biology chapter 8.5-8.7 review aminno acids mrnans miscvocabulary mutation q $100 q $200 q $300 q...
TRANSCRIPT
![Page 1: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/1.jpg)
Biology Chapter 8.5-8.7Review
Aminno Acids mRNAns Misc Vocabulary Mutation
Q $100
Q $200
Q $300
Q $400
Q $500
Q $100 Q $100Q $100 Q $100
Q $200 Q $200 Q $200 Q $200
Q $300 Q $300 Q $300 Q $300
Q $400 Q $400 Q $400 Q $400
Q $500 Q $500 Q $500 Q $500
Final Jeopardy
![Page 2: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/2.jpg)
$100 Question Amino Acids
How many amino acids areUsed to make all the proteinsThe body uses?
![Page 3: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/3.jpg)
$100 Answer Amino Acids
20
![Page 4: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/4.jpg)
$200 Question Amino Acids
How many amino acids are built in thisLine of mRNA
augccauaugcgguaacadaguag
![Page 5: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/5.jpg)
$200 Answer Amino Acid
augccauaugcgguaacacaguag
One start AUGOne end UAG6 amino acids
![Page 6: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/6.jpg)
$300 Question Amino Acids
What are the three nucleitide Bases called that identify anAmino acid?
![Page 7: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/7.jpg)
$300 Answer Amino Acid
Triplet codon
![Page 8: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/8.jpg)
$400 Question Amino Acid
What molecule carries the amino acid coded by mRNA to the ribosome??
![Page 9: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/9.jpg)
$400 Answer Amino Acid
tRNA
![Page 10: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/10.jpg)
$500 Question Amino Acid
What anticodon pairs with the codon AUG?
![Page 11: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/11.jpg)
$500 Answer Amino Acid
TAC
![Page 12: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/12.jpg)
$100 mRNA
What happens if the mRNA reading frame is changed??
![Page 13: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/13.jpg)
$100 Answer mRNA
The amino acid sequence of the resulting protein changes.
![Page 14: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/14.jpg)
$200 Question mRNA
What forms the peptide bonds that link amino acids in a protein??
![Page 15: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/15.jpg)
ribosome
$200 Answer mRNA
![Page 16: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/16.jpg)
$300 Question mRNA
How does the lac operon switch off?
![Page 17: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/17.jpg)
$300 Answer mRNA
A repressor protein binds to the operator.
![Page 18: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/18.jpg)
$400 Question mRNA
What does NOT happen during mRNA processing?
A) introns are cut outB) a cap and tail are added
c) exons are removedd) exons are spliced together
![Page 19: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/19.jpg)
$400 Answer mRNA
C) Exons are removed
![Page 20: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/20.jpg)
$500 Question mRNA
What determines the order ofAmino acids ina protein?
![Page 21: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/21.jpg)
$500 Answer mRNA
The order of the mRNA anticodons
![Page 22: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/22.jpg)
$100 Question Misc.
What is the function of transcription factors in eukaryotic cells?
![Page 23: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/23.jpg)
$100 Answer Misc
They help RNA polymerase know where a gene starts
![Page 24: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/24.jpg)
$200 Question Misc
Genes determine a person’sEye color by coding for _________That affect eye color?
![Page 25: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/25.jpg)
$200 AnswerMisc
proteins
![Page 26: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/26.jpg)
$300 Question Misc
Why type of bond are created duringDehydration synthesis?
![Page 27: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/27.jpg)
$300 AnswerMisc
Polypeptide bonds
![Page 28: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/28.jpg)
$400 Question Misc
Of the 20 amino acids, 12 are found in the cellAnd the remaiinng 8 are made from?a)Proteins floating in the cytoplasmb) Waterc) Hydrogend) The food we eat
![Page 29: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/29.jpg)
$400 Answer Misc
d) From the food we eat
![Page 30: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/30.jpg)
$500 Question Misc
Proteins are sometimes called?
![Page 31: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/31.jpg)
$500 Answer Misc
Polypeptide chains
![Page 32: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/32.jpg)
$100 Question Vocabulary
Define mutagen
![Page 33: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/33.jpg)
$100 Answer Vocabulary
Agents in the environment that can change DNA
![Page 34: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/34.jpg)
$200 Question Vocabulary
What is a mutation?
![Page 35: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/35.jpg)
$200 Answer Vocabulary
Change in the organism’s DNA
![Page 36: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/36.jpg)
$300 Question Vocabulary
What is frameshift?
![Page 37: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/37.jpg)
$300 Answer Vocabulary
Insertion or deletion ofA nucleotide in DNA
![Page 38: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/38.jpg)
$400 Question Vocabulary
What is Point Mutation?
![Page 39: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/39.jpg)
$400 Answer Vocabulary
One nucelotide is substitutedFor another
![Page 40: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/40.jpg)
$500 Question Vocabulary
What is chromosomal mutation?
![Page 41: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/41.jpg)
$500 Answer Vocabulary
Different sized units that have no copy of the gene
![Page 42: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/42.jpg)
$100 Question Mutation
Cystic Fibrosis is an example of a genetic disease caused by a deletion of a nucleotide . What is the term for this type of mutation?
![Page 43: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/43.jpg)
$100 Answer Mutation
frameshift
![Page 44: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/44.jpg)
$200 Question Mutation
What type of mutation has noEffect on phenotype?
![Page 45: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/45.jpg)
$200 Answer Mutation
Translocation
![Page 46: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/46.jpg)
$300 Question Mutation
Which is an example of a mutagen?a)Triglycerideb)UV sunlightc)Thymine
![Page 47: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/47.jpg)
$300 Answer Mutation
UV Sunlight
![Page 48: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/48.jpg)
$400 Question Mutation
Mutations that can affectOffspring occur in what Cell type?
![Page 49: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/49.jpg)
$400 Answer Mutation
Chromosomal
![Page 50: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/50.jpg)
$500 Question Mutation
List two causes of mutations
![Page 51: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/51.jpg)
$500 Answer Mutations
a) Inheritatedb) Environmental Impact on epigenomec) Frame shiftd) Point mutation
![Page 52: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/52.jpg)
Final Jeopardy
What is the difference betweenTranscription and translation?
![Page 53: Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final](https://reader030.vdocuments.us/reader030/viewer/2022032709/56649ed35503460f94be430d/html5/thumbnails/53.jpg)
Final Jeopardy AnswerTranscription is when theNucleotide T is changed to U formRNATranslation is when the tripletCodon is “read” to create a protein
Poetry Jeopardy Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final Jeopardy
Jeopardy ABCD E Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final Jeopardy