Biochimica et Biophysica Acta 1823 (2012) 1242–1251

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r .com/ locate /bbamcr

Capacitative and non-capacitative signaling complexes in human platelets

Alejandro Berna-Erro, Carmen Galan, Natalia Dionisio, Luis J. Gomez, Gines M. Salido, Juan A. Rosado ⁎Department of Physiology, Cell Physiology Research Group, University of Extremadura, Cáceres, Spain

⁎ Corresponding author at: Department of PhysiologCaceres, 10071, Spain. Tel.: +34 927257139; fax: +34

E-mail address: jarosado@unex.es (J.A. Rosado).

0167-4889/$ – see front matter © 2012 Elsevier B.V. Aldoi:10.1016/j.bbamcr.2012.05.023

a b s t r a c t

a r t i c l e i n f o

Article history:Received 26 January 2012Received in revised form 18 May 2012Accepted 21 May 2012Available online 26 May 2012

Keywords:Orai1Orai2Orai3STIM1STIM2TRPC

Discharge of the intracellular Ca2+ stores activates Ca2+ entry through store-operated channels (SOCs). Sincethe recent identification of STIM1 and STIM2, as well as the Orai1 homologs, Orai2 and Orai3, the proteincomplexes involved in Ca2+ signaling needs re-evaluation in native cells. Using real time PCR combinedwith Western blotting we have found the expression of the three Orai isoforms, STIM1, STIM2 and differentTRPCs in human platelets. Depletion of the intracellular Ca2+ stores with thapsigargin, independently ofchanges in cytosolic Ca2+ concentration, enhanced the formation of a signaling complex involving STIM1,STIM2, Orai1, Orai2 and TRPC1. Furthermore, platelet treatment with the dyacylglicerol analog 1-oleoyl-2-acetyl-sn-glycerol (OAG) resulted in specific association of Orai3 with TRPC3. Treatment of platelets witharachidonic acid enhanced the association between Orai1 and Orai3 in human platelets and overexpressionof Orai1 and Orai3 in HEK293 cells increased arachidonic acid-induced Ca2+ entry. These results indicatethat Ca2+ store depletion results in the formation of exclusive signaling complexes involving STIM proteins,as well as Orai1, Orai2 and TRPC1, but not Orai3, which seems to be involved in non-capacitative Ca2+ influxin human platelets.

© 2012 Elsevier B.V. All rights reserved.

1. Introduction

Receptor-operated Ca2+ entry is a ubiquitous and important mecha-nism for Ca2+ influx in excitable and non-excitable cells. This mecha-nism comprises Ca2+ entry pathways activated by receptor occupation,from the non-capacitative Ca2+ currents via receptor-channels them-selves or through channels operated by second messengers to thecapacitative Ca2+ entry pathway activated by discharge of the intracellu-lar Ca2+ pools via store-operated Ca2+ channels (SOCs) [1]. Capacitativeor store-operated Ca2+ entry (SOCE) is a complexmechanism controlledby the filling state of the intracellular Ca2+ stores. In 2005, the proteinSTIM1 was identified as the endoplasmic reticulum (ER) Ca2+ sensorthat communicates the information of the filling state of the ER to SOCslocated in the plasma membrane [2]. Concerning SOCs, the canonicalhuman homologs of Drosophila transient receptor potential channels(TRPC), particularly TRPC1, have been presented as candidates to medi-ate non Ca2+-selective capacitative currents (ISOC) [3]. In 2006, Orai1waspresented as the pore unit of the channel that mediate ICRAC, the bestcharacterized and Ca2+-selective capacitative current [4,5], and a num-ber of studies demonstrated that co-expression of STIM1 and Orai1 isable to enhance ICRAC [6] or to successfully reconstitute ICRAC-like signalsin HEK-293 cells [7]. Isoforms of these proteins, STIM2, Orai2 and Orai3,have also been identified, although their role in intracellular Ca2+ ho-meostasis is less characterized [8].

y, University of Extremadura,927257110.

l rights reserved.

STIM2 is almost ubiquitously expressed in human tissues and hasbeen found located in the ER membrane and in the membrane ofacidic intracellular Ca2+ stores [9–11], but not in the plasma mem-brane in contrast to STIM1 [10,12]. Nevertheless, the function ofSTIM2 is still unclear. By using STIM2 knockdown expression, it hasbeen suggested that STIM2 acts as a regulator that stabilizes restingCa2+ concentration in the cytosol and the ER [13]. Concerning SOCE,STIM2 has been shown to be able to interact with Orai proteins andTRPC1 channels [6,14], thus suggesting a potential role in SOCE. Stud-ies performed by Gill's group suggested that STIM2 inhibits SOCEwhen expressed alone [10], but induces constitutive SOCE when co-expressed with Orai1 [6]. Further studies have reported different de-grees of attenuation of SOCE in the absence of STIM2 expression in avariety of cells [15,16], and STIM2-mediated Ca2+ entry via twostore-dependent and store-independent modes in HEK293 cells [14].

Orai2 andOrai3 are alsowidely expressed in different human tissues[17,18]. Knockdown gene expression in a variety of cell lines has re-vealed that Orai2 and Orai3 have a minor role in SOCE than Orai1[19–21]. The functional properties of Orai3 have been shown to beslightly different to those of Orai1 and Orai2. The latter show similarlyfast activation kinetics while Orai3 shows slower activation. In addition,Orai3 is more permeant to monovalent cations than Orai1 and Orai2[22]. Co-expression of STIM1 and Orai1 or Orai2 channels increasedSOCE in HEK293 cells [7] andmouse [23], indicating that these isoformsinteract and are activated by STIM1. In contrast, no significant increasesin SOCE were found in cells co-expressing STIM1 and Orai3 [7].

In the present study we have investigated the expression and in-teraction of the different isoforms of Orai and STIM proteins and the

Table 1Primers.

Gene Forward (5′–3′) Reverse (5′–3′) Bp. Anneal T.(°C)

Ref.

hTRPC1 tgcgtagatgtgcttgggag atgctctcagaattggatcc 377 54.6 [51]hTRPC3 cgatctggtatgagaacc cagtccatgtaaactggg 216 48hTRPC6 tcatcatggtgtttgtggc gcaaaacaatgaccattgtaa 237 56.5 [52]hOrai1 agcaacgtgcacaatctcaa gtcttatggctaaccagtga 344 56.5 [23]hOrai2 cggccataagggcatggatt ttgtggatgttgctcacggc 333 56.5 [23]hOrai3 ctcttccttgctgaagttgt cgattcagttcctctagttc 354 56.5 [23]hSTIM1 cagtgaaacacagcaccttcc aagagcactgtatccagagcc 213 56.5 [53]hSTIM2 ccagggctttcactgtgatt cctcggcttaaggttgtgaa 147 60 [54]hβ-actin agcgagcatcccccaaagtt gggcacgaaggctcatcatt 285 48–60 [55]

Fig. 1. Quantification of Orai, STIM and TRPC mRNA transcripts in human platelets.A, Representative picture of semi-quantitative RT-PCR products separated by electrophoresisin agarose gels. B, qRT-PCR expression analysis of TRPC(1, 3, 6), Orai(1–3) and STIM(1–2)mRNA transcripts in human platelets. Values were normalized to β-actin expression andrepresented as (mean expression relative to Orai1±S.E.M; n=3).

1243A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

most relevant TRPC subfamily members in human platelets in re-sponse to store depletion or stimulation with the soluble analog ofthe second messenger diacylglycerol, 1-oleoyl-2-acetyl-sn-glycerol(OAG). Our results suggest that, while Orai1 and Orai2 operate in aSTIM-dependent manner, Orai3 does not interact with STIM isoformsupon store depletion in these cells.

2. Materials and methods

2.1. Materials

Apyrase (grade VII), aspirin, thapsigargin (TG), bovine serum albu-min (BSA), phenylmethylsulfonyl fluoride (PMSF), arachidonic acid,1-oleoyl-2-acetyl-sn-glycerol (OAG) and rabbit anti-Orai1 antibodywere purchased from Sigma (Madrid, Spain). Goat anti-hTRPC6 poly-clonal antibody, horseradish peroxidase-conjugated goat anti-rabbitIgG antibody and horseradish peroxidase-conjugated donkey anti-goat IgG antibody were from Santa Cruz (Santa Cruz, CA, U.S.A). Rabbitanti-TRPC1 antibodywas from Alomone Labs (Jerusalem, Israel). Rabbitanti-TRPC3 polyclonal antibody, rabbit anti Orai-2 polyclonal antibodyand rabbit anti Orai-3 polyclonal antibody were from Abcam(Cambridge, U.K.). Mouse anti STIM1 antibody was from BD Transduc-tion Laboratories (Frankin Lakes, NJ, U.S.A). Rabbit polyclonal anti-STIM2 antibody was from Cell Signaling (Boston, MA, U.S.A). HyperfilmECL was from Amersham (Buckinghamshire, U.K.). Transpass transfec-tion reagent was from Izasa (Madrid, Spain). Protein A-agarose wasfromUpstate Biotechnology Inc. (Madrid, Spain). Enhanced chemilumi-nescence detection reagents and rabbit anti-mouse IgG were fromPierce (Cheshire, U.K.). All other reagents were of analytical grade.

2.2. Platelet preparation

Platelets were prepared as previously described [24] as approved byLocal Ethical Committees and in accordance with the Declaration ofHelsinki. Briefly, blood was obtained from healthy drug-free volunteersand mixed with one-sixth volume of acid/citrate dextrose anticoagulantcontaining (in mM): 85 sodium citrate, 78 citric acid and 111 D-glucose.Platelet-rich plasma (PRP) was then prepared by centrifugation for5 min at 700 ×g and aspirin (100 μM) and apyrase (40 μg/mL) wereadded. For dimethyl BAPTA loading, the platelet-rich plasmawas incubat-ed at 37 °C with 10 μM dimethyl BAPTA acetoxymethyl ester for 20 min.Cells were then collected by centrifugation at 350 ×g for 20 min andresuspended in HEPES-buffered saline (HBS), pH 7.45, containing (inmM): 145 NaCl, 10 HEPES, 10 D-glucose, 5 KCl, 1 MgSO4 and sup-plemented with 0.1% BSA and 40 μg/mL apyrase.

2.3. Cell culture

Human embryonic kidney 293 (HEK293) cells were obtained fromthe American Type Culture Collection (Barcelona, Spain) and culturedin Dulbecco's modified Eagle's medium, supplemented with 10% heat-inactivated fetal bovine serum, in a 37 °C incubator with 5% CO2. Atthe time of the experiments cells were suspended in HEPES-bufferedsaline (HBS) containing (in mM): 145 NaCl, 10 HEPES, 10 D-glucose, 5KCl, 1 MgSO4, 1 mM CaCl2, pH 7.45. Orai1 and Orai3 cDNA plasmidswere kindly provided by Dr. Trebak and Dr. Romanin, respectively.Cells were transiently transfected with plasmids using the transpasstransfection reagent, and used 1–3 d after transfection as previouslydescribed [25].

2.4. Real time-PCR

RNA was extracted from isolated human platelets using TRIzol®reagent (Invitrogen, Carlsbad, CA) according tomanufacturer's specifica-tions, and 2.5 μg of total RNA was subsequently reverse-transcribed tosingle-strand cDNA using SuperScript® VILO™ cDNA Synthesis Kit

(Invitrogen, Carlsbad, CA). Single-strand cDNA products were directlyused for PCR amplification performedwith an EppendorffMastercycler®thermal cycler (Eppendorf AG, Hamburg-Eppendorf, Germany). PCRreagents such as Taq polymerase and buffers were purchased fromTAKARA (Takara Bio Inc., Otsu, Shiga, Japan). PCR products were obtainedusing the following cycling conditions: 96 °C for 2 min, followed by 35 cy-cles of 96 °C for 15 s, 48–56 °C for 25 s, 72 °C for 30 s, and finished with72 °C for 10 min. Primers listed in Table 1 were used to amplify cDNAtranscripts of human TRPC1, TRPC3, TRPC6, Orai1, Orai2, Orai3, STIM1 andSTIM2 genes. PCR products were separated by electrophoresis in 1.5%agarose gels (Roth, Germany) and the resulting bands were documentedand subsequently isolated from gels using UltraClean® PCR Clean-Up Kit(MO BIO Laboratories Inc., Carlsbad, CA). Amplification of the desiredgenes was confirmed by sequenciation of PCR products (STAB-SAIUex,University of Extremadura, Spain).

1244 A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

2.5. Quantitative RT-PCR

Total RNA isolation and single-strand cDNA synthesis was per-formed in purified platelets as described above. SYBR green qRT-PCRwas performed using SYBR® Premix Ex Taq™ (Takara Bio Inc., Otsu,Shiga, Japan) in an Applied Biosystems STEPONE Real-Time thermalcycler (Life Technologies Corporation, Carlsbad, CA). PCR productswere obtained using the following cycling conditions: 96 °C for 2 min,followed by 35 cycles of 96 °C for 15 s, 48–56 °C for 25 s and finishedwith 72 °C for 10 min. PCR efficiencies were assessed by standardcurve method, obtaining for all primers efficiencies ranging between90 and 100%. mRNA abundance was calculated by comparative CT(ΔΔCT) method using the formula: RQ=2−ΔΔCT [26]. The amount of

Fig. 2. Ca2+ store depletion by treatment with thapsigargin modifies the association of Ora(2×109 cell/mL) were loaded with dimethyl BAPTA and then suspended in a Ca2+-free mindicated and lysed. Whole cell lysates were immunoprecipitated (IP) with the indicatedWestern blotting with specific anti-Orai2, anti-Orai1 or anti-STIM2 antibody (A) or with aimmunoprecipitation for protein loading control. The panel shows results from one experiwere determined using molecular mass markers run in the same gel. Histograms representat resting conditions (control) and TG-treated cells. Results are presented as percentage of

mRNA transcripts were normalized to β-actin expression and repre-sented as (mean expression relative to Orai1±S.E.M; n=3).

2.6. Cell viability

Cell viability was assessed using calcein and trypan blue. For calceinloading, cells were incubated for 30 min with 5 μM calcein-AM at 37 °C,centrifuged and the pellet was resuspended in fresh HBS. Fluorescencewas recorded from 2mL aliquots using a Cary Eclipse Spectrophotometer(Varian Ltd., Madrid, Spain). Samples were excited at 494 nm and theresulting fluorescence was measured at 535 nm. The results obtainedwith calcein were confirmed using the trypan blue exclusion technique.

i1 and Orai2 with Orai3, STIM and TRPC proteins in human platelets. Human plateletsedium (100 μM EGTA added). Cells were then stimulated for 3 min with TG (1 μM) asantibodies and immunoprecipitates were subjected to 10% SDS-PAGE and subsequentnti-Orai2 antibody (B and C). Membranes were reprobed with the antibody used forment representative of four to eleven others. Molecular masses indicated on the rightthe quantification of Orai1 (A) and Orai2 (B and C) association with the tested proteinsthe respective control and expressed as mean±S.E.M. *pb0.05 versus control.

Fig. 3. Ca2+ store depletion reduces the association of Orai3 with TRPC1 and TRPC6 inhuman platelets. Human platelets (2×109 cell/mL) were loaded with dimethyl BAPTAand then suspended in a Ca2+-free medium (100 μM EGTA added). Cells were thenstimulated for 3 min with TG (1 μM) as indicated and lysed. Whole cell lysates wereimmunoprecipitated (IP) with anti-TRPC1, anti-TRPC3 or anti-Orai3, as indicated.Immunoprecipitates were subjected to 10% SDS-PAGE and subsequent Western blottingwith anti-Orai3 or anti-TRPC6 antibody. Membranes were reprobed with the antibodyused for immunoprecipitation for protein loading control. The panel shows results fromone experiment representative of four to six others. Molecular masses indicated on theright were determined using molecular mass markers run in the same gel. Histogramsrepresent the quantification of Orai3 association with the mentioned proteins at rest(control) and TG-treated cells. Results are presented as percentage of the respectivecontrol and expressed as mean±S.E.M. *pb0.05 versus control.

1245A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

2.7. Immunoprecipitation and Western blotting

The immunoprecipitation and Western blotting were performedas described previously [11,27]. Briefly, 500 μL aliquots of plateletsuspension (2×109 cell/mL) were lysed with an equal volume ofRIPA buffer, pH 7.2, containing 316 mM NaCl, 20 mM Tris, 2 mMEGTA, 0.2% SDS, 2% sodium deoxycholate, 2% triton X-100, 2 mMNa3VO4, 2 mM PMSF, 100 μg/mL leupeptin and 10 mM benzamidine.Aliquots of platelet lysates (1 mL) were immunoprecipitated by incu-bation with 2 μg of either anti-Orai1 or anti-TRPC1, 1 μg of anti Orai3,anti STIM1, anti-TRPC3 or anti-TRPC6 antibody and 25 μL of proteinA-agarose overnight at 4 °C on a rocking platform. The immunopre-cipitates were resolved by 10% SDS-PAGE and separated proteinswere electrophoretically transferred onto nitrocellulose membranesfor subsequent probing. Blots were incubated overnight with 10%(w/v) BSA in tris-buffered saline with 0.1% Tween 20 (TBST) toblock residual protein binding sites. Immunodetection of STIM1,STIM2, Orai1, Orai2, Orai3, hTRPC1, hTRPC3 and hTRPC6 was achievedusing the anti-STIM1 antibody or the anti Orai1 antibody diluted1:250 in TBST for 2 h; anti h-TRPC1 or anti-hTRPC6 diluted 1:200 orthe anti-hTRPC3 diluted 1:1000 in TBST for 2 h, respectively; or theanti Orai2 antibody diluted 1:500, the anti Orai3 antibody diluted1:100 or the anti-STIM2 diluted 1:400, gently shaking overnight at4 °C. The primary antibody was removed and blots were washed sixtimes for 5 min each with TBST. To detect the primary antibody,blots were incubated for 45 min with the appropriate horseradishperoxidase-conjugated secondary antibody diluted 1:10,000 in TBSTand then exposed to enhanced chemiluminiscence reagents for4 min. Blots were then exposed to photographic films. The densityof bands on the film was measured using scanning densitometryand analyzed using ImageJ software for gel analysis from NIH. Datawere normalized to the amount of protein recovered by the antibodyused for the immunoprecipitation. Negative controls using rabbit IgGfor immunoprecipitation are shown in Supplemental Fig. 1.

For each antibody-based immunoprecipitation we performed anantibody-free, protein A-agarose only control in order to ensure thatthe proteins immunoprecipitated are not carried through by the aga-rose alone. In addition, for each antibody used in Western blotting aprimary antibody-free control was carried out to confirm that detec-tion is specific and not due to non-specific binding by the secondaryantibody alone (data not shown).

2.8. Measurement of [Ca2+]i (cytosolic free Ca2+ concentration)

Fluorescence was recorded from 2 mL aliquots of magneticallystirred platelet suspension (1×108 cells/mL) at 37 °C using a fluores-cence spectrophotometer with excitation wavelengths of 340 and380 nm and emission at 505 nm. Changes in [Ca2+]i were monitoredusing the fura-2 340/380 fluorescence ratio and calibrated accordingto the method of Grynkiewicz et al. [28].

2.9. Statistical analysis

Analysis of statistical significancewas performed using one-way anal-ysis of variance. For comparison between two groups Student's t-test wasused. pb0.05 was considered to be significant for a difference.

3. Results and discussion

The identification of STIM1 and Orai1 as essential components of thestore-operated current ICRAC marked a milestone in the investigation ofthe biophysical, biochemical and functional aspects of SOCE. Two ubiqui-tously expressedmammalian Orai1 homologs have been described, Orai2and Orai3, as well as one STIM1 homolog, STIM2, whose involvement inSOCE remains unclear. To identify the expression of the different Oraiand STIM isoforms, as well as TRPC1, TRPC3 and TRPC6, we carried out

RT-PCR in platelets isolated from healthy volunteers. Semi-quantitativeRT-PCR showed a single PCR band for Orai(1–3), STIM(1–2) andTRPC(1, 3, 6) indicating significant expression of their mRNA transcriptsin human platelets (Fig. 1A), as observed in previous studies [29–33].Despite the high variability observed in TRPC3 and STIM1 abundancebetween individuals (Fig. 1B), qRT-PCR analysis indicated a predominantexpression of Orai1 and STIM1 mRNA transcripts in human platelets aspreviously observed [29,30,33], followed by TRPC6.

3.1. Ca2+ store depletion induces specific association between Orais,STIMs and TRPC proteins

As reported above using real time-PCR, we have found that humanplatelets have detectable amounts of mRNA for the elementary CRACchannel components Orai1 and STIM1, as well as Orai2, Orai3, STIM2,and the TRPC channels TRPC1, TRPC3 and TRPC6; therefore, platelets arean excellent model for native cells endogenously expressing STIM, Oraiand TRPC proteins in order to investigate their role in capacitative ornon-capacitative Ca2+ entry pathways. We have previously reportedfunctional association of Orai1with STIM1 and the TRPC subfamilymem-bers TRPC1 and TRPC6 in humanplatelets associated to SOCE [34–37].Wetherefore tested for coupling betweenOrai, STIMandTRPCproteins underconditions that stimulated capacitative Ca2+ entry in these cells bylooking for co-immunoprecipitation fromplatelet lysates. Immunoprecip-itation and subsequent SDS/PAGE and Western blotting were conductedusing control platelets and platelets inwhich the intracellular Ca2+ stores

Fig. 4. Treatment OAG does not significantly modify the association of Orai1 and Orai2 with Orai3, STIM and TRPC proteins in human platelets. Human platelets (2×109 cell/mL) weresuspended in a medium containing 1 mM Ca2+ and then stimulated for 3 min with OAG (100 μM) as indicated and lysed. Whole cell lysates were immunoprecipitated (IP) with theindicated antibodies and immunoprecipitates were subjected to 10% SDS-PAGE and subsequent Western blotting with specific anti-Orai2, anti-Orai1 or anti-STIM2 antibody (A) orwith anti-Orai2 antibody (B and C).Membraneswere reprobedwith the antibody used for immunoprecipitation for protein loading control. The panel shows results fromone experimentrepresentative of four to eight others.Molecularmasses indicated on the rightwere determinedusingmolecularmassmarkers run in the same gel. Histograms represent thequantification ofOrai1 (A) and Orai2 (B and C) association with the tested proteins at resting conditions (control) and TG-treated cells. Results are presented as percentage of the respective control andexpressed as mean±S.E.M.

1246 A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

had been depleted by 3 min of pretreatment with TG (1 μM) in theabsence of extracellular Ca2+ (100 μM EGTA added). Platelets heavilyloaded with the intracellular Ca2+-chelator, dimethyl-BAPTA, were usedfor this study so as to eliminate Ca2+-, but not store depletion-, triggeredresponses. Immunoprecipitation with the anti-Orai1 antibody followedby Western blotting revealed the presence of Orai2 and STIM2 in restingplatelets (Fig. 2A, left and right panels), and, similarly, Orai1was detectedin samples from resting platelets immunoprecipitatedwith the anti-Orai3antibody (Fig. 2A, middle panel), indicating association between theseproteins in resting conditions. Co-immunoprecipitation of Orai1 withOrai2 and STIM2 was significantly enhanced by Ca2+ store depletion,

while the coupling between Orai1 and Orai3 was significantly attenuatedby Ca2+ store discharge using TG (Fig. 2A), suggesting a facilitation ofOrai1 association with Orai2 and STIM2 in detriment of Orai3 uponstore depletion.

We have further explored the interactions of Orai2 with other pro-teins upon depletion of the intracellular Ca2+ stores in platelets loadedwith dimethyl BAPTA. Immunoprecipitation and subsequent SDS/PAGEand Western blotting revealed detectable association of Orai2 withOrai3, STIM2 (Fig. 2B), TRPC1, TRPC3 and TRPC6 (Fig. 2C) in restingplatelets. As depicted in Fig. 2B (middle and right panels), immunopre-cipitation with anti-STIM1 and anti-STIM2 antibodies and subsequent

Fig. 5. Treatment with OAG enhances the association of Orai3 with TRPC3 in humanplatelets. Human platelets (2×109 cell/mL) were suspended in a medium containing1 mM Ca2+ and then stimulated for 3 min with OAG (100 μM) as indicated and lysed.Whole cell lysates were immunoprecipitated (IP) with anti-TRPC1, anti-TRPC3 oranti-Orai3, as indicated. Immunoprecipitates were subjected to 10% SDS-PAGE andsubsequent Western blotting with anti-Orai3 or anti-TRPC6 antibody. Membraneswere reprobed with the antibody used for immunoprecipitation for protein loadingcontrol. The panel shows results from one experiment representative of four to sixothers. Molecular masses indicated on the right were determined using molecularmass markers run in the same gel. Histograms represent the quantification of Orai3association with the mentioned proteins at rest (control) and TG-treated cells. Resultsare presented as percentage of the respective control and expressed as mean±S.E.M.*pb0.05 versus control.

1247A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

Western blotting with anti-Orai2 antibody revealed that, in dimethylBAPTA-loaded cells, Ca2+ store depletion resulted in a significant in-crease in the association of Orai2 with both STIM isoforms. Similarly,immunoprecipitation and subsequent Western blotting revealed thatthe association of Orai2 with TRPC1 and TRPC6 was significantly en-hanced by Ca2+ store depletion (Fig. 2C, left and right panels). In con-trast, the association of Orai2 with TRPC3 was unaffected by storedischarge (Fig. 2C, middle lane) and co-immunoprecipitation of Orai2with Orai3 was significantly reduced by Ca2+ store depletion (Fig. 2A,left panel).

In human platelets, a functional involvement of both TRPC1 andTRPC6 in capacitative Ca2+ entry has been reported [32,34,38–40];meanwhile TRPC3 has been classically considered a non-capacitativechannel subunit [40]. In human platelets we have previously reportedthe association of STIM1 with Orai1, TRPC1 and TRPC6 regulated bythe intracellular Ca2+ stores [34,35,37]. In agreement with the conceptthat TRPC3 is a non-capacitative channel in human platelets, we havenow found that Ca2+ store depletion significantly reduced the associa-tion between both STIM1 and STIM2 with TRPC3 (Supplemental Figs. 2and 3C), while no change in the association between STIM proteins andTRPC3 was detected upon stimulation with OAG. We have further ex-plored the interaction between STIM2 and STIM1, TRPC1 and TRPC6specifically induced by Ca2+ store discharge in dimethyl BAPTA-loaded cells. Immunoprecipitation and subsequent Western blottingrevealed that Ca2+ store depletion enhances association of STIM2with STIM1 and TRPC1 (Supplemental Figs. 3A and B), which furthersuggest the involvement of TRPC1 in the capacitative pathway. Wefailed to detect co-immunoprecipitation between STIM2 and TRPC6 in

human platelets either at resting conditions or upon stimulation withTG (data not shown).

In summary, our results indicate that discharge of the intracellularCa2+ stores in platelets loaded with the intracellular chelator dimethylBAPTA, to prevent rises in [Ca2+]i, enhances the association of a signalingcomplex involving STIM1, STIM2, Orai1, Orai2, TRPC1 and TRPC6 (seeFig. 7). We have found that the association of Orai3 with Orai1 or Orai2is reduced upon Ca2+ store discharge; thus suggesting that Orai3might not be involved in the capacitative pathway. To further explorethis possibility we investigated the association of Orai3 with STIM1and STIM2 by co-immunoprecipitation; however, we did not detect as-sociation between Orai3 and STIM proteins either at resting conditionsor after discharge of the intracellular Ca2+ stores (data not shown). Thelack of association of Orai3 with STIM proteins upon Ca2+ store depletionsuggests that Orai3 gating is not regulated by the intracellular Ca2+ storesin humanplatelets. To further explore the role of Orai3 in humanplateletswe have investigated the association of Orai3with TRPC proteins in thesecells. Immunoprecipitation and subsequent Western blotting revealeddetectable association of Orai3 with TRPC1, 3 and 6 in resting platelets(Fig. 3). Co-immunoprecipitation of Orai3with TRPC1 and TRPC6was sig-nificantly reduced by Ca2+ store depletion while the interaction of Orai3with TRPC3was independent of the filling state of the Ca2+ stores (Fig. 3).

3.2. Formation of signaling complexes upon activation ofnon-capacitative Ca2+ entry by OAG

We have further investigated the association of Orai, STIM and TRPCproteins after stimulation of human platelets with 100 μMOAG, the di-acylglycerol (DAG) analog, in the presence of 1 mM extracellular Ca2+,an experimentalmaneuver that has beenwidely shown to activate non-capacitative Ca2+ entry [41]. In human platelets, OAG is unable tomobilize Ca2+ from internal stores but induces rapid Ca2+ entry acrossplasma membrane channels [35]. In the presence of 1 mM extracellularCa2+, co-immunoprecipitation of Orai, STIM and TRPC proteins at rest-ing conditions was similar to that found in dimethyl BAPTA-loadedplatelets suspended in a Ca2+-free medium (Figs. 4 and 5 vs. Figs. 2and 3). Treatment of human platelets with OAG did not alter the co-immunoprecipitation of Orai1 with Orai2, Orai3, and STIM2 (Fig. 4A)or the association of Orai2 with Orai3, STIM proteins, TRPC1, TRPC3and TRPC6 (Fig. 4B and C), indicating that non-capacitative Ca2+ entrydoes not require further association between these proteins.

Interestingly, OAG significantly enhanced the association betweenOrai3 and the non-capacitative channel TRPC3, while the interactionof Orai3 with TRPC1 or TRPC6 was unaffected by this treatment(Fig. 5). Altogether, our observations suggest that Orai3 might func-tion as a non-capacitative channel in human platelets. This suggestionis based on the following findings: 1) store depletion evokes dissoci-ation of Orai3 from Orai1, Orai2, TRPC1 and TRPC6; 2) platelet treat-ment with the DAG analog OAG results in association of Orai3 withthe non-capacitative channel TRPC3 and 3) the lack of association ofOrai3 with STIM1 or STIM2 either in resting conditions or after stim-ulation with TG or OAG.

We have further investigated the possible role of Orai3 in non-capacitative Ca2+ entry in HEK-293 cells overexpressing Orai3 channels.Our results indicate that in Orai3-expressing cell treatment with 100 μMOAG, in the presence of 1 mM extracellular Ca2+, resulted in a signifi-cantly greater Ca2+ entry than in wild type cells (pb0.05; Fig. 6A andB); while TG-induced Ca2+ entry was not significantly affected byOrai3 overexpression (data not shown).

Since Orai3 has been reported to participate in the arachidonicacid (AA) activated ARC channels [42], and AA has been reported tomobilize Ca2+ in human platelets [43], we explored the role of Orai3 inAA-mediated Ca2+ influx. As reported in Fig. 6C, treatment of humanplatelets with 8 μM AA in a Ca2+-free medium resulted in a transientrise in [Ca2+]i due to Ca2+ release from the intracellular stores, subse-quent addition of Ca2+ to the extracellular medium resulted in Ca2+

Fig. 6. Orai3might be involved in arachidonic acid-mediated non-capacitative Ca2+ entry. (A)Western blottingwith anti-Orai3 antibodyof lysates fromwild typeHEK-293 cells (WT) andHEK-293 cells overexpressing Orai3 (Orai3). (B) Fura-2-loadedwild type (WT) or Orai3-overexpressing HEK-293 cells (Orai3) were suspended in a medium containing 1 mM CaCl2 andstimulated with 100 μM OAG. (C) Fura-2-loaded human platelets (1×108 cell/mL) were stimulated either with arachidonic acid (AA; 8 μM) in a Ca2+-free medium (100 μM EGTA wasadded) followed by addition of CaCl2 (final concentration 1 mM) two and a half minutes later to initiate Ca2+ entry. (D) Platelets were stimulated with 1 μM TG+50 nM ionomycinin the presence of 1 mMextracellular Ca2+ and 2 min later 8 μMAAwas added to the platelet suspension. Changes in [Ca2+]i weremonitored as described inMaterial andmethods. Tracesare representative offive separate experiments. (E) Human platelets (2×109 cell/mL) were suspended in amedium containing 1 mMCa2+ and then stimulated for 3 minwith AA (8 μM)and lysed. Whole cell lysates were immunoprecipitated (IP) with anti-Orai3 antibody, as indicated. Immunoprecipitates were subjected to 10% SDS-PAGE and subsequent Westernblotting with anti-Orai1 antibody. Membranes were reprobedwith the antibody used for immunoprecipitation for protein loading control. The panel shows results from one experimentrepresentative of four others. Molecular masses indicated on the right were determined using molecular mass markers run in the same gel. Histograms represent the quantification ofOrai1–Orai3 association at rest (control) and AA-treated cells. Results are presented as percentage of the respective control and expressed as mean±S.E.M. *pb0.05 versus control.(F) Fura-2-loaded wild type (WT) or Orai3 and Orai1-overexpressing HEK-293 cells (Orai1/3) were suspended in a Ca2+-free medium and stimulated with arachidonic acid(AA; 8 μM) followed by addition of CaCl2 (final concentration 1 mM) two and a half minutes later to initiate Ca2+ entry. Changes in [Ca2+]i were monitored as described in Materialand methods. Traces are representative of four separate experiments. (G) Western blotting with anti-Orai3 (top panel) or anti-Orai1 (bottom panel) antibody of lysates from wildtype HEK-293 cells (WT) and HEK-293 cells overexpressing Orai3 and Orai1 (Orai1/3).

1248 A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

Fig. 7. Speculative model for the formation of Ca2+ influx complexes regulated by Ca2+ store depletion or second messengers in human platelets. Left, in cells with depleted Ca2+

stores, STIM1 and STIM2 localized in the membrane of the Ca2+ stores [11,37] associate with Orai1, Orai2 and TRPC channels, including TRPC1 and TRPC6, in a Ca2+-independentmanner, on order to initiate Ca2+ entry regulated by the intracellular stores or capacitative Ca2+ influx. Right, cell activation by agonists is often followed by the generation ofdiacylglycerol (DAG; OAG is a DAG analog) which activates the association of Orai3 with TRPC3 independent of the filling state of the intracellular Ca2+ stores, where Orai3might be an important element of the non-capacitative pathway for Ca2+ influx in human platelets.

1249A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

influx. To confirm the activation of non-capacitative Ca2+ entry by AA,cells were treated in the presence of 1 mM external Ca2+ with 1 μM TGcombined with 50 nM ionomycin, to induce extensive and permanentdepletion of the intracellular stores [44]. Once [Ca2+]i reached a plateauaddition of AA to the platelet suspension resulted in a further increase in[Ca2+]i indicative of the activation of non-capacitative Ca2+ entry(Fig. 6D). Since ARC channels, which consist of Orai1 and Orai3 subunits,have been reported to conduct AA-induced Ca2+ entry in other cells [45],we have further investigated whether AA stimulates Orai1 and Orai3 as-sociation in humanplatelets. As shown in Fig. 6E, our results indicate thatstimulation with AA significantly enhances association of Orai1 andOrai3 in human platelets (pb0.05). Furthermore, we have found thatco-expression of Orai1 andOrai3 inHEK-293 cells results in enhanced ar-achidonic acid-induced Ca2+ entry (Fig. 6F and G). Although furtherelectrophysiological and biophysical studies are necessary to demon-strate the presence of ARC channels in human platelets, our findings sug-gest that, in agreement with previous studies [45,46], there is aninterplay between Orai3 subunits and AA in these cells.

The contribution of Orai3, as well as that of STIM2 and Orai2, tocapacitative or non-capacitative Ca2+ entry in native cells remainsunclear. In cultured myoblasts derived from human muscle biopsiessilencing of STIM1, Orai1 and Orai3 has been reported to attenuatecapacitative Ca2+ influx, while Orai2 knockdown was without effect[20]. By contrast, in vascular smooth muscle cells from rat aorta si-lencing of STIM1 and Orai1, but not that of Orai2 and Orai3, markedlyreduced capacitative Ca2+ entry [19], and similar observations havebeen reported in primary cultured proliferating human aortic smoothmuscle cells [47]. In addition, co-expression of Orai1 and Orai2 withSTIM1 significantly enhanced ICRAC, while Orai3 failed to reproducethis current [7,48]. Furthermore, co-expression of STIM1 with themurine orthologs of Orai2 had a minor effect on capacitative Ca2+

entry, and similar results were observed with Orai3, while co-expression with the murine ortholog of Orai1 markedly increasedcapacitative Ca2+ influx [23]. Co-expression of Orai2 with STIM1 hasbeen reported to amplify ICRAC in HEK293 but not in RBL 2H3 cells,while Orai1 has been found to enhance ICRAC in both cell lines underthe same experimental maneuver [49]. A role for Orai3 in ICRAC hasbeen reported in estrogen receptor-positive breast cancer cell linesmediated by STIM1 and STIM2 [50]. Altogether these findings suggestthat, while in exogenous expression systems Orai2 plays a role incapacitative Ca2+ influx and Orai3 fails to reproduce this current,the ability of Orai2 and Orai3 to form capacitative channels in nativecells strongly depends on the cell background.

In human platelets, our results indicate that Ca2+ store depletionresults in the formation of a macromolecular complex possibly regu-lated by STIM1 and STIM2 proteins. The present and previous obser-vations reported by us under the same conditions [34] indicate thatSTIM1, but not STIM2, associates with TRPC6 upon store depletion,thus suggesting that both STIM isoforms might finely regulate specificsignals activated by depletion of discrete intracellular Ca2+ compart-ments and where the participation of different Ca2+-permeable chan-nel subunits, including Orai and TRPC isoforms, for the conduction ofSOCE might provide the cell with a battery of possibilities for a rangeof Ca2+ signals, from Ca2+ selective to non-selective cationic cur-rents. In summary, our results provide the first evidence for the par-ticipation of Orai2 and STIM2 in the store-operated macromolecularcomplex that mediates SOCE in human platelets, as well as suggesta non-capacitative role for Orai3 in these cells probably participatingin a DAG-regulated channel involving TRPC3 (Fig. 7). The rationale ofthe presence of different channels to conduct Ca2+ entry, probablyassociated or independent on lipid rafts as previously reported [1,2],might be explained by the variety of Ca2+ signals generated by

1250 A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

different agonists or distinct agonist concentrations. It is important tomention that human platelets contain two distinct intracellular Ca2+

stores, expressing STIM1 and STIM2 [3], that activate store-operatedCa2+ entry by different mechanisms [4]. Platelet agonists have beenshown to induce Ca2+ release exclusively from the dense tubular sys-tem, such as ADP or AVP, or from the dense tubular system and theacidic stores, in the case of thrombin and depending on the agonistconcentration [5].

Acknowledgements

This research was supported by the MICINN grant BFU2010-21043-C02-01 and Junta de Extremadura-FEDER grant GR10010.Alejandro Berna-Erro is supported by the University of Extremadura(D01). We thank I. Jardín for the design of Fig. 7 and A. Gallardo-Soler por technical assistance.

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.bbamcr.2012.05.023.

References

[1] S.O. Sage, Three routes for receptor-mediated Ca2+ entry, Curr. Biol. 2 (1992)312–314.

[2] S.L. Zhang, Y. Yu, J. Roos, J.A. Kozak, T.J. Deerinck, M.H. Ellisman, K.A. Stauderman,M.D. Cahalan, STIM1 is a Ca2+ sensor that activates CRAC channels and migratesfrom the Ca2+ store to the plasma membrane, Nature 437 (2005) 902–905.

[3] A.B. Parekh, J.W. Putney Jr., Store-operated calcium channels, Physiol. Rev. 85(2005) 757–810.

[4] S. Feske, Y. Gwack, M. Prakriya, S. Srikanth, S.H. Puppel, B. Tanasa, P.G. Hogan, R.S.Lewis, M. Daly, A. Rao, A mutation in Orai1 causes immune deficiency by abrogat-ing CRAC channel function, Nature 441 (2006) 179–185.

[5] M. Vig, C. Peinelt, A. Beck, D.L. Koomoa, D. Rabah, M. Koblan-Huberson, S. Kraft, H.Turner, A. Fleig, R. Penner, J.P. Kinet, CRACM1 is a plasma membrane protein es-sential for store-operated Ca2+ entry, Science 312 (2006) 1220–1223.

[6] J. Soboloff, M.A. Spassova, X.D. Tang, T. Hewavitharana, W. Xu, D.L. Gill, Orai1 andSTIM reconstitute store-operated calcium channel function, J. Biol. Chem. 281(2006) 20661–20665.

[7] J.C. Mercer, W.I. Dehaven, J.T. Smyth, B. Wedel, R.R. Boyles, G.S. Bird, J.W. PutneyJr., Large store-operated calcium selective currents due to co-expression of Orai1or Orai2 with the intracellular calcium sensor, Stim1, J. Biol. Chem. 281 (2006)24979–24990.

[8] S.J. Roberts-Thomson, A.A. Peters, D.M. Grice, G.R. Monteith, ORAI-mediated calci-um entry: mechanism and roles, diseases and pharmacology, Pharmacol. Ther.127 (2010) 121–130.

[9] J. Liou, M.L. Kim, W.D. Heo, J.T. Jones, J.W. Myers, J.E. Ferrell Jr., T. Meyer, STIM is aCa2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx, Curr. Biol.15 (2005) 1235–1241.

[10] J. Soboloff, M.A. Spassova, T. Hewavitharana, L.P. He, W. Xu, L.S. Johnstone, M.A.Dziadek, D.L. Gill, STIM2 is an inhibitor of STIM1-mediated store-operated Ca2+

entry, Curr. Biol. 16 (2006) 1465–1470.[11] H. Zbidi, I. Jardin, G.E. Woodard, J.J. Lopez, A. Berna-Erro, G.M. Salido, J.A. Rosado,

STIM1 and STIM2 Are located in the acidic Ca2+ stores and associates with Orai1upon depletion of the acidic stores in human platelets, J. Biol. Chem. 286 (2011)12257–12270.

[12] I. Jardin, J.J. Lopez, P.C. Redondo, G.M. Salido, J.A. Rosado, Store-operated Ca2+

entry is sensitive to the extracellular Ca2+ concentration through plasma mem-brane STIM1, Biochim. Biophys. Acta 1793 (2009) 1614–1622.

[13] O. Brandman, J. Liou, W.S. Park, T. Meyer, STIM2 is a feedback regulator that sta-bilizes basal cytosolic and endoplasmic reticulum Ca2+ levels, Cell 131 (2007)1327–1339.

[14] S. Parvez, A. Beck, C. Peinelt, J. Soboloff, A. Lis, M. Monteilh-Zoller, D.L. Gill, A.Fleig, R. Penner, STIM2 protein mediates distinct store-dependent and store-independent modes of CRAC channel activation, FASEB J. 22 (2008) 752–761.

[15] M.K. Schuhmann, D. Stegner, A. Berna-Erro, S. Bittner, A. Braun, C. Kleinschnitz, G.Stoll, H. Wiendl, S.G. Meuth, B. Nieswandt, Stromal interaction molecules 1 and 2are key regulators of autoreactive T cell activation in murine autoimmune centralnervous system inflammation, J. Immunol. 184 (2010) 1536–1542.

[16] M. Matsumoto, Y. Fujii, A. Baba, M. Hikida, T. Kurosaki, Y. Baba, The calcium sen-sors STIM1 and STIM2 control B cell regulatory function through interleukin-10production, Immunity 34 (2011) 703–714.

[17] S. Cordeiro, O. Strauss, Expression of Orai genes and I(CRAC) activation in thehuman retinal pigment epithelium, Graefes Arch. Clin. Exp. Ophthalmol. 249(2011) 47–54.

[18] Y. Gwack, S. Srikanth, S. Feske, F. Cruz-Guilloty, M. Oh-hora, D.S. Neems, P.G.Hogan, A. Rao, Biochemical and functional characterization of Orai proteins, J.Biol. Chem. 282 (2007) 16232–16243.

[19] M. Potier, J.C. Gonzalez, R.K. Motiani, I.F. Abdullaev, J.M. Bisaillon, H.A. Singer, M.Trebak, Evidence for STIM1- and Orai1-dependent store-operated calcium influxthrough ICRAC in vascular smooth muscle cells: role in proliferation and migration,FASEB J. 23 (2009) 2425–2437.

[20] B. Darbellay, S. Arnaudeau, S. Konig, H. Jousset, C. Bader, N. Demaurex, L.Bernheim, STIM1- and Orai1-dependent store-operated calcium entry regulateshuman myoblast differentiation, J. Biol. Chem. 284 (2009) 5370–5380.

[21] J.M. Bisaillon, R.K. Motiani, J.C. Gonzalez-Cobos, M. Potier, K.E. Halligan, W.F.Alzawahra, M. Barroso, H.A. Singer, D. Jourd'heuil, M. Trebak, Essential role forSTIM1/Orai1-mediated calcium influx in PDGF-induced smooth muscle migra-tion, Am. J. Phys. Cell Phys. 298 (2010) C993–C1005.

[22] A. Lis, C. Peinelt, A. Beck, S. Parvez, M. Monteilh-Zoller, A. Fleig, R. Penner,CRACM1, CRACM2, and CRACM3 are store-operated Ca2+ channels with distinctfunctional properties, Curr. Biol. 17 (2007) 794–800.

[23] Y. Takahashi, M. Murakami, H. Watanabe, H. Hasegawa, T. Ohba, Y. Munehisa, K.Nobori, K. Ono, T. Iijima, H. Ito, Essential role of the N-terminus of murine Orai1in store-operated Ca2+ entry, Biochem. Biophys. Res. Commun. 356 (2007)45–52.

[24] J.J. Lopez, G.M. Salido, E. Gomez-Arteta, J.A. Rosado, J.A. Pariente, Thrombininduces apoptotic events through the generation of reactive oxygen species inhuman platelets, J. Thromb. Haemost. 5 (2007) 1283–1291.

[25] N. Dionisio, L. Albarran, J.J. Lopez, A. Berna-Erro, G.M. Salido, R. Bobe, J.A. Rosado,Acidic NAADP-releasable Ca(2+) compartments in the megakaryoblastic cell lineMEG01, Biochim. Biophys. Acta 1813 (2011) 1483–1494.

[26] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(−delta delta C(T)) method, Methods 25(2001) 402–408.

[27] P.C. Redondo, M.T. Harper, J.A. Rosado, S.O. Sage, A role for cofilin in the activationof store-operated calcium entry by de novo conformational coupling in humanplatelets, Blood 107 (2006) 973–979.

[28] G. Grynkiewicz, M. Poenie, R.Y. Tsien, A new generation of Ca2+ indicatorswith greatly improved fluorescence properties, J. Biol. Chem. 260 (1985)3440–3450.

[29] W. Bergmeier, M. Oh-Hora, C.A. McCarl, R.C. Roden, P.F. Bray, S. Feske, R93Wmutation in Orai1 causes impaired calcium influx in platelets, Blood 113 (2009)675–678.

[30] A. Braun, D. Varga-Szabo, C. Kleinschnitz, I. Pleines, M. Bender, M. Austinat,M. Bosl, G. Stoll, B. Nieswandt, Orai1 (CRACM1) is the platelet SOC channeland essential for pathological thrombus formation, Blood 113 (2009)2056–2063.

[31] E. den Dekker, D.G. Molin, G. Breikers, R. van Oerle, J.W. Akkerman, G.J. van Eys,J.W. Heemskerk, Expression of transient receptor potential mRNA isoforms andCa2+ influx in differentiating human stem cells and platelets, Biochim. Biophys.Acta 1539 (2001) 243–255.

[32] S.R. Hassock, M.X. Zhu, C. Trost, V. Flockerzi, K.S. Authi, Expression and role ofTRPC proteins in human platelets: evidence that TRPC6 forms the store-independent calcium entry channel, Blood 100 (2002) 2801–2811.

[33] D. Varga-Szabo, A. Braun, C. Kleinschnitz, M. Bender, I. Pleines, M. Pham, T.Renne, G. Stoll, B. Nieswandt, The calcium sensor STIM1 is an essential media-tor of arterial thrombosis and ischemic brain infarction, J. Exp. Med. 205 (2008)1583–1591.

[34] I. Jardin, L.J. Gomez, G.M. Salido, J.A. Rosado, Dynamic interaction of hTRPC6 withthe Orai1/STIM1 complex or hTRPC3 mediates its role in capacitative or non-capacitative Ca2+ entry pathways, Biochem. J. 420 (2009) 267–276.

[35] I. Jardin, J.J. Lopez, G.M. Salido, J.A. Rosado, Orai1 mediates the interactionbetween STIM1 and hTRPC1 and regulates the mode of activation of hTRPC1-forming Ca2+ channels, J. Biol. Chem. 283 (2008) 25296–25304.

[36] I. Jardin, G.M. Salido, J.A. Rosado, Role of lipid rafts in the interaction betweenhTRPC1, Orai1 and STIM1, Channels (Austin) 2 (2008) 401–403.

[37] J.J. Lopez, G.M. Salido, J.A. Pariente, J.A. Rosado, Interaction of STIM1 with endog-enously expressed human canonical TRP1 upon depletion of intracellular Ca2+

stores, J. Biol. Chem. 281 (2006) 28254–28264.[38] I. Jardin, J.J. Lopez, G.M. Salido, J.A. Rosado, Functional relevance of the de novo

coupling between hTRPC1 and type II IP3 receptor in store-operated Ca2+ entryin human platelets, Cell. Signal. 20 (2008) 737–747.

[39] J.A. Rosado, S.L. Brownlow, S.O. Sage, Endogenously expressed Trp1 is involved instore-mediated Ca2+ entry by conformational coupling in human platelets, J. Biol.Chem. 277 (2002) 42157–42163.

[40] S.L. Brownlow, S.O. Sage, Transient receptor potential protein subunit assemblyand membrane distribution in human platelets, Thromb. Haemost. 94 (2005)839–845.

[41] I. Jardin, P.C. Redondo, G.M. Salido, J.A. Rosado, Phosphatidylinositol 4,5-bisphosphate enhances store-operated calcium entry through hTRPC6 channelin human platelets, Biochim. Biophys. Acta 1783 (2008) 84–97.

[42] T.J. Shuttleworth, Arachidonic acid, ARC channels, and Orai proteins, Cell Calcium45 (2009) 602–610.

[43] M.T. Alonso, A. Sanchez, J. Garcia-Sancho, Arachidonic acid-induced calcium influx inhuman platelets, comparison with the effect of thrombin, Biochem. J. 272 (1990)435–443.

[44] J.A. Rosado, S.O. Sage, Phosphoinositides are required for store-mediated calciumentry in human platelets, J. Biol. Chem. 275 (2000) 9110–9113.

[45] T.J. Shuttleworth, J.L. Thompson, O. Mignen, STIM1 and the noncapacitative ARCchannels, Cell Calcium 42 (2007) 183–191.

1251A. Berna-Erro et al. / Biochimica et Biophysica Acta 1823 (2012) 1242–1251

[46] O. Mignen, J.L. Thompson, T.J. Shuttleworth, Both Orai1 and Orai3 are essentialcomponents of the arachidonate-regulated Ca2+‐selective (ARC) channels,J. Physiol. 586 (2008) 185–195.

[47] S.G. Baryshnikov, M.V. Pulina, A. Zulian, C.I. Linde, V.A. Golovina, Orai1, a criticalcomponent of store-operated Ca2+ entry, is functionally associated withNa+/Ca2+ exchanger and plasma membrane Ca2+ pump in proliferating humanarterial myocytes, Am. J. Phys. Cell Phys. 297 (2009) C1103–C1112.

[48] W.I. DeHaven, J.T. Smyth, R.R. Boyles, J.W. Putney Jr., Calcium inhibition and cal-cium potentiation of Orai1, Orai2, and Orai3 calcium release-activated calciumchannels, J. Biol. Chem. 282 (2007) 17548–17556.

[49] S.A. Gross, U. Wissenbach, S.E. Philipp, M. Freichel, A. Cavalie, V. Flockerzi, MurineORAI2 splice variants form functional Ca2+ release-activated Ca2+ (CRAC) chan-nels, J. Biol. Chem. 282 (2007) 19375–19384.

[50] R.K. Motiani, I.F. Abdullaev, M. Trebak, A novel native store-operated calciumchannel encoded by Orai3: selective requirement of Orai3 versus Orai1 in estro-gen receptor-positive versus estrogen receptor-negative breast cancer cells,J. Biol. Chem. 285 (2010) 19173–19183.

[51] Y. Takahashi, H. Watanabe, M. Murakami, T. Ohba, M. Radovanovic, K. Ono, T.Iijima, H. Ito, Involvement of transient receptor potential canonical 1 (TRPC1) inangiotensin II-induced vascular smooth muscle cell hypertrophy, Atherosclerosis195 (2007) 287–296.

[52] S. Antoniotti, A. Fiorio Pla, S. Barral, O. Scalabrino, L. Munaron, D. Lovisolo, Inter-action between TRPC channel subunits in endothelial cells, J. Recept. Signal Trans-duct. Res. 26 (2006) 225–240.

[53] M.I. Lioudyno, J.A. Kozak, A. Penna, O. Safrina, S.L. Zhang, D. Sen, J. Roos, K.A.Stauderman, M.D. Cahalan, Orai1 and STIM1 move to the immunological synapseand are up-regulated during T cell activation, Proc. Natl. Acad. Sci. U. S. A. 105 (2008)2011–2016.

[54] S. Brechard, S. Plancon, C. Melchior, E.J. Tschirhart, STIM1 but not STIM2 is anessential regulator of Ca2+ influx-mediated NADPH oxidase activity in neutrophil-like HL-60 cells, Biochem. Pharmacol. 78 (2009) 504–513.

[55] J. Sun, A. Feng, Y. Zhang, S. Sun, W. Hu, M. Yang, F. Wei, X. Qu, Fucoidan increasesTNF-alpha-induced MMP-9 secretion in monocytic cell line U937, Inflamm. Res.59 (2010) 271–276.