GAC1, a gene encoding a putative GTPase-activating protein, regulates bikaverinbiosynthesis in Fusarium verticillioides

Yoon-E ChoiDepartment of Plant Pathology and Microbiology, TheProgram for the Biology of Filamentous Fungi, TexasA&M University, College Station, Texas 77843-2132

Jillian A. BrownCourtney B. WilliamsLorena L. Canales

Bioenvironmental Sciences Program, Department ofPlant Pathology and Microbiology, Texas A&MUniversity, College Station, Texas 77843-2132

Won-Bo Shim1

Department of Plant Pathology and Microbiology, TheProgram for the Biology of Filamentous Fungi, TexasA&M University, College Station, Texas 77843-2132

Abstract: Fusarium verticillioides (teleomorph Gibber-ella moniliformis) is an ascomycete known to producea variety of secondary metabolites, including fumoni-sins, fusaric acid and bikaverin. These metabolites aresynthesized when the fungus is under stress, notablynutrient limitations. To date we have limited under-standing of the complex regulatory process associatedwith fungal secondary metabolism. In this study wegenerated a collection of F. verticillioides mutants byusing REMI (restriction enzyme mediated integra-tion) mutagenesis and in the process identified astrain, R647, that carries a mutation in a genedesignated GAC1. Mutation in the GAC1 locus, whichencodes a putative GTPase activating protein, result-ed in the increased production of bikaverin, suggest-ing that GAC1 is negatively associated with bikaverinbiosynthesis. Complementation of R647 with the wild-type GAC1 gene restored the bikaverin productionlevel to that of the wild-type progenitor, demonstrat-ing that gac1 mutation was directly responsible for theoverproduction of bikaverin. We also demonstratedthat AREA, encoding global nitrogen regulator, andPKS4, encoding polyketide synthase, are downstreamgenes that respectively are regulated positively andnegatively by GAC1. Our results suggest that GAC1plays an important role in signal transductionregulating bikaverin production in F. verticillioides.

Key words: restriction enzyme mediated inte-gration, secondary metabolism, signal transduction

INTRODUCTION

Fungi produce a wide variety of secondary metabo-lites, which are often complex in chemical structure.Some of the well characterized fungal secondarymetabolites, such as growth regulators, antibiotics andmycotoxins, are known to affect plant and animalcellular functions (Yu and Keller 2005). While it isclear that these secondary metabolites are of greatimportance to humans, the biological role of vastmajority of fungal secondary metabolites is unknown(Calvo et al 2002, Yu and Keller 2005). Furthermorethe complex process in which these metabolites aresynthesized in fungi is understood poorly. It isperceived generally that ambient environmentalfactors (e.g. nitrogen stress, carbon stress and pHconditions) trigger secondary metabolite biosynthesisin fungi (Sagaram et al 2006b). However ourunderstanding of fungal secondary metabolism,particularly when coupled with fungal developmentalprocesses, is far from complete.

The ascomycete Fusarium verticillioides (Sacc.)Nirenburg (teleomorph Gibberella moniliformis Wine-land) has been the topic of extensive research due toits ability to produce mycotoxin fumonisin B1 (FB1)on corn. FB1 is a potent carcinogen, and ingestion offumonisin-contaminated corn by humans and ani-mals has been linked to a variety of illnesses,including leukoencephalomalasia and neural tubedefects (Gelderblom et al 1988, Marasas 2001,Minorsky 2002, Missmer et al 2006). However F.verticillioides secondary metabolites are not limited toFB1 and also include a wide variety of othermycotoxins and pigments (Bacon et al 2004, Nelsonet al 1993). Although recent studies have revealedsome of the regulatory mechanisms associated withFB1 biosynthesis, little is known about the biosynthet-ic processes of other secondary metabolites in F.verticillioides.

One of the pigments produced by F. verticillioides isbikaverin, which mainly is responsible for the redcolor that is produced in the cultures of severalFusarium species under select conditions (Linne-mannstons et al 2002). Bikaverin is a polyketide withantiprotozoal and antifungal activities (Linnemann-stons et al 2002). Giordano et al (1999) showed thatspecific conditions, such as nitrogen depletion andacidic pH, are required for bikaverin production. InF. fujikuroi the polyketide synthase (PKS) Pks4 is a keyenzyme necessary for bikaverin production, and that

Accepted for publication 23 May 2008.1 Corresponding author. E-mail: wbshim@tamu.edu

Mycologia, 100(5), 2008, pp. 701–709. DOI: 10.3852/08-015# 2008 by The Mycological Society of America, Lawrence, KS 66044-8897

701

PKS4 gene expression is negatively associated with theglobal nitrogen regulator AreA (Linnemannstons etal 2002). F. verticillioides harbors 15 type-I PKS genes(Kroken et al 2003), one of which is PKS4 that isinvolved in bikaverin production (Proctor et al 2006).However no further information is available regard-ing the regulatory mechanism associated with bika-verin biosynthesis in Fusarium species.

In this study we employed REMI (restrictionenzyme mediated integration) approach to explorethe genes associated with F. verticillioides secondarymetabolism. REMI is an attractive molecular geneticstool for investigating gene function in filamentousfungi and lower eukaryotes (Kahmann and Basse1999, Maier and Shafer 1999). The ascomycete F.verticillioides spends most of its life as a haploid, whichmakes it feasible for generating null mutants viaREMI approach. For example FCC1, one of the keyregulatory genes for FB1 biosynthesis, initially wasidentified by screening REMI mutants altered in FB1

production (Shim and Woloshuk 2001). Here wedescribe the isolation of a REMI mutant strain R647,which exhibits increased bikaverin production. Weshow that a single gene, designated GAC1, is directlyresponsible for this phenotype. We also demonstratethat transcriptional levels of AREA and PKS4 respec-tively are positively and negatively affected by GAC1mutation.

MATERIALS AND METHODS

Fungal strain and culture media.—Fusarium verticillioidesstrain 7600 (Fungal Genetics Stock Center, University ofMissouri, Kansas City, Missouri) was stored in 20% glycerinat 280 C. Conidia were produced for inocula by growingthe fungus on V8 juice agar (200 mL V8 juice per L, 3 gCaCO3 per L and 20 g agar per L) at 25 C. For genomicDNA extraction the fungus was grown in YPD medium(Difco, Detroit, Michigan) on a rotary shaker (150 rpm).For RNA isolation the fungus was grown in defined liquid(DL) medium, pH 6.0 (Shim and Woloshuk 1999). Themedium (100 mL) was inoculated with 1 3 105 conidia andincubated at 25 C, shaking at 150 rpm, under a 14 h light/10 h dark cycle. To test for bikaverin production the funguswas grown on diluted (0.23) potato dextrose agar (PDA)(Difco). For RNA isolation fungal strains were grown onplates filled with 0.23 potato dextrose broth (PBD) (Difco)without shaking.

Nucleic acid isolation and manipulation.—Bacterial plasmidDNA and fungal genomic DNA were extracted respectivelywith the Wizard Miniprep DNA Purification System (Pro-mega, Madison, Wisconsin) and the OmniPrep GenomicDNA Extraction Kit (G Biosciences, St Louis, Missouri).Total RNA for quantitative real-time (qRT)-PCR andnorthern analysis was prepared with Trizol reagent (Invitro-gen, Carlsbad, California) or the RNeasy Plant Mini Kit(QIAGEN, Valencia, California). Southern and northern

analyses were performed as described by Sagaram et al(2006a) and Sambrook and Russell (2001). The probesused in all hybridization experiments were 32P-labeled withthe Prime-It Random Primer Labeling Kit (Stratagene, LaJolla, California).

PCR and quantitative real-time (qRT)-PCR.—All primersused in this study are listed (TABLE I). PCR amplificationswere performed in a GeneAmp PCR System 9700 thermo-cycler (PE Applied Biosystems, Norwalk, Connecticut). PCRof DNA (except single-joint PCR) was performed in 25 mLtotal volumes with Taq DNA polymerase (Promega). ThePCR conditions were 2 min predenaturation at 94 Cfollowed by 30 cycles of 45 s denaturation at 94 C, 45 sannealing at 54–57 C and 2 min extension at 72 C, unlessspecified otherwise. PCR reactions for amplicons largerthan 2 kb were performed with expand long polymerase(Roche, Indianapolis, Indiana) using the manufacturer’ssuggested protocol.

qRT-PCR analyses were performed in a Cepheid SmartCycler System (Cepheid, Sunnyvale, California) with theQuantiTect SYBR Green RT-PCR kit (QIAGEN). Concen-trations of RNA samples were adjusted to 100 ng per mLbefore qRT-PCR. qRT-PCR amplifications were carried outwith 30 min reverse transcription at 50 C followed by15 min predenaturation at 95 C and 35 cycles of 15 sdenaturation at 95 C, 30 s annealing at 55 C and 30 sextension at 72 C. The expression of F. verticillioides b-tubulin gene (TUB2) (GenBank U27303) was used as areference.

F. verticillioides transformation.—F. verticillioides proto-plasts were generated with the protocol described by Shimand Woloshuk (2001), except that Mureinase (2 mg permL) was replaced with Drieselase (5 mg per mL) (Sigma, StLouis, Missouri). Mutations were performed with REMIstrategy (Shim and Woloshuk 2001). The pBP15 vector,which contains a hygromycin phosphotransferase (HPH)gene as a selectable marker, was linearized with HindIIIbefore protoplast transformation (FIG. 1A). Hygromycin-resistant transformants were selected on regeneration agarmedium amended with hygromycin (150 mg per mL) andscreened for pigmentation, FB1 production, maize stalk rotand ear rot severity as described by Sagaram et al (2007) andShim and Woloshuk (2001). For Southern analysis fungalgenomic DNA samples were digested with EcoRV beforebeing subjected to electrophoresis in a 1% agarose gel. A 2-kb DNA fragment of the pBP15 vector, which harbors HPH,was amplified by M-13 forward and reverse primers and was32P-labeled as a probe (FIG. 1A).

To identify the location of pBP15 integration plasmidrescue strategy was used as described by Shim and Woloshuk(2001). Genomic DNA of REMI isolate R647 was extractedand digested with EcoRI (FIG. 1A). Self-ligation reactionssubsequently were performed and cloned into Top10chemically competent cells (Invitrogen). Sequences wereretrieved with M-13 forward and reverse primers. DNAsequencing was performed at Gene Technologies Lab,Texas A&M University (College Station, Texas).

REMI isolate R647 was complemented with a wild-typeGAC1 gene fused to a geneticin-resistance gene (GEN). The

702 MYCOLOGIA

complementation construct GCV1 was made via a single-joint PCR strategy (Sagaram et al 2006a, Yu et al 2004).Primers GAC-com-F1 and GAC-com-R1 were used to amplifyfull-length GAC1 plus a 1.17-kb 59 untranslated region(UTR) and a 640-bp 39 UTR, and the GEN marker wasprepared as described by Sagaram et al (2006a). Ampliconssubsequently were mixed in a single tube and were joined byPCR. The final GCV1 construct, amplified with primersGene-F and GAC-com-R2 using expand long polymerase(Roche), was transformed into R647 protoplasts andscreened for colonies resistant to geneticin and hygromycin(Sagaram et al 2006a). The introduction of GCV1 ingeneticin-resistant strains was verified by PCR analyses.Northern analysis also was used for verifying GAC1mutation and complementation. A 280-bp GAC1 DNA

TABLE I. All Primers used in this study

Number Name Primer sequence (59–39)

1 CSP1-F GAA TAT ACT TGG CGA TAG CTT CTT GCT C2 CSP1-R CAG ATC GCT CAA CTT CTT GAC G3 ACG1-F CCC GAC TAC AAT GTC ATT CAT ATA GC4 ACG1-R CTA TGC AAA GCC AGA GTT CAC C5 GAC1-F GCC GAT TAG CCT CAC TTA GTC AC6 GAC1-R GGA AAA ATC GAC GGT GTC AGT G7 GAC1-NOR-R CTC CAT GTG ACC AGA GGA CAG8 TUB2-F TTCTGGCAAACCATCTCTGG9 TUB2-R ATC TGA TCC TCG ACC TCC TT

10 M13-F TTG TAA AAC GAC GGC CAG TGA11 M13-R CAG GAA ACA GCT ATG ACC ATG12 GAC-com-F1 CAT GGT CAT AGC TGT TTC CTG* CGC TCG ACT CAA TGA CG13 GAC-com-R1 GTG TAA CGG TGA CCT AAC TTG CTG CTA GTG G14 Gene-F GCG AAT TGG AGC TCC ACC GC15 GAC-com-R2 CAG ATT GTG ATA ACG AGA CGC TGC AGT CTA CC16 AREA-F CCA CAG GCG TTA CAC AGT GG17 AREA-R CAG CAG AAT GGT TTT GAG CAG C18 PKS4-F GCA TCA AGA CTA AGA TCA ACC AGG19 PKS4-R GGC AAT GTA TGC TTC GAG AGC20 TUB2-rt-F CAG CGT TCC TGA GTT GAC CCA ACA G21 TUB2-rt-R CTG GAC GTT GCG CAT CTG ATC CTC G

* M13-R primer sequence for single joint PCR application (Yu et al 2004).

FIG. 1. A. Schematic representation of GAC1 locus inthe wild-type strain. Flanking genes of GAC1 are CSP1 andACG1. In REMI strain R647, pBP15 vector is integrated inGAC1 locus. The REMI vector pBP15 harbors hygromycinphosphotranferase gene (HPH) as the selectable marker.GCV1 is the construct with the wild-type GAC1 gene fusedto the geneticin-resistance gene (GEN) that was used tocomplement R647. The numbered arrows indicate thelocation of primers used for PCR assays of each gene(TABLE I). The double-headed arrow on pBP15 indicates thefragment used as 32P-labeled probe in the southern blot.Primers 5 and 7 were used to amplify DNA fragment forGAC1 northern analysis. E: EcoRI, EV: EcoRV, H: HindIII. B.

r

Southern blot analysis of wild-type (WT), R552, and R647strains. Fungal genomic DNA was digested with EcoRV, andthe blot was hybridized with 32P-labeled HPH probe(FIG. 1A). C. PCR analysis of GAC1 with gene specificprimers (5 and 6 described in FIG. 1A). TUB2 PCR wasperformed as a positive control. WT: wild type, R647: REMImutant strain, GACc: GCV1-complemented strain. Theamplified genes and sizes are described on the left. D.Northern blot analysis of the transformants probed with 32P-labeled DNA fragment of GAC1 (described in FIG. 1A) todetermine the expression of GAC1. Total RNA samples(15 mg) were subjected to electrophoresis in a 1.2%

denaturing agarose gel. The gel was stained with ethidiumbromide to confirm uniformity of loading (rRNA).

CHOI ET AL: BIKAVERIN REGULATION 703

fragment probe was amplified with primers (GAC1-F andGAC1-NOR-R) and 32P-labeled for northern hybridization(FIG 1A).

Pathogenicity, FB1 and bikaverin analysis.—Pathogenicityassays on maize ear and stalk were performed as describedby Sagaram et al (2007). For fumonisin production analysisF. verticillioides strains were grown in cracked-corn medium10 d. FB1, the major fumonisin produced by F. verticillioides,was extracted and analyzed by HPLC, following the methoddescribed by Shim and Woloshuk (1999). FB1 was quanti-fied by comparing peak areas with FB1 standard (Sigma).Bikaverin was extracted from total mycelium grown on 0.23

PDA 14 d, following the suggested protocol (Chavez-Pargaet al 2005, Giordano et al 1999) and analyzed by UV-visiblespectrophotometer (Agilent 8453, Agilent Technologies,Santa Clara, California) at 518 nm (Giordano et al 1999).Bikaverin standard was kindly provided by Dr Jin-Cheol Kim(Korea Research Institute of Chemical Technoloy, Daejeon,Korea) (Kwon et al 2007).

qRT-PCR was used to investigate the relative expression ofPKS4 and AREA in the wild-type, R647 and GACc strains.Total RNA samples were prepared from wild type, R647 andGACc grown on Petri dishes filled with 0.23 PDB 7 dwithout agitation, 14 h light/10 h dark cycle at 25 C. qRT-PCR analysis was performed with SYBR-Green as thefluorescent reporter using gene specific primers for PKS4(PKS4-F and PKS4-R) and AREA genes (AREA-F and AREA-R). The expression of each gene was normalized toendogenous TUB2 gene expression, which was amplifiedwith TUB2 gene-specific primers (TUB2-rt-F and TUB2-rt-R). The gene expression was calibrated with 22DDCt method(Livak and Schmittgen 2001); the range of expression wascalibrated with 22DDCt 2 s 2 22DDCt + s, where s is the standarddeviation of DCt value (Ct 5 threshold cycle).

Visual anlysis of bikaverin production.—To test bikaverinproduction under various conditions we prepared agarmedia with various nutrients and pH conditions. Bikaverinproduction was tested with 0.23 PDA with pH 7 or 10.Water agar (1%) media supplemented with select carbon ornitrogen sources (e.g. sucrose, glucose, ammonium acetate,sodium nitrate, ethanol or methanol at specific concentra-tions) were prepared, and F. verticillioides strains were pointinoculated at the center of these plates with an agar block(0.5 cm diam). Plates were incubated 7 d at 25 C under14 h light/10 h dark cycle.

RESULTS

Isolation of REMI mutant strain R647 in F. verticil-lioides.—We generated more than 2000 F. verticil-lioides REMI mutants with a goal of studying fungalsecondary metabolism and virulence on maize,namely FB1 production, stalk rot and ear rot. Duringthe screening process we identified a strain, designat-ed R647, which showed a drastic increase in redpigment production on 0.23 PDA plates whencompared to its wild-type progenitor. The pigmentproduction on 0.23 PDA by R647 became evident 4 d

postinoculation, whereas the wild-type progenitorshowed little pigment production. This phenotypebecame more apparent after 14 d postinoculation(FIG. 2A). We further analyzed R647 for additionalcharacters that differed from the wild-type progeni-tor, namely conidiation, hyphal development, FB1

production and maize pathogenicity. We did observea slight growth reduction, approximately 12%, onagar media when we compared wild type and R647(FIG. 2B). However we did not observe any significantdifferences in the wild type and R647 for the othercharacters examined (data not shown). R647 was asvirulent as the wild-type progenitor on maize ears andstalks and produced wild-type level FB1 on maizekernels. We concluded that the insertional mutationthat occurred in R647 likely is responsible for theoverproduction of red pigment on 0.23 PDA.

Identification of REMI locus GAC1, encoding a GTPaseactivating protein.—To confirm that the REMI eventin R647 occurred at a single locus we performedsouthern blot analysis with the hygromycin phospho-transferase (HPH) gene as a probe (FIG. 1A). HPHprobe did not hybridize to the wild-type genomicDNA whereas a single band was detected in R647genomic DNA (FIG. 1B). Another random insertionalmutant R552 was determined to have multiple copiesof pBP15 inserted in the genome. This blot demon-strates that a single copy of the pBP15 vector wasinserted into the wild-type genome, suggesting that amutation in a single locus is responsible for R647phenotype.

We subsequently recovered the DNA flanking thesite of pBP15 integration in R647 by standard plasmidrescue technique (Shim and Woloshuk 2001). Thegenomic DNA of R647 was digested with EcoRI, selfligated and transformed into E. coli. The rescuedplasmid containing the entire pBP15 vector andflanking F. verticillioides DNA was sequenced toidentify the gene into which pBP15 integrated. A 70-bp DNA sequence was obtained and used to searchthe matching genomic DNA sequence in F. verticil-lioides (The Fusarium Group Database, Broad Insti-tute of Harvard and MIT, http://www.broad.mit.edu/annotation/genome/fusarium_group). The searchrevealed that the 70-bp DNA sequence completelymatched sequence 714 918–714 988 in supercontig10. Sequencing also showed that the insertion ofpBP15 39 end occurred 482 bp downstream from thestart codon. However we were not able to retrieve thesequence flanking the 59 end of pBP15. The rescuedsequence was part of a 4.9-kb gene encoding aputative GTPase activating protein. We designatedthis gene GAC1 (GTPase activating protein 1). BLASTanalyses revealed that GAC1 shares significant simi-

704 MYCOLOGIA

larities with the putative GTPase activating protein inNeosartorya fischeri (E value 5 0.0), Aspergillusfumigatus (E value 5 0.0) and in Candida albicans(E value 5 9e-95).

Next we recognized that GAC1 is located close toadjacent genes upstream and downstream and there-fore tested whether the REMI event also affectedthese genes. This question was raised because wecannot completely rule out the possibility of partialdeletion during the REMI process (Shim andWoloshuk 2001). The genes that flank GAC1 in theF. verticillioides genome were a 3.2-kb gene encodinga putative chromosome segregation protein (super-contig 10, sequence 709 281–712 522) and a 1.2-kbgene encoding a putative beta-N-acetylglucosamini-dase (supercontig 10, sequence 721 246–722 474),which were designated respectively CSP1 and ACG1(FIG. 1A). PCR analyses were carried out to determinewhether these genes were affected by the REMI event.In wild-type and R647 strains PCR with primersspecific for CSP1 and ACG1 resulted in expectedamplicons for CSP1 and ACG1 (data not shown).However no PCR product was observed in R647 whenthe reaction condition was optimized to amplify 4.9-kb GAC1 amplicon, suggesting that only GAC1 wasaffected by the insertion of pBP15 in R647 (FIG. 1C).As a control we amplified the b-tubulin gene (TUB2)and obtained the expected amplicons in both the wildtype and R647 (FIG. 1C).

Complementation analysis of GAC1 in R647.—South-ern blot and PCR analyses showed that GAC1 locuswas disrupted by the insertion of pBP15. Northernblot analysis was performed with a 280-bp GAC1 DNAfragment probe, which hybridized to the expected 5-kb transcript band in the wild type but did not inR647 (FIG. 1D), confirming that the expression ofGAC1 was suppressed drastically in the REMI mutant.To further verify that the phenotypes exhibited byR647 was due to the REMI mutation we complement-ed R647 with the GCV1 construct, which contains thewild-type copy of the GAC1 gene fused to the GENmarker (FIG. 1A). After the transformation thecomplemented strains were selected by growth on0.23 PDA containing hygromycin and geneticin. Theputative complemented strain containing GCV1 wasdesignated GACc, and we determined by PCR thatGACc contained the introduced wild-type GAC1 gene(FIG. 1C). Northern analysis also showed that expres-sion of GAC1 was restored in GACc (FIG. 1D). Wethen tested whether the R647 phenotypes wererestored in GACc. The presence of GAC1 restoredR647 pigmentation to those of the wild-type(FIG. 2A). Likewise GACc growth on agar media wasrestored to the wild-type level (FIG. 2B). Therefore we

FIG. 2. A. Colony morphology and pigmentation of thewild type, R647, and GACc grown on 0.23 PDA and V8 agarplates. Wild type, R647 and GACc were point inoculatedwith an agar block (0.5 cm diam) and incubated 14 d at25 C under 14 h light/10 h dark cycle. B. Radial growth on0.23 PDA was measured and presented as a bar graph.Results are means of three biological replications. C.Quantification of bikaverin production in wild type, R647and GACc grown on 0.23PDA. Bikaverin was extractedfrom total mycelium on 0.23 PDA with 5 mL chloroformand quantified with molecular extinction coefficient (log e5 3.95) at 518 nm (Giordano et al 1999). Results are meansof three biological replications.

CHOI ET AL: BIKAVERIN REGULATION 705

concluded that the mutation of GAC1 in R647 isdirectly responsible for the increased pigmentationand growth reduction on agar plates.

Identification of bikaverin and its production pattern onvarious agar plates.—During this study the nature ofthe red pigment produced by R647 was ambiguous.However review of literature strongly suggested thatthe metabolite is bikaverin, which is the major redpigment produced by a variety of Fusarium species inculture (Giordano et al 1999, Linnemannstons et al2002). We followed the extraction protocol specifi-cally designed for bikaverin (Chavez-Parga et al 2005,Giordano et al 1999) and measured the concentra-tion of bikaverin, following the protocol described byChavez-Parga et al (2005) and Giordano et al (1999).We observed more than a 15-fold increase inbikaverin production in R647 culture when comparedto that of wild-type progenitor, and significantly thisincrease was reverted to the wild-type level in GACcculture (FIG. 2C). This suggested that bikaverin is thepigment overproduced in R647.

Next we tested whether conditions known toenhance bikaverin production, such as ambient pHand nitrogen stress, affect the overproduction ofbikaverin in R647. Under higher pH conditionsbikaverin production was inhibited in the wild-typeand GACc strains, whereas no significant differencewas observed in R647 (data not shown). We alsotested the affect of different carbon or nitrogensources on R647 bikaverin production. Of note, thepresence of readily usable nitrogen sources, such asammonium or nitrate, suppressed bikaverin produc-

tion in wild-type, GACc and R647 strains (FIG. 3),suggesting that bikaverin biosynthetic mechanism isunder nitrogen catabolite repression. PKS4, thepolyketide responsible for bikaverin biosynthesis, isdownstream of AREA in F. fujikuroi (Linnemannstonset al 2002). We consequently argued that AreA, theglobal nitrogen regulator, is downstream of GAC1.

AREA and PKS4 are regulated by GAC1 in F.verticillioides.—We investigated the affect of aGAC1 mutation on the expression of AREA andPKS4 genes with qRT-PCR analysis. Total RNAsamples were prepared from fungal mycelia of wild-type, R647 and GACc strains grown in 0.23 PDBwithout agitation. qRT-PCR analysis revealed thatAREA expression was twofold, down-regulated where-as PKS4 expression was up-regulated significantly inR647 compared to those of wild type and GACc(FIG. 4). Analysis also showed that GAC1 complemen-tation restored AREA and PKS4 expression to thewild-type levels. Our data provide molecular evidencethat AREA and PKS4 are downstream genes of GAC1and they respectively are under positive and negativeregulation by GAC1 in F. verticillioides.

DISCUSSION

Bikaverin is a cyclic polyketide rendering deep redhues from the culture of Fusarium species and hasbeen recognized as an undesirable byproduct ofgibberellin production in Fusarium fujikuroi (Gior-dano et al 1999, Linnemannstons et al 2002) as well asa fungal metabolite with antiprotozoal and antifungal

FIG. 3. Bikaverin production on a variety of agar plates. Wild type (WT), R647 and GACc were point inoculated with anagar block (0.5 cm diam) and incubated 7 d at 25 C under 14 h light/10 h dark cycle. All agar plates were made on the basisof 1% water agars plus these ingredients: (i) sucrose 0.01 M, (ii) sucrose 0.1 M, (iii) Glucose 0.1 M, (iv) NH4C2H3O2 0.1 M, (v)NaNO3 0.1 M, (vi) 30% Ethanol (v/v).

706 MYCOLOGIA

activities (Linnemannstons et al 2002). Its biosynthe-sis requires a polyketide synthase (PKS), and PKS4has been characterized as the PKS gene required forbikaverin production in F. fujikuroi and F. verticil-lioides (Linnemannstons et al 2002, Proctor et al2006). However little additional information isavailable on bikaverin biosynthesis, particularly thegene-signaling pathways that regulate production ofthis secondary metabolite.

The REMI mutagenesis study was aimed at identi-fying genes responsible for secondary metabolism andvirulence in F. verticillioides. In this study weunexpectedly identified GAC1 that encodes a putativeGTPase activating protein (GAP), which does notaffect fumonisin production or virulence on maizebut negatively affects bikaverin production. A data-base search with the Gac1 protein sequence indicatedthat Gac1 is likely a Ran-GAP, which regulates RanGTPase that is involved in trafficking of proteins in orout of the nucleus by acting on GTP (Avis and Clarke1996). Ran-GAP takes part in turning off Ran-GTPaseby hydrolysis of GTP, leading to transport of proteinsfrom the nucleus to the cytosol. The counterpart ofGAP is guanine nucleotide exchange factor (GEF),which turns on the G-protein again by making a GTP-bound form of the G protein, and thereby allowingprotein transport into nucleus (Avis and Clarke

1996). We speculate that the disruption of GAC1might have resulted in an imbalance of GAP and GEF,giving rise to increased GEF activity and ultimatelyconstitutive activations of yet-to-be determined Gprotein that led to overproduction of bikaverin in F.verticillioides. Further investigation is necessary todetermine unambiguously the G-protein signalingpathway that directly regulates bikaverin biosynthesis.

While questions regarding G-protein directly down-stream of Gac1 remain we investigated other molec-ular and physiological factors known to affectbikaverin production in Fusarium species and howthese factors are associated with each other. In F.fujikuroi expression of PKS4 is affected by the globalnitrogen regulator AreA. Accordingly, we observedthat the presence of ammonia or nitrate inhibitedbikaverin production in the F. verticillioides strains(FIG. 3). Based on these findings we postulated thatAREA and PKS4 are downstream of GAC1, and to testour hypothesis we analyzed the expression levels ofAREA and PKS4 in R647 (FIG. 4). Our data showedthat GAC1 mutation had a negative effect on AREAexpression, which strongly suggests that GAC1 isupstream of AREA in bikaverin regulatory pathway.Also this repression of AREA resulted in overexpres-sion of PKS4 in R647, suggesting that AREA plays anegative regulator role in bikaverin biosynthesis. Thefact that PKS4 is under negative regulation by AREAwas not a surprise. Linnemannstons et al (2002)suggested a model explaining how AREA and PKS4affect bikaverin biosynthesis in F. fujikuroi. In thismodel it was postulated that AREA is interactingdirectly with an unidentified bikaverin-specific repres-sor under nitrogen-rich conditions, which in turncould repress PKS4 expression. However the obser-vation that ammonium and nitrate repressed bika-verin production in R647 (FIG. 3) raises the possibilitythat AreA is only partially regulated by Gac1. Furtherinvestigation is necessary to determine whether AreAcan be regulated by other genetic or physiologicalsignals in F. verticillioides.

Another factor that is known to affect bikaverinbiosynthesis is pH, particularly acidic pH which isknown to trigger bikaverin production (Giordano etal 1999). When the wild-type F. verticillioides wasgrown on acidic agar media we did not observesignificant difference in bikaverin production. Wesubsequently questioned whether GAC1-mediatedbikaverin biosynthesis in F. verticillioides is controlledby a key pH regulator gene PAC1. PAC1, homologousto PACC in Aspergillus nidulans, is activated underalkaline conditions repressing genes that requireacidic conditions (Flaherty et al 2003, Orejas et al1995). However when we observed R647 underdifferent pH conditions we did not see a difference

FIG. 4. Expression of AREA and PKS4 genes in wild-type, R647 and GACc strains. Total RNA samples wereprepared from fungal strains grown on 0.23 potatodextrose broth (PBD) 14 d, and quantitative real-time(qRT)-PCR analysis was performed with SYBR-Green asthe fluorescent reporter. The levels of transcription wereevaluated with the 22DDC

T method with TUB2 as endogenouscontrol. Data represent the fold differences in geneexpression. Three biological replications were performedto obtain standard deviations.

CHOI ET AL: BIKAVERIN REGULATION 707

in bikaverin production (data not shown). Thereforewe concluded that the pH response pathways in F.verticillioides are not directly associated with GAC1-mediated bikaverin biosynthesis.

In summary, using a REMI approach, we identifiedF. verticillioides GAC1 gene, which encodes a GTPaseactivating protein and demonstrated that GAC1 isnegatively associated with bikaverin production.GAC1 positively affects transcription of AREA butnegatively affects transcription of PKS4. GAC1 is alsonecessary for proper growth, as was indicated by areduction of the growth rate in the gac1 mutant. Ourlack of knowledge in F. verticillioides gene-signalingpathways currently hinders us from unambiguouslycharacterizing GAC1-mediated secondary metabolismpathways. In fact we cannot rule out the possibilitythat there are other metabolites, which might beovershadowed by the high concentration of bikaverin,overproduced in R647. Here we can conclude thatGAC1, AREA and PKS4 play critical roles in bikaverinproduction. However there is no doubt that addition-al genes (e.g. G proteins) are involved in thissignaling pathway. Functional genomic tools, such asmicroarray and proteome analyses, currently arebeing used to identify additional components thatformulate the complicated secondary metabolismsignaling pathways in F. verticillioides.

ACKNOWLEDGMENTS

The authors thank Dr Mala Mukherjee for careful readingof this manuscript. This project was supported by theNational Research Initiative of the USDA Cooperative StateResearch, Education and Extension Service (grantNo. 2007-35319-18334).

LITERATURE CITED

Avis JM, Clarke PR. 1996. Ran, a GTPase involved in nuclearprocesses: its regulators and effectors. J Cell Sci 109:2423–2427.

Bacon CW, Hinton DM, Porter JK, Glenn AE, Kuldau G.2004. Fusaric acid, a Fusarium verticillioides metabolite,antagonistic to the endophytic biocontrol bacteriumBacillus mojavensis. Can J Bot 82:878–885.

Calvo AM, Wilson RA, Bok JW, Keller NP. 2002. Relation-ship between secondary metabolism and fungal devel-opment. Microbiol Mol Biol Rev 66:447–459.

Chavez-Parga MC, Gonzalez-Ortega O, Sanchez-Cornejo G,Negrete-Rodrıguez MLX, Gonzalez-Alatorre G, Esca-milla-Silva EM. 2005. Mathematical description ofbikaverin production in a fluidized bed bioreactor.World J Microbiol Biotechnol 21:683–688.

Flaherty JE, Pirttila AM, Bluhm BH, Woloshuk CP. 2003.PAC1, a pH-regulatory gene from Fusarium verticil-lioides. Appl Environ Microbiol 69:5222–5227.

Gelderblom WCA, Jaskiewicz K, Marasas WFO, Thiel PG,

Horak RM, Vleggaar R, Kriek NPJ. 1988. Fumonisins—novel mycotoxins with cancer-promoting activity pro-duced by Fusarium moniliforme. Appl Environ Micro-biol 54:1806–1811.

Giordano W, Avalos J, Cerda-Olmedo E, Domenech CE.1999. Nitrogen availability and production of bikaverinand gibberellins in Gibberella fujikuroi. FEMS MicrobiolLett 173:389–393.

Kahmann R, Basse C. 1999. REMI (restriction enzymemediated integration) and its impact on the isolationof pathogenicity genes in fungi attacking plants. Eur JPlant Path 105:221–229.

Kroken S, Glass NL, Taylor JW, Yoder OC, Turgeon BG.2003. Phylogenomic analysis of type I Polyketidesynthase genes in pathogenic and saprobic ascomyce-tes. Proc Nat Acad Sc USA 100:15670–15675.

Kwon HR, Son SW, Han HR, Choi GJ, Jang SJ, Choi YH, LeeS, Sung ND, Kim JC. 2007. Nematicidal activity ofbikaverin and fusaric acid isolated from Fusariumoxysporum against pine wood nematode, Bursaphe-lenchus xylophilus. Plant Path J 23:318–321.

Linnemannstons P, Schulte J, Prado MM, Proctor RH,Avalos J, Tudzynski B. 2002. The polyketide synthasegene pks4 from Gibberella fujikuroi encodes a keyenzyme in the biosynthesis of the red pigmentbikaverin. Fungal Genet Biol 37:134–148.

Livak KJ, Schmittgen TD. 2001. Analysis of relative geneexpression data using real-time quantitative PCR andthe 22DDC

T method. Methods 25:402–408.Maier FJ, Shafer W. 1999. Mutagenesis via insertional- or

restriction enzyme-mediated-integration (REMI) as atool to tag pathogenicity related genes in plantpathogenic fungi. Biol Chem 380:855–864.

Marasas WFO. 2001. Discovery and occurrence of thefumonisins: a historical perspective. Environ HealthPerspect 109:239–243.

Minorsky PV. 2002. The hot and the classic. Plant Physiol129:929–930.

Missmer SA, Suarez L, Felkner M, Wang E, Merrill AH Jr,Rothman KJ, Hendricks KA. 2006. Exposure tofumonisins and the occurrence of neural tube defectsalong the Texas-Mexico border. Environ Health Per-spect 114:237–241.

Nelson PE, Desjardins AE, Plattner RD. 1993. Fumonisins,mycotoxins produced by Fusarium species: biology,chemistry and significance. Ann Rev Phytopath 31:233–252.

Orejas M, Espeso EA, Tilburn J, Sarkar S, Arst HN Jr,Penalva MA. 1995. Activation of the Aspergillus PacCtranscription factor in response to alkaline ambient pHrequires proteolysis of the carboxy-terminal moiety.Genes Dev 9:1622–1632.

Proctor R, Butchko RA, Brown DW, Busman M, PlattnerRD. 2006. Characterization of polyketide synthasegenes from Fusarium verticillioides. Phytopathology96:S95.

Sagaram US, Butchko RAE, Shim WB. 2006a. The putativemonomeric G-protein GBP1 is negatively associatedwith fumonisin B1 production in Fusarium verticil-lioides. Mol Plant Path 7:381–389.

708 MYCOLOGIA

———, Kolomiets MV, Shim WB. 2006b. Regulation offumonisin biosynthesis in Fusarium verticillioides-maizesystem. Plant Path J 22:203–210.

———, Shaw BD, Shim WB. 2007. Fusarium verticillioidesGAP1, a gene encoding a putative glycolipid-anchoredsurface protein, participates in conidiation and cell wallstructure but not virulence. Microbiology 153:2850–2861.

Sambrook J, Russell DW. 2001. Molecular cloning: alaboratory manual. Cold Spring Harbor, New Yyork:Cold Spring Harbor Laboratory Press.

Shim WB, Woloshuk CP. 1999. Nitrogen repression of

fumonisin B1 biosynthesis in Gibberella fujikuroi. FEMSMicrobiol Lett 177:109–116.

———, ———. 2001. Regulation of Fumonisin B biosyn-thesis and conidiation in Fusarium verticillioides by acyclin-like (C-type) gene, FCC1. Appl Environ Micro-biol 67:1607–1612.

Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Domınguez Y,Scazzocchio C. 2004. Double-joint PCR: a PCR-basedmolecular tool for gene manipulations in filamentousfungi. Fungal Genet Biol 41:973–981.

———, Keller N. 2005. Regulation of secondary metabolismin filamentous fungi. Ann Rev Phytopath 43:437–458.

CHOI ET AL: BIKAVERIN REGULATION 709