause them to self destruct. If proteins aren't produced then the rate of division increases
2. Proto-oncogenes – effect of the Proto-oncogenes is increased if mutations occur, they stimulate cell division by producing proteins that make the cells divide. If mutation occur they can become overactive and constantly stimulate division
Acquired Mutations
![Page 82: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/82.jpg)
Prevention – Protect yourself by limiting the amount of contact you have with mutagenic agents by wearing protective clothing, applying sun cream and having vaccinations (HPV vaccine)
Diagnosis – Normally diagnosis occurs after systems are showing, those who are high risk can be screened on a regular basis, which can lead to early diagnosis and a higher chance of recovery
Diagnosis – if the specific mutation is known then more sensitive tests can be developed which can lead to more accurate diagnosis and improved chances of a recovery
Treatment – treatment differs depending on the mutation, certain drugs can alter specific proteins helping supress cell division, sugary can be carried out to remove the cancer cells followed by chemo to kill off any left, gene therapy could treat it as long as it’s a specific mutation
Cancer – Acquired Mutations
![Page 83: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/83.jpg)
Prevention – those with hereditary mutations are already at more risk than others so should avoid gaining any further mutations and therefore should stay well away from any mutagenic agents, if the person is very high risk then preventative surgery can the carried out some woman may have a mastectomy to prevent breast cancer
Diagnosis – screening in a regular basis can catch it early increasing chances of recovery
Treatment – similar to acquired cancers but as the cancer is normally found earlier then the treatment isn't always as aggressive
Cancer – Hereditary
![Page 84: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/84.jpg)
Prevention – carriers or suffers of genetic disorders can undergo pre-implantation genetic diagnosis during IVF to prevent any offspring having the disease. Embryos are produced by IVF and screened for the mutation, only embryos without the mutation are implanted into the womb
Diagnosis – If a person has a family history of a genetic disorder they can have their DNA analgised to see if they have the mutation or are a carrier, if they are tested before systems develop any treatment can begin earlier
Treatment – Gene therapy can help some genetic disorders such as cystic fibrosis, but treatment can differ depending on the mutation and many treatments help reduce systems not stop the disease, in most cases though early diagnosis is key and can affect treatment options
Genetic Disorders
![Page 85: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/85.jpg)
• Multicellular organisms are made up to many different cell types that are all specialised for their particular function (liver cells, WBC etc.)
• All specialised cells came from stem cells
• Stem cells are unspecialised cells that can develop into other types of cell, when they divide
• Stem cells are found in the embryo and in some adult tissues (i.e.. In bone marrow)
• Stem cells that can develop into any kind of call are totipotent cells and are only present in early embryo development the few stem cells that remain into adult life are calls multipotent cells and are limited to what they can divide into
Stem Cells
![Page 86: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/86.jpg)
• Stem cells all contain the same genes but during development not all are transcribed and translated (expressed)
• Under the correct conditions, some genes are ‘switched off’
• mRNA is only transcribed from specific genes, the mRNA from these genes are then translated to proteins
• These proteins modify the cell, they determine cell structure and control cell processes
• Changes to the cell produced by these proteins cause the cell to become specialised, these changes are difficult to reverse so once a cell becomes specialised they stay that way
Specialisation
![Page 87: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/87.jpg)
• Mature plants also have stem cells, they are found in the growing regions of the plant
• All stem cells in plants are totipotent
• This means that whole plants can be grown artificially using a process called tissue culture
1. A single totipotent cell is taken from a growing region of a plant
2. The cell is placed in a sterile growth medium (agar jelly)
3. The plant cells will grow and divide into a mass of unspecialised cells, given the right conditions and growth factors, these cells will mature and specialise
4. The cells grow forming plant organs or an entire plant depending on the growth factor used
Plants – Tissue Culture
![Page 88: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/88.jpg)
• Stem cells can divide into other types of cell, so could be used to replace cells damaged by illness or injury
• Bone marrow contains stem cells that can become any BC, so a bone marrow transplant can be used to replace faulty marrow with good stuff producing healthy blood cells (leukaemia)
• It can also be used to treat sickle-cell anaemia and SCID
Stem Cell Therapy
![Page 89: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/89.jpg)
Scientists are very interested to see if stem cell therapy can help treat other diseases and are currently researching the use of stem cells in the treatment off…
1. Spinal Cord injuries – replacing the damaged nerve tissue
2. Heart disease – replacing damaged Heart tissue
3. Bladder conditions – could grow a whole new bladder
4. Respiratory disease – donated windpipes can be stripped down to there collagen structure and then covers In stem cell tissue
5. Organ transplants – organs could be grown for those on the organ donor list
Other Options
![Page 90: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/90.jpg)
There are a many benefits to stem cell treatments
• They could save a lot of lives, those on the organ donor list wouldn’t be waiting for donors to come forward but would have their own organ grown for them, decreasing the number that die waiting, also many successful transplant patients are on drugs the rest of there life to prevent rejection, the stem cell organ wouldn’t have this issue
• Could improve the quality of life for many people, the bind would see again as stem cells could replace damaged eye tissue
Benefits of Stem Cells Therapy
![Page 91: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/91.jpg)
Scientists have to get stem cells from somewhere, and there's only two options
1. From Adults – the cells can be obtained from body tissue, its all very simple and very little risk is involved, however there is limited use as cells are multi-potent
2. From Embryos – obtained in the early stages of embryo development, embryos are produced in IVF and once they are 4-5 days old stem cells are removed, these can become anything there totipotent, but naturally this causes a heap of ethical issues
The Problems
![Page 92: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/92.jpg)
1. Stem cells form IVF raises a few issues because the embryo could become implanted In a womb creating life, which can be considered as wrong
2. Some have fewer objections to stem cells being obtained from unfertilised embryos as they could only survive a few days anyway
3. And some think that only adult stem cells should be used as they don’t damage any embryos, even If its currently not possible to do much with adult stem cells
Ethics
![Page 93: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/93.jpg)
Quite short, quite interesting, quite tricky
Last Part
Gene Therapy
![Page 94: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/94.jpg)
• Polymerase chain reaction – Produces a lot of identical copies of a specific gene
• In vivo cloning – produces lots of identical copies of genes
• DNA probes – used to identify specific genes
These techniques are then used for many things such as genetic fingerprinting, genetic engineering, diagnosing diseases and treat genetic disorders
DNA technology uses DNA fragments, there are 3 ways these fragments can be obtained
1. Reverse transcriptase
2. Restriction endonuclease
3. PCR
Techniques
![Page 95: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/95.jpg)
• Many cells only contain 2 copies of each gene, making it difficult to get a fragment containing the target gene, but there are many mRNA molecules which are complementary to the target gene, which is easier to get
• The mRNA molecules can be used as a template to make lots of DNA, reverse transcriptase makes DNA from a RNA template, the DNA produced is called cDNA
• Pancreatic cells produce insulin, they have lots of mRNA that are complementary to the insulin gene, so reverse transcriptase could be used to make cDNA from the mRNA
• For this to happen mRNA must first be isolated from the cells, and mixed with free DNA nucleotides and reverse transcriptase, the mRNA is used as a template for the cDNA
Reverse Transcriptase
![Page 96: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/96.jpg)
• Some sections of DNA are palindromic (GAATTC – CTTAAG)
• Restriction endonuclease are enzymes that recognise specific palindromic sequences and cut the DNA at these parts
• Different restriction endonuclease cut at different recognition sequences, the base sequence of the DNA is complementary to the active site of the enzyme
• If the recognition sequence is the same at each end of the fragment that’s needed then the restriction endonuclease can separate it from the rest of the gene
• The DNA sample is incubated with the specific restriction endonuclease, which cut the fragment via hydrolysis
• The cut can leave sticky ends (preferable) or blunt ends
Restriction Endonuclease
![Page 97: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/97.jpg)
1. Reaction mixture of DNA, nucleotides, primers and DNA polymerase is set up (primers are complementary to ends of DNA allowing polymerase to bind, polymerase builds the new DNA strand)
2. The mix is heated to 95*C breaking the H-bonds
3. Mix is then cooled to 50* is so that primers can attached to DNA strand
4. Mix is heated to 72* allowing DNA polymerase to work
5. The DNA polymerase lines up the nucleotides along the template strand and by specific base pairing a new complementary DNA strand is formed
6. Two new copies of the template strand are formed and first cycle is finished
7. The cycle begins again, each cycle doubling the amount of DNA in the mixture until adequate amounts are produced
PCR
![Page 98: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/98.jpg)
Its all about making two identical copies of a gene, there are two methods available
1. In vitro – where the gene copies are made outside out a living organism using PCR
2. In vivo – where the gene copies are made within a living organism, and as the organism grows, it replicates it DNA creating multiple copies of the gene
Gene Cloning
![Page 99: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/99.jpg)
• The DNA is inserted into a vector (something used to transfer DNA into a cell i.e.. Virus or plasmid)
• The vector DNA is cut open using the same restriction endonuclease that was used to isolate the target gene, thus allows the sticky ends to be complementary to one another
• The vector DNA and DNA fragment are mixed together with enzyme DNA ligase. The ligase joins the sticky ends together, connecting the vector and fragment. This process is called ligation
• The new combination of bases in the DNA vector is known as recombinant DNA
In-vivo – Step 1
![Page 100: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/100.jpg)
• The vector with the recombinant DNA is used to transfer the gene into host cells
• If a plasmid vector is used, the cells need to be encouraged to take up the plasmid. This is done by placing the cells into ice cold CaCl2 solution making cell wall more preamble, and then mix is heat shocked, encouraging plasmids to be taken in
• The bacteria vector will infect the host cells by injecting its DNA into it, the target gene then integrates itself with the cells DNA
• Host cells that take up the vectors containing the gene are transformed
In-vivo - Step 2
![Page 101: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/101.jpg)
• Marker genes are used to discover which host cells took up the recombinant DNA, they are inserted into the vectors at the same time as the gene to be cloned
• Host cells are grown on agar jelly, and as each cell divides it creates an colony (army) of cloned cells
• Transformed cells will produce a colonies where all the cells contain the target gene and the marker gene
• The marked can code for antibiotic resistance, if the agar plates contain the antibiotic only the transformed cells will grow and survive
• The marker could be a fluorescing gene, so under UV light a transformed cells will glow (this is how they make glow in the dark fish/rabbits)
• Identified transformed cells are allowed to continue to grow and produce more of the cloned gene
In-vivo – Step 3
![Page 102: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/102.jpg)
In-vivo Advantages Disadvantages
Can produce mRNA as well as its done in a living cell
DNA fragments have to isolated, this can be a very slow process
Can produce modified DNA Inserting DNA into vector wont work every time can take several attempts
Large fragments can be cloned
Relatively cheap method
![Page 103: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/103.jpg)
In-vitro (PCR)
Advantages Disadvantages
Can produce a lot of DNA Only works with small fragments
DNA isn't modified Cant produce any mRNA
Only replicated fragments of interest
Can be expensive if you need a lot of DNA
Very fast
![Page 104: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/104.jpg)
• Also know as recombinant DNA technology
• Organisms that have their DNA altered by genetic engineering are called transformed organisms
• These organisms have recombinant DNA
• Micro-organisms, plants and animals can be genetically engineered to benefit humans
Genetic Engineering
![Page 105: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/105.jpg)
• Agricultural crops can be transformed so that they give a higher yield or are more nutritious, this reduces malnutrition and famine, crops can be made resistant to pests, reducing the amount of pesticide needed and lowering the cost of production
• However people are concerned that monoculture (producing one type of GM crop) could make the whole crop vulnerable to disease as all the crops are identical
• There is a chance of super weeds, when GM plants interbreed with wild plants
Agriculture
![Page 106: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/106.jpg)
• Industrial processes often use biological catalysts, these can be produced from transformed organisms in large quantities cheaply and quickly
• The production of cheese uses an enzyme found in cows, GM enzymes save the killing of cows and is a lot cheaper
• However people are worried that if labelling is not clear they may consume food that been made from GM organisms and could lead to toxins in the food industry
Industry
![Page 107: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/107.jpg)
• Many drugs and vaccines are produced by transformed organisms, using recombinant DNA technology, they can be made quickly and cheaply in large quantities
• For example insulin used to come from cow, horse or pig pancreases which didn’t work as well as it wasn’t human insulin, now human insulin can be produced by cloning the human insulin gene
• However there is concern that companies who own the GM tech may be limiting the use of technology that could be saving lives
• Others are worries that designer babies could be produced having alleles that were specifically chosen by the parents
Medicine
![Page 108: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/108.jpg)
• They believe that GM crops can benefit people reducing the risk of famine and malnutrition such as drought resistance crops in areas prone to drought
• Transformed crops could be used to produce useful pharmaceutical products, making the drugs more accessible to people, such as places where storage is difficult
• Medicine can be produced cheaply, making them more affordably
Humanitarians
![Page 109: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/109.jpg)
• Are against GM technologies as it could damaged the environment, monoculture will reduce biodiversity of an area, and if the transformed crops interbreed with wild plants the consequences could be massive
• Most the GM technology rests with a handful of large companies, that with the tech are only getting bigger, preventing smaller businesses from moving up the corporate ladder.
Environmentalists
![Page 110: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/110.jpg)
• Not all of a genome codes for proteins
• Some of the genome consists of not coding repeats of base sequences i.e. GGCCTATGGCCTATGGCCTAT etc.
• The number of times these sequences repeat is unique to each individual person (apart from identical twins)
• The repeated sequences occur in many places in the genome, to the position of the repeats and the number of repeats can be used to identify people this is genetic fingerprinting
Non-Coding DNA
![Page 111: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/111.jpg)
1. A sample of DNA is obtained from a persons blood/saliva
2. PCR is used to make copies of the fragments of repeating bases on the DNA, primers bind to repeats so only they are copied
3. You end up with DNA fragments where the length corresponds to the number of repeats the person has
4. A fluorescent tag is added to all DNA fragments, so they can be identified with UV light
5. The DNA undergoes electrophoresis, the fragments are placed in wells in gel that’s submerged in buffer sol, and electrical current is run through the gel, as DNA has a –ive charge the fragments move to the +ive electrode
6. The smaller fragments move the fastest so travel further down the gel
7. Alongside the sample run, a sample of known fragment sizes is also run through and under UV light you can compare the two, and find the size of the fragments
Electrophoresis
![Page 112: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/112.jpg)
Genetic finger printing can be use to determine genetic relationships because we inherited our non-coding base sequences from our parents, half from each parent, so the more bands that match on a fingerprint the more closely related those to people are, this is how paternity tests work
Another use of fingerprinting is determining genetic variation within a population, so the few bands that match the more genetically different people are, this means you can compare the number of repeats in several places to find how genetically varied a population is
Relationships and Variability
![Page 113: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/113.jpg)
• Forensic science uses genetic fingerprints to compare samples of DNA collected at crime scenes, and run them against possible suspects
• DNA is isolated at crime scene
• Each sample is replicated using PCR
• Products are run though electrophoresis
• Is the samples match it proves that person was at the crime scene at some point, not that they did it
• Victims sample should also be included to avoid confusion
Forensics
![Page 114: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/114.jpg)
• In medical diagnosis, a genetic fingerprint can refer to a unique pattern of alleles
• It can be used to diagnosis genetic disorders and cancers, its useful when the specific mutation isn't known or where several mutations have caused the disorder, because it identifies a broader, altered genetic pattern
• PGH screens embryos created by IVF for genetic disorders before they are implanted into the uterus
Medical Diagnosis
![Page 115: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/115.jpg)
• DNA probes can be used to locate genes or to see if a person have a mutated gene
• DNA probes are short strands of DNA, that have specific base sequences complementary to the base sequence of the target gene
• The DNA probe will hybridise (bind) to the target gene if its present
• The probe will also have a marker attached so it can be identified, the marker will be radioactive or fluorescent
Here's how its done
1. A sample of DNA is digested into fragments using restriction enzymes and separated using electrophoresis
2. Separated DNA are transferred to nylon membrane and incubated with marker
3. If gene present the DNA probe will hybridise
4. The membrane is exposed to UV and a band will appear
Locating Genes
![Page 116: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/116.jpg)
As well as locating genes, knowing its sequence can be quite handy to, this is done by DNA sequencing. But genes are a bit to long to sequence as a whole, so using restriction endonuclease they are cut into smaller fragments. The fragments are then sequenced and put back in the same order, restriction mapping is used to do this
1. Different restriction enzymes are used to cut labelled DNA into fragments
2. The fragments are then separated (electrophoresis)
3. The size of the fragments produced is used to determine the relative location of the cut sites
4. A restriction map of the original DNA is made, showing all the cut sites
Restriction Mapping
![Page 117: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/117.jpg)
1. Into a 4 separate tubes, single stranded DNA, DNA polymerase, primer, nucleotides and labelled nucleotide (A in one, T in another etc..)
2. The tubes undergo PCR, which replicates the DNA strands, all strands are of a different length due to the labelled nucleotide stopping the chain
3. For example if a modified T was used to build the new strand instead of a normal T then the addition of any further bases is stopped i.e.. ATTGCT* and ATTGCTACT*
4. The DNA fragments in each tube are separated by electrophoresis and observed under UV light
5. The complementary base sequence can be read from top (furthest from well) to bottom of the gel
Gene Sequencing
![Page 118: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/118.jpg)
• A genetic disorder caused by a mutation in the haemoglobin gene
• Causes RBCs to be sickle shaped (concave)
• The sickle RBCs block capillaries restricting blood flow causing organ damage and pain
• Some people are carriers and have both sickle cell and normal RBCs
• Carriers are better protected against malaria, but does increase the chances of producing a sickle celled child
Sickle-Cell Anaemia
![Page 119: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/119.jpg)
• DNA probes can be used to screen for clinically important genes, such as mutated ones
• There are two ways this can be done
1. The probe can be labelled and used to look for a single gene in a sample of DNA
2. The probe can be used as a DNA microarray, which can scan lots of genes at once
Microarrays
• It’s a glass slide with spots of different DNA probes attached to it in rows
• A sample of labelled DNA is washed over the slide
• If the labelled DNA is complementary to the probes it will stick to them, the tray is then re-washed and examined under UV light
• Any spot that florescent shows that the DNA contains that specific gene
DNA Probes
![Page 120: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/120.jpg)
• Genetic counselling is advising patients and relatives about the risks of genetic disorders
• It advises people about screening and explains the results, screening can help identify the carrier of the gen, the type of mutated gene and the most effective treatment
• If the results are +ive then the person is advised on the options available to them, in either prevention or treatment
• For example someone with a history of breast cancer may chose to get screened and if there is a high chance of developing breast cancer they may choose to have a mastectomy
Genetic Counselling
![Page 121: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/121.jpg)
• Cancers can be caused by mutations to proto-oncogenes and tumour suppressor genes, different mutations cause different cancers, which need to be treated in different ways
• Screening using DNA probes can be used to help decide the best course of treatment
• Breast cancer can be caused by a mutation in the HER2 proto-oncogene, if the patients cancer is caused by this gene they can be treated with Herceptin®. This drugs binds to the altered HER2 protein and supresses cell division, but its only affective against this type of cancer as it only binds to receptors on the HER2 protein.
Deciding Treatment
![Page 122: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/122.jpg)
How it works
• Altering the defective genes inside cells to treat genetic disorders and cancers
• The method all depends on the type of gene, if its caused by to recessive alleles a working dominant can be added. If the disorders dominant you can ‘silence’ the allele by adding more DNA to it so it doesn't work anymore
Getting the new DNA in
• The allele is inserted using vectors either a virus plasmid or liposome
Somatic therapy – altering the alleles in the body cells most affected by the disorder
Germ line therapy – altering the alleles in sex cells so all the cells will contain altered DNA (currently illegal)
Gene Therapy
![Page 123: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/123.jpg)
Advantages Disadvantages
Could prolong the lives of people with genetic disorders and cancers
The effects can be short lived (somatic only)
Give people a better quality of life
Multiple treatments (somatic)
People with disorder can conceive a healthy child
Difficult to get allele into target cell
Could decrease the frequency of sufferers of certain genetic diseases
Vector could produce an immune response
Allele inserted to wrong place causing more problems
Allele could be over expressed
People fear designer or super babies
Pros and Cons
![Page 124: Biology unit 5 overview](https://reader035.vdocuments.us/reader035/viewer/2022070303/5499e9f9ac7959ff2d8b59bb/html5/thumbnails/124.jpg)
Yay you did it, now read until you know it ALL
Fini