bioinformatics da wikipedia: involve the use of techniques including: applied mathematics,...
TRANSCRIPT
![Page 1: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/1.jpg)
BioinformaticsDa wikipedia:Involve the use of techniques including:applied mathematics, informatics, statistics, computer science, artificial intelligence, chemistry and biochemistry
to solve biological problems usually on the molecular level
![Page 2: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/2.jpg)
I Computers nella scienza
Comunicazione
Informazione Calcolo
![Page 3: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/3.jpg)
Banche datiSequenze: (proteine, geni, reg. regolative, rna- 100 miliardi di basi 100 milioni di sequenze 100 mila organismi
Testi: letteratura scientifica 15 milioni di articoli 5 mila riviste
Altre:strutture, enzimi, malattie, promotori etc..
![Page 4: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/4.jpg)
Analisi di sequenzeSequenze: (proteine, geni, reg. regolative, rna)
1 sequenza nel 1977nel 1983 2000 in banca dati
strumenti e metodi per l'analisi delle sequenze sono alla base di quasi tutta la bioinformatica
![Page 5: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/5.jpg)
Annotazione funzionale
Ricerche in banche dati
Motivi funzionali
![Page 6: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/6.jpg)
Analisi filogeneticheRicostruire la storia evolutiva di geni e organismi
![Page 7: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/7.jpg)
Bioinformatica strutturale
Visualizzazione
Classificazionee funzione
![Page 8: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/8.jpg)
Predire la struttura
Trovare la struttura 3D di una proteina a partire dalla sua sequenza
![Page 9: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/9.jpg)
Simulazioni
Drug design
Protein design
Docking
![Page 10: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/10.jpg)
Genomicaacaccacacc cacaccacac ccacacccac acaccacacc cacacacaca cacacaccac acccacacac acccacacac cacaccacac ccacacacca cccacacaca cacaacacta ccctaatcta accctgtcca acctgtctcc aaacttaccc tccattacct tacctccccactcgttaccc tgccccattt aaccatacca cagcgaacca cgatccacat ctctacttcc taccaccaac ccaccgtcca ccataaccgt taccctccaa ctacccatat cctactccac tgccacttac cctgccattc ctctaccatc catcatctgg tactcactat actgttgttc tacccaccat attgaaacgc taacaaatga tcgtaaataa tacacatata cttaccctaccactccaatc ccaccaccac atgccatact caccttcact tgtatattga tatgccatac gcccacggat gctatagtat ataccatctc aaacttaccc tactttcaca ttccactcca tggcccatct ctcactaaat cagtaaatat gcacccacat cattatgcac ggcgcttgcc tcagcggtct ataccctttg ccatttaccc ataaattcca tgattatcta cattttaata tctatatctc atttggcggc ccaaaatatt gtataactgc ccttaataca tacgttatac tattttacac cgtatactaa ccactcaatt tatatacact tatgtcaatg t
Genomi al 4-2006
Finiti Incompleti In corso Totale
Procarioti 330 238 342 910
Funghi 9 33 20 62
Altri eucarioti 11 41 110 162
Totale 350 312 472 1134
![Page 11: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/11.jpg)
AssemblaggioRicostruire un genoma da milioni di sequenze di DNA
![Page 12: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/12.jpg)
Annotazione genomica
Cercare geni e promotori all’interno di un genoma
![Page 13: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/13.jpg)
10 Kb
200 bp
1 Mb
200 Mb
Browser genomici
![Page 14: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/14.jpg)
Genomica Comparata
![Page 15: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/15.jpg)
altri "...omi"ProteomaTrascrittomaInterattomaMetaboloma
Nuove tecnologie
+ dati
- qualità
![Page 16: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/16.jpg)
Analisi dei microarrays
Classificare i geni a seconda di quando e dovesono trascritti in RNA
![Page 17: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/17.jpg)
Systems biology• Studio dei processi biologici (spesso a livello cellulare e
molecolare) considerati come sistemi composti da molte parti interagenti
• Raccolta dati• Modello matematico• Simulazione e previsione• Verifica
![Page 18: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/18.jpg)
Reti di interazioni
![Page 19: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/19.jpg)
Reti metaboliche
![Page 20: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/20.jpg)
![Page 21: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/21.jpg)
Simulazioni
![Page 22: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/22.jpg)
in vivo
in vitro
in silicio
Cellule virtuali
![Page 23: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/23.jpg)
Analisi di testiCercare di estrarre in modo automatico informazione scientifica dalla letteratura
![Page 24: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/24.jpg)
Analisi di testi
![Page 25: Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,](https://reader036.vdocuments.us/reader036/viewer/2022062701/5542eb5a497959361e8c7a22/html5/thumbnails/25.jpg)
OntologieClassificare e ordinare la conoscenza biologica