benefit-sharing fund of the international treaty on plant ... · this midterm report must be sent...
TRANSCRIPT
Benefit-sharing Fund of the International Treaty on Plant Genetic Resources for Food and Agriculture
Project Cycle 2014-2015
WINDOW 3B
IMMEDIATE IMPACT PROJECTS
PR-05-PERU
First Implementation Report (General instructions)
This Midterm report must be sent to the Secretary of the International Treaty on Plant Genetic
Resources for Food and Agriculture electronically at the following address [email protected] or by fax +39 06570 56347.
TABLE OF CONTENTS
1. Executive summary 2. Effectiveness-progress towards achievement of outputs and specific objectives
2.1. Project inception 2.2. Performance: outputs and activities 2.3. Activities not completed
3. Relevance
3.1. Coverage 3.2. Beneficiaries and gender considerations 3.3. Contribution to science and innovation for better use and conservation of PGRFA. 3.4. Contribution to capacity development
4. Methodology of monitoring
4.1. Monitoring approach and data collection methods 4.2. Challenges and major issues identified in conducting the monitoring process 5. Risk Assessment and management 6. Best practices 7. Signature
Annexes Annex 1: Risk assessment matrix
It will take you around five hours to compile this first implementation report.
1. EXECUTIVE SUMMARY Give a brief overview of the project, its main objectives and intervention logic, the existing situation before the beginning of the project, priorities and crops addressed, number and category of targeted beneficiaries (direct and indirect beneficiaries) what have been the main achievements of the project to date and the key constraints affecting the implementation process.
Potato (Solanum tuberosum) ranks as the world's third most important food crop after
wheat and rice (maize is used predominantly as fodder) and provides a significant
contribution to the global food supply. Particularly, potato plays a key role for food
security and subsistence of Andean farmers, as recognized by the initiatives and plans in
food security and nutrition of the governments of the Andean Community. Most of the
actually cultivated potato species are not adapted to the threats of climate change, but
large germplasm resources in form of native and wild Solanum species exist which carry
important genes for resistance or tolerance to different stresses.
The aim of this project is to characterize cultivated and wild germplasm with respect to
resistance and tolerance to different biotic and abiotic stresses and exploit it through
breeding to obtain new potato varieties adapted to climate change for sustainable
agriculture.
The effects of global climate change such as heat, coldness, drought or flooding are likely
to threaten most crop species. Moreover, changes in the pathogen spectrums affecting a
crop can be expected and has been already observed for Phytopthora infestans, the most
important potato pathogen. It is necessary to develop new cultivars which are adapted to
these threats by applying marker assisted selection (MAS) based on useful candidate
genes.
Genomic studies offer the possibility to characterize germplasm efficiently at the
molecular level and to accelerate considerably breeding programmes. The detection of
candidate genes for useful traits offers the possibility to apply them – after developing the
corresponding markers – in marker assisted selection (MAS) within breeding
programmes. The survey of allelic diversity of such genes within cultivated and wild
species and analyses of their particular effects permits to select the most efficient allele
combinations for these purposes. Within this project we want to identify useful candidate
genes for different biotic and abiotic stresses using molecular tools, characterize the
allelic variation of this germplasm and use the markers in marker assisted breeding in
order to speed up the obtainment of improved varieties.
The specific objectives of the project are:
1. Evaluation of potato accessions (cultivars, breeding clones, native and wild Solanum species) for resistance or tolerance to abiotic and biotic stresses related to global climate change.
2. Detection of useful candidate genes (CG) for abiotic and associated biotic stresses applying different molecular Tools.
3. Molecular characterization of the allelic variation in these CG and determination of allelic composition in the evaluated accessions.
4. Association mapping to detect the effects of specific CG alleles or CG allele combinations on the tolerance levels of the analysed stresses, development of molecular markers for Marker-Assisted Selection and Model building to assign parental breeding values and predict progeny performances.
5. Pre-breeding activities to combine favourable characteristics and to improve adaptation to climate change applying the developed markers and models.
6. Dissemination and Transfer of Project results and Products (accessions and breeding clones).
The tasks, materials and methods of this project have been carefully discussed, planned
and coordinated by frequent e-mail contacts with the coordinator and other partners and
particularly during an initial project meeting in the frame of the XXVII Congreso de la
Asociación Latinoamericana de la Papa (ALAP) in Panama City, August 22 to 26, 2016.
The research work for this reporting period has been co-ordinated in detail vía
email/Skype with other project members and during frequent short meetings of the
project staff with the scientists in charge in each institution.
Main achievements:
The PAPACLIMA Project is running now for 8 months since the FAO signature and 4
months since IBT-UNALM signature. Furthermore funds were received by the mid of
November 2016, and FAO instructions for field trial materials availability has not been
accomplished yet since an Amendment to the Letter of Agreement is pending. This has
affected initial implementation according to the Partner.
Appropriate plant materials have been selected and various Field trials have been planned
by the partners targeting different stress conditions and are in part in execution. From the
cold trial in Pichincha 5 varieties were selected with tolerance to frost and good
agronomic performance.
Eight cDNA libraries were constructed derived from mRNA populations of one
susceptible and one tolerant genotype which was stressed for drought, heat and cold as
well as from the unstressed controls.
In silico mining of sequence databases and publications was performed in order to detect
published candidate genes for stress tolerance in Potato but also in other species. All
information has been compiled into a CG Database. Sequences of 57 novel candidate
genes for stress adaptation or they orthologs have been detected in Potato and are
available.
Breeding activities have been initiated by the partners in order to produce improved
cultivars in the future.
Available external resources of Potato on stress tolerance such as sequences, publications
and others were compiled and all project results including sequences, markers and
primers were integrated into a large database. The POTATO Knowledge Database for
Stress Tolerance has been established in form of the PATVIEW browser Software.
Initially the domain: http://www.PAPACLIMA.com was acquired and an informative
project WEB Page has been established which contains information about the
PAPACLIMA project and its participants. The structure of the WEB Page has been
implemented and contains several sections.
The PAPACLIMA project was presented during the XXVII Congreso de la Asociación
Latinoamericana de la Papa (ALAP) in Panama City to a broad audience of around 500
scientists, farmers and stakeholders. A press note about the PAPACLIMA Project is in
preparation with the title: “NEIKER participa en el desarrollo de nuevas variedades de
Patata adaptadas al cambio climático”
Targeted Beneficiaries:
Although the project is a relative short time in execution we are targeting the following
beneficiaries:
Soon the Andean farmers will have recommended cultivars or accessions at their disposal
that can be grown under harsh and adverse agro-climatical conditions. In the near future
Potato varieties with improved properties such as tolerances and resistances to abiotic and
associated biotic stresses which are adapted to the global climate change will be obtained
for sustainable agriculture. Supported by the different planned dissemination actions we
expect to target over 500 farmers and their families in each country.
Useful candidate genes for stress adaptation are already available and the molecular work
is underway. Breeders and researchers will have a set of molecular markers and
predictive models useful for assessing adaptation to abiotic stresses in germplasm,
progenitors and breeding clones at their disposal, which can be used to develop novel
Potato varieties.
The project WEB Page and the foreseen congress presentations of project results will
allow targeting at least 500 scientists.
The project is in good progress. No significant problems have been detected until now for
the realization of all tasks and all expected deliverables in the reporting period have been
delivered, despite problems in the initial implementation. Good progress has been
achieved for other pending deliverables with later delivery date. All tasks will be
completed successfully until the end of the project.
The objectives and expected benefits of this project can be fully achieved.
2. EFFECTIVENESS-PROGRESS TOWARDS ACHIEVEMENT OF PROJECT OUTPUTS AND SPECIFIC OBJECTIVES
2.1. Project inception: enabling environment 2.1.1. Describe the executing arrangements and implementation mechanisms put in place to enable project management and effectiveness and specify whether finance, personnel and materials were available on time and in the right quantities. 2.1.2. Specify if the starting phase of the project implementation has been inclusive of all stakeholders and partners referred to in the Technical Proposal, specify who those partners are and assess their roles and responsibilities.
2.1.1 Project Management
Methodology of project implementation
At the beginning of the project Agreements were signed between coordinator and
partners in order to establish the legal and technical aspects of the collaboration.
Up-to-date Methodology to implement the Project was followed (see: The Basics of
Project Implementation, CARE US; http://www.careclimatechange.org/files/toolkit/CARE_Project_Implementation.pdf).
The components of a successful project include managing relationships with various
stakeholders, managing human resources, managing financial resources, facilitating
learning, managing risks and ensuring flexibility.
Some of the elements for project implementation were already included in the proposal,
such as objectives (2.1) a detailed work plan (2.2) including activities and executing
partners, expected outputs and time schedule of tasks, project budget (Appendix IV) and
a logical framework (log frame) that explains how the project will contribute to an
ultimate impact (Appendix III).
Others were implemented by the partners at project start, such as a Monitoring and
Evaluation Plan, Budget Planning and Monitoring including a Staffing & Procurement
Plan, following the particular procedures in force of each participating institution.
Moreover, Annual Work Plans (AWP) were prepared, which include a detailed planning
of the foreseen activities and deliverables and the specific set of results to achieve during
a particular year.
In order to control and monitor the progress of the project the following elements were
implemented:
Project Management Board (PMB)
The PMB monitors the progress of the project. It is composed of the Coordinator and the
principal investigators of each participating institution, together with the corresponding
heads of departments of each institution as external observers and project staff, if
required.
The coordinator in collaboration with the other PMB members is responsible for
reporting and the technical and financial management of the project.
Project start:
Although at least the planning of the activities started immediately at project start, there
was a slight delay in receiving the first payment from FAO.
Moreover, with respect to the provision of field trial materials, there is still a Procurement
issue of 95,700 US$ for IBT, INIAP and USFQ pending at FAO! This has to be solved
quickly.
2.1.2 Project Implementation and Partners
Four public institutions perform jointly the R&D activities:
P1. IBT - Instituto de Biotecnología de la Universidad Nacional Agraria La Molina (Lead
Institution, Peru)
P2. INIAP - National Agriculture Research Institute (Ecuador)
P3. USFQ: Universidad San Francisco de Quito, Colegio de Ciencias e Ingenierías (Ecuador)
P4: NEIKER - Basque Institute for Research and Development in Agriculture, Spain
(Subcontracted)
The following activities and involved participants with responsibilities are scheduled
during the project duration. The activities in yellow have been addressed successfully in
the starting phase:
Table 1: Task scheduling and its participants in the PAPACLIMA Project
Year 1 Year 2 Year 3
Activity as Task 2 4 6 8 1
0
1
2 2 4 6 8
1
0
1
2 2 4 6 8
1
0
1
2 PAR
A 1.1: Evaluation of resistance or tolerance
to abiotic stress factors: drought, cold, heat X X X X X X X X X X X X I,E,U
A 1.2: Evaluation of resistance or tolerance
to late blight (Phytophthora infestans) X X X X X X I,E,U
A 2.1 Library construction and RNA-Seq X X X X X X X X X X N
A 2.2 Analysis of known candidate genes
for biotic and abiotic stresses. X X X X X X X X X X X X N
A 2.3: Analyses of CG by Amplicon
Sequencing (CG driven approach) X X X X X X N
A 2.4: RAD sequencing for CG detection
and analyses (random approach). X X X X X X N
A 3.1- Association Mapping X X X X X X X X N
A 3.2 Design of allele specific primers
(ASP) for important CG alleles X X N
A 3.3 Model Development X X X X X X X N
A 3.4 Model Validation and Refinement X X N
A 4.1 Performance of crosses between
accessions from WP1 X X X X X X I,E,U
A 4.2 Evaluation of the obtained progenies
for agronomic performance and tolerances X X X X X X X X X X X X I,E,U
A 4.3 Application of the developed allele-
specific primers for genotype selection. X X X X I,E,U
A 5.1 Establishment of a Knowledge Base
on Analysis and Evaluation of Resistance /
Tolerance to stresses in potato X X X X X X X X X N,I,E,U
A 5.2: Establishment of a Project WEB
Page X X X X X X N
A5.3 Dissemination at the scientific /
technical level X X X X X X X X X N,I,E,U
A 5.4 Transfer the sector (productive chain) X X X X X X X X N,I,E,U
A 5.5 Establishment of Demonstration
Plots X X X X I,E,U
Yi = Year 1 to 3 with 2 month periods. PAR Participants: N=Neiker, I=IBT, E=INIAP, U=USFQ .
IBT is the coordinating institution and involved in resistance trials/assays,
resistance/tolerance evaluations(A1i) and in breeding activities (A4i).
INIAP and USFQ are also involved in resistance trials/assays, resistance/tolerance
evaluations(A2i) and in breeding activities (A4i) .
NEIKER is the Technology provider, dedicated to Molecular Technology Development
and Technology transfer (A2i, A3i, A5i)
All partners collaborate in Transfer and Dissemination activities (A5i).
2.2. Performance: outputs and activities 2.2.1. Assess progress made towards the achievement of each planned output and provide details on the quality and quantity of output delivery as well as the timeliness with respect to original work plan.
2.2.2. For each output, describe relevant activities undertaken during the reporting period and specify the methodology used.
2.2.3. For each activity, specify which stakeholder/beneficiary group(s) was/were involved, their number, the reason of their involvement and what was the share of women involved in these groups (%).
2.2.1 Progress and Output
The following Output is foreseen and the following progress has been achieved
accordingly in the reporting period:
Some Output is not yet scheduled, see Table 1 in 2.2.2
Target Output 1: Andean potato varieties and accessions including native potato species with
resistance or tolerance to abiotic and associated biotic stresses related to global climate change
identified, recommended for cultivation under adverse conditions and used for cultivation and
breeding.
Activity Project outputs Targeted outputs (Deliverable) Due
date
A1.1 Results on evaluations of drought, cold
and heat tolerance of the accessions
through field trials and bio-assays.
D1.1a,b: Evaluation Data &
Recommended LIST of accessions with
tolerance to different abiotic stresses for
cultivation & breeding
Months
* 12 and
24
A1.2 Results of evaluation assays for
resistances to P. infestans in the working
collection.
D1.2a,b: Evaluation Data &
Recommended LIST of accessions with
resistance to P. infestans for cultivation &
breeding
Months
* 12 and
24
* First results and final results, respectively.
The first deliverables are due at month 12 according to the contract. Nevertheless, certain
achievements have been already obtained or are on the pipe:
IBT:
D1.1a, b: The accessions for the evaluations have been selected and the trial locations
have been determined:
Field evaluation 2016
ORIGIN NUMBER OF ACCESSIONS
ALTITUDE (masl)
Latitude Longitude
Huancavelica 43 3403 12°50'38.81"S 74°33'41.90"O
Huancayo 13 3260 12°00'50.00"S 75° 13'11.00"O
Cuzco 42 3357 13°34'17.82"S
71°51'59.70"O
Cajamarca 27 3970 7°10'2.74"S 78°11'17.48"O
Puno 60 3852 15°52'52.13"S 70° 0'1.14"O
Additional plots are being installed in 2017 to validate frost tolerance under natural
conditions:
Junín: June 2017; Cuzco: September 2017 and Puno: October 2017.
Timeliness with respect to original plan is a little delayed with regards to material
available for frost tolerance validation under natural conditions.
INIAP:
D1.1a, b and D1.2a,b: The accessions for the evaluations have been selected and the
trial locations have been determined.
For the project 110 potato accessions from the Ecuadorian INIAP potato breeding
program were selected for the field activities and a leaf sample of each accession was sent
to Neiker-Tecnalia for molecular analysis. Three Ecuadorian representatives Provinces were
selected for the field experiments: Carchi, Pichincha and Chimborazo.
In Pichincha, two field experiments (cold and late blight resistance) were planted, furthermore
breeding activities as crosses and offspring evaluations are in progress.
In Chimborazo, two field experiments were established (cold tolerance and late blight resistance).
In Carchi, a demonstration plot for the VII National Potato Congress was installed containing 24
representative potato varieties.
USFQ:
D1.1a, b and D1.2a,b: The accessions for the evaluations have been selected and the
trial locations have been determined.
Twenty five different potato accessions were delivered from INIAP to USFQ in order to
test tolerance to abiotic stresses (cold, heat, and drought). Greenhouse and field trials
were performed. Greenhouse trials were made at the USFQ facilities while field trials
were made at two different locations in the Ecuadorian Highlands: Pastocalle (3197 masl)
at the Cotopaxi Province and Cangahua (2790 masl) at the Pichincha Province. The 25
accessions were used in each trial.
NEIKER: NOT involved in these tasks.
Target Output 2: Useful candidate genes for abiotic stress and associated biotic stress tolerance
identified applying RNAseq, in silico Mining and RAD sequencing & existing allelic variation for
these CG in the evaluated accessions determined.
Activity Project outputs Targeted outputs (Deliverable) Due date
A2.1 Results of CG analyses derived from
RNAseq sequences for drought, cold
and heat tolerance.
D2.1a,b:List of new candidate genes for
abiotic and related biotic stress resistance
derived from RNAseq.
Months* 12
and 24
A2.2 Results of in silico mining to detect
published candidate genes for
tolerances to abiotic stresses drought,
cold, heat and resistance to biotic
stresses. Identification of homologues
in potato.
D2.2a,b: List of potato CG derived from in
silico mining of published candidate genes
for abiotic and related biotic stress
resistance.
Months* 12
and 24
A2.3 CG sequences and Amplicon primers.
Results of allelic variation of CG and
allele composition of the accessions
derived from Amplicon sequencing.
D2.3a,b: List of CG Sequences and
functional primers for obtaining CG
amplicons.
For each CG LIST of SNP/alleles in the
collection and CG allele composition of each
accession.
Months* 12
and 18
A2.4 Results of CG extractions derived from
RAD sequences, allelic variation of CG
and allele composition of the
accessions
D2.4a,b: LIST of CG extracted from RAD
tags and their biological meaning. LIST of
SNP/alleles in the collection and CG allele
composition of each accession.
Months* 18
and 24
The first deliverables are due at month 12 according to the contract. Nevertheless, certain
achievements have been already obtained or are on the pipe:
IBT, INIAP, USFQ: NOT involved in these tasks.
NEIKER:
D2.1a: dsCDNA has been prepared for mRNA populations derived from stressed
(cold, heat, drought) and unstressed materials. Amplicon construction,
sequencing and sequence analyses are underway.
D2.2a: A list of 57 new candidate genes (CG) from in silico mining are available.
D2.3a: Functional primers for the 57 CG were designed in Exon regions and
successfully tested.
A 2.3: Analyses of CG by Amplicon Sequencing (CG driven approach)
A 2.4: RAD sequencing for CG detection and analyses (random approach).
(Not yet scheduled)
Target Output 3: Effects of specific CG alleles or CG allele combinations on the tolerance
levels of the analysed stresses detected through Association Mapping and Models allowing
predictions of parental breeding values and progeny performances established.
Not yet scheduled , starting at Month 20 -
Target Output 4: Genotypes with combined favourable characteristics obtained through pre-
breeding activities and application of developed markers, allowing to improve adaptation to
climate change and progeny performance predictions. Activities Project outputs Targeted Output
(Deliverables)
Due date
4.1.
Crossings
Crossings between promising accessions in order
to combine favourable characteristics
D4.1a,b,c: List of
performed crossings (at
least 200) and promising
parents (at least 30)
involved
Months* 12,
24 and 36
4.2.
Evaluation of
resulting
progenies
Results of progeny evaluation and Selection of
superior breeding clones with combined
favourable characteristics.
Not yet scheduled starting at Month 13
D4.2a,b: Data of Progeny
evaluations, LIST of
selected progeny genotypes.
At least 60 breeding
populations developed and
9 advanced breeding clones
identified.
Months*
24 and 36
4.3.
Application
of MAS
Results of application of the developed allele
specific primers in selected progeny genotypes.
Not yet scheduled starting at Month 13
D4.3a,b: Data of at least
100 marker validations in
selected genotypes
Months*
24 and 36
The first deliverables are due at month 12 according to the contract. Nevertheless, certain
achievements have been already obtained or are on the pipe:
IBT:
D4.1a,b,c. Progenies from breeding activities of one of the INIA collaborators (Dr.
Noemí Zuñiga, INIA, Huancayo) will be available to test de molecular markers for frost
tolerance.
INIAP:
D4.1a,b,c:
For the breeding activities, eight parents were selected, nine crosses were carried out, we
obtained 85 families and 4,448 off springs.
USFQ: None.
NEIKER: ONLY involved in task 4.3.
Target Output 5: Efficient Dissemination and Transfer actions realized to implement successfully Project results and Products.
Activities Project outputs Targeted Outputs (Deliverable) Due date
A5.1. Knowledge Base Establishment of a Knowledge Database about
“Analysis and Evaluation of tolerance/
resistance to stresses in the potato crop.
D5.1: Knowledge Database based on
all project results and external
information
Month 6 and updates
month 12, 24,36
A5.2. Project WEB
page
Establishment of an informative Project web
page
D5.2: Project WEB Page
“Papaclima” with regular updates
Month 6 and updates
month 12, 24,36
A5.3. Scientific
Dissemination
Efficient transfer of project results between
project partners and to the scientific
community
D5.3: Publications of project results.
Presentation of project results in
conferences and workshops.
Periodically during the
project
A5.4. Transfer of results
to the sector
Efficient transfer actions to the sector
(productive chain) and stakeholders
D5.4: Fairs, Field Days, Regional
Workshops. Distribution of tubers
Periodically during the
project
A5.5. Demonstration
Plots
To establish Demonstration plot s with most
promising varieties or breeding clones
D5.5: Demonstration Plots of adapted
varieties /breeding clones
Months 30 to 36
* In addition the Indicators/Targets specified in the Log Frame (Appendix 2) which have
been already partially targeted and will be completed gradually during the project duration
The first deliverables are due at month 6 and 12 according to the contract. Certain
achievements have been already obtained or are on the pipe:
D5.1: A Knowledge Database “PATVIEW”considering on all project results and
external information has been established.
D5.2: An initial Project WEB Page “PAPACLIMA” has been established
(http://www.papaclima.com)
D5.3: The partners participated in the conference:” ALAP 2016 Panamá: XXVII
Congreso de la Asociación Latinoamericana de la Papa”, Panama City, August 22 to
26, 2016. At his occasion also a Poster was presented about the Papaclima Project
A press note about the PAPACLIMA Project is soon to be released by NEIKER in
2017 with the title: “NEIKER participa en el desarrollo de nuevas variedades de Patata
adaptadas al cambio climático”
D5.4a: Training stages at NEIKER are being programmed at IBT. INIAP will send a
researcher to NEIKER-Tecnalia for training in June. Training is under coordination
with Dr. Enrique Ritter (NEIKER).
D5.4b:
Each two years INIAP, CIP and local Universities organize a National potato
Congress, this year the event will be developed in Carchi Province. It is planned
to include into the program a special session about climate change with at least
three contributions from the project participants. A field day is organized into the
Congress program, for this event 24 potato varieties from the project were planted
in Carchi location in February 14 and April 4.
Coordination with the San Francisco University at Quito (USFQ) are ongoing.
There were three meetings to discuss project activities, to set up the late blight and
low temperature tolerance experiments, and planning of the demonstration plots
for the potato Congress. USFQ participated in the evaluation of cold tolerance
experiments.
2.2.2 Activities and Methodology The following activities have been performed so far in concordance with the workplan
and the scheduling (see above). Besides the description, also partner-specific annexes are
included, containing Tables and Figures for illustrating the work.
Related to Output 1 according to Specific Objective 1: Phenotypic evaluation of the
germplasm working collection
A 1.1: Evaluation of tolerance to abiotic stress factors: drought, cold, heat
A 1.2: Evaluation of resistance or tolerance to late blight (Phytophthora infestans)
IBT: The main purpose to install field trials was phenotyping a wide genetic and geographic
diversity of accessions with putative resistances or tolerances to the abiotic and biotic
stresses, propagation for further trials, and sampling for DNA extraction. Sampling has
been performed and phenotyping is being conducted. Material and field trials are being
prepared for frost tolerance validation under natural conditions (D1.1a.b) as well as for
Late Blight resistance (D1.2a,b). These trials under natural conditions are planned to be
installed in 2017.
INIAP
Pichincha:
Location: INIAP-Sta. Catalina Research Station (3050 masl)
The field experiment was planted in September 20, 2016 and harvested in February 6,
2017. Twenty-four potato varieties previously selected for cold tolerance were used. A
randomized complete block design with three replicates was used.
Each treatment consisted of 4 furrows with 15 tubers per furrow and a net plot of 30
plants from the center plot.
We had the presence of three frost events on November 20, 21 and 22, bringing the
temperature down to 0⁰C. We measured, the damage of the foliage three times using a
scale from 0 to 6 (Table 1) (Vega and Bamber 1995), the first one, two days after the last
frost, two days later the second evaluation, and after two weeks the last measurement. At
harvest time, information of yield and its components was registered (ANNEX INIAP
Table 2.2.2.1.1.)
Table 1. Frost damage scale
Score Description
0 No damage
1 Slight bronzing of upper leaves
2 Few upper leaflets killed
3 Most upper leaflets killed
4 All upper leaflets and petioles killed
5 All leaves killed
6 All leaves and stems killed
The INIAP-Catalina, Jubaleña, Tushpa, Calvache, INIAP-Josefina, INIAP-Victoria,
INIAP-Gabriela, INIAP-Puka Shungo, Allypacha, INIAP-Fripapa and Puña negra
varieties showed the least damage due to frost. The INIAP-Yana Shungo, Premium,
INIAP-Libertad and Carolina varieties presented the greatest damage. In the last frost
scoring, Leona Negra, Lila Shungo INIAP-Libertad, Superchola, and Uvilla varieties
showed significant vegetative recovery from frost damage.
The highest yields > 30 t/ha were obtained for the varieties Calvache, INIAP-Natividad,
INIAP-Raymipapa, INIAP-Catalina, INIAP-Josefina, Jubaleña and INIAP-Victoria.
While the INIAP-Yana Shungo variety presented the lowest value 5.49 t / ha.
In summary, INIAP-Catalina, Jubaleña, Tushpa, Calvache, INIAP-Josefina, INIAP-
Victoria, INIAP-Gabriela, INIAP-Puka Shungo, Allypacha, INIAP-Fripapa and Puña
Negra varieties showed tolerance to the effect of low temperatures.
From the cold trial in Pichincha 5 varieties were selected with tolerance to frost and good
agronomic performance: INIAP-Catalina, Jubaleña, Calvache, INIAP-Josefina, and INIAP-
Victoria.
Chimborazo
For the field experiment we selected sixteen varieties, it was planted in March, at present
the trial is in progress.
Evaluation of resistance or tolerance to late blight (Phytophthora infestans)
INIAP:
For late blight resistance two field experiments were planted:
Pichincha: Location: Nono (2800 masl), 80 km from Quito.
Chimborazo: Location: Yacupamba (3500 masl), 40 km from Riobamba.
The field experiments were planted in April and May respectively because of the climate
conditions, excessive rain. In the Chimborazo experiment the plants are starting emerging
from the soil.
In the two locations a randomized complete block design with three replicates was
established.
Information about resistance to late blight using percentage of infection in the foliage will
be used according with CIP methodology and transformed to area under diseases progress
curve (AUDPC). At harvest time, yield and its components will be evaluated.
USFQ:
Index of injury to cold exposure
Twenty five potato accessions were planted at the USFQ greenhouse in order to test their
resistance to cold stress. eight tubers per accession were planted in a mixture of
autoclaved black soil and perlite in a proportion 3:1. Plants were cultivated for
approximately three months until they were fully grown and with enough leaves in order
to perform the experiments. After two weeks, 100% germination in all accession was
observed.
The chosen methodology to test the cold resistance was the electrolyte leakage which
many authors have proved its effectiveness to test cellular damage of leaf tissues (Coria,
N 1998; Wallis, J.G., Wang, H. & Guerra, D.J 1997; Donelly, J., Arvin, M. 2008; Bott, A
1989). The plants were put through different temperatures in refrigerators and freezers to
induce cold stress and damage. More electrolyte leakage will represent more cell damage.
Four plants of each potato variety were chosen for each assay. The plants were placed in
a cold room at 15°C for a twelve hour period. 1 plant was left at this temperature and it
will be used as control 15°C. The three remaining plants were placed in a cold room at
4°C for six hours; 1 plant was left there as a control 4°C. The two remaining plants were
put in a -18°C freezer for a total of 12.5 minutes. Each 2.5 min a leaf sample was taken
and five circular discs were taken using a puncher. These discs were put in distilled
water and kept at room temperature for 1 h.
Electrical conductivity was measured with a conductivity meter (JENWAY 470 Cond.
Meter), four measurements were made per sample at each measurement time point. Then
samples containing leaf discs were autoclaved and the electrical conductivity was
measured one more time to identify the maximum possible damage. At this point of the
study nine different varieties have already been tested to cold treatments. Results are
shown below.
Data was collected and the index of injury due to cold exposure was calculated with the
methodology described by Flint, 1967:
Index of injury result to cold exposure of nine different potato varieties vs the time plants were subjected to -18°C. Each measurement was made each 2.5 minutes.
As it can be seen in the Figure, the variety that presented the highest injury index is
Natividad and the one with the lowest is Puca. The index represents the electrolyte
leakage of each variety when submitted to freezing temperatures. The lowest the index
the least electrolyte leakage is present, which can be translated into least cellular damage.
The other 15 varieties will be analyzed in the following days, in order to determine
candidates for genetic improvement. Similar results have been observed in a previous
study conducted in 2013 by Amagua, J. and INIAP where the cold tolerance of 30
different potatoes genotypes were analyzed. According to Amagua the variety Puca has a
great tolerance to freeze temperatures, and in our trials Puca also presented the greatest
tolerance of the nine accesions analyzed. On the other hand, the variety Natividad showed
a great electrolyte leakage in our experiment and in the Amagua study this variety was
one of the most sensitive to this abiotic stress. The results found in this preliminary
screening are consistent to what it has been found in previous studies.
Field Trials
Field trials have been installed in two different locations in the Ecuadorian highlands.
The first is located in the city of Pastocalle, in the Cotopaxi Province, the second in the
city of Cangahua in the Pichincha Province. The two field trials have been handled in
different ways. The field trial in Lasso, Pastocalle, has been handled with the most
rigorous agricultural conventional management, while the field trial in Cangahua has
been handled with less care in order to determine the most tolerant varieties under
adverse conditions.
Once the varieties were grown after three months, measurements of survival,
germination, flowering, presence of insects, diseases and leaf yellowing were taken.
Comparison of phenotypic characteristics after the most rigorous agricultural
conventional management in Lasso, Pastocalle (3197 masl), and poor management
in Cangahua (2790 masl), Ecuador, in order to determine the most tolerant varieties
under adverse conditions.
Variety Pastocalle Cangahua
Natividad
Josefina
Súper Chola
Puca
Related to Output 2 according to Specific Objective 2: Detection of useful candidate
genes (CG) for abiotic and biotic stresses and Analysis of the allelic variation in
these CG.
IBT, INIAP, USFQ: Not involved in this Objective
NEIKER:
A 2.1 Library construction and RNA-Seq
In order to obtain appropriate RNA populations first a small bio assay was set up:
One supposed tolerant potato cultivar, Rudolph, and one susceptible cultivar, Atlantic,
were chosen for the experiment.
Plants from these cultivars were put under heat stress (46-48ºC), under cold stress (8-
10ºC) and under drought stress without irrigation until in all treatments severe stress
symptoms were observed. Leaf samples were taken from each treatment and from the
unstressed controls and frozen at -80ºC until further processing.
Eight cDNA libraries were constructed from these materials, which are shown in Table
2.1. The libraries consisted of adapter-ligated and barcoded restriction fragments of ds-
cDNA.
The following methodology was applied:
Each sample was powdered without thawing in a mortar using liquid nitrogen. Total
RNA was extracted from each sample using the NORGEN Plant RNA Extraction Kit,
following the instructions of the manufacturer. Then poly-A+ RNA was obtained from
total RNA using 5’ biotinylated oligo (dT) primer bound to paramagnetic beads coated
with streptavidin (Dyanabeads M-280 Streptavidin, DYNAL, Oslo, Norway). First and
second strand cDNAs were synthesized according to Sambrook et al. (1989). Double-
stranded cDNA (ds-cDNA) was digested with AseI and TaqI (NEB Biolabs Inc, New
Brunswick, NE, USA). followed by ligation of AseI and TaqI adapters with T4 DNA
ligase (Invitrogen Inc, Barcelona, Spain).
Currently Illumina Primers containing sequences described by Bachem et al (1998).
Figure 2.1 shows the scheme for library construction and Table 2.2 shows the adapter and
primer sequences used for this purpose.
After size selection and purification, samples will be pooled with approximately equal
concentrations and – after quality control using a BIOANALYZER the pool well be sent
for sequencing on an ILLUMINA MySeq sequencing platform (StarSeq GmbH,
Germany).
The results and sequence analyses are pending.
A 2.2 Analysis of known candidate genes for biotic and abiotic stresses.
NEIKER has performed in silico mining of sequence databases and publications in order
to detect published candidate genes for stress tolerance in Potato but also in other species.
In this latter case the Potato homologs were identified through BLAST searches against
the Potato whole genome sequence.
So far a total of 57 candidate genes have been identified. For many of them also the
corresponding primers were identified in exon (=coding) regions, since we work later
with DNA.
All information has been compiled into a CG Database. A partial view is shown in Fig
2.2 of the Annex. This database is also freely available at the project WEB page and
forms part of the Knowledge DB on stress resistance in Potato (see below).
Beside the name and primers sequences to obtain amplicons, in many cases Accession
numbers, gene sequences and amplicon sequences are indicated in this database.
The partners have sent meanwhile plant material from around 180 Potato accessions to
NEIKER in order to extract DNA and continue with amplicon generation, sequencing and
association mapping.
Related to Output 3 according to Specific Objective 3: Association Mapping and
Model Development
A 3.1- Association Mapping
A 3.2 Design of allele specific primers (ASP) for important CG alleles
A 3.3 Model Development
A 3.4 Model Validation and Refinement
(Not yet scheduled)
A 4.1 Performance of crosses between accessions from WP1
IBT: Progenies from breeding activities of one of the INIA collaborators (Dr. Noemí
Zuñiga, INIA, Huancayo) will be available to validate their frost tolerance
under natural conditions and to test de molecular markers for frost tolerance.
INIAP: Based on the previous information of late blight resistance, drought, tolerance
and good agronomic performance, eight potato varieties were selected as parents to be
used in a breeding scheme to combine favorable alleles in superior breeding clones.
These parents are included in the germplasm sent to NEIKER for molecular activities.
Nine crosses were carried out, we obtained 85 families and 4,448 off springs. This
germplasm will be planted the next cycle in nurseries for selection activities (Table 1).
Table 1. Number of crosses and off springs obtained for the Papaclima Project
Crosses Families Off springs
1 Superchola x INIAP-Natividad 2 8
2 INIAP-Natividad x Superchola 25 44
3 INIAP-Natividad x INIAP-Victoria 9 1,400
4 INIAP-Natividad x INIAP-Gabriela 2 246
5 INIAP-Natividad x INIAP-Fripapa 9 2,200
6 INIAP-Natividad x Rubí 2 160
7 INIAP-Natividad x 399079 2 197
8 INIAP-Natividad x Chaucha amarilla 23 158
9 INIAP-Natividad x Chaucha negra 11 35
TOTAL 85 4,448
Related to Output 4 according to Specific Objective 4: Pre-breeding activities to combine
favourable characteristics, to improve adaptation to climate change, and to improve
progeny performance predictions
USFQ: None.
A 4.2 Evaluation of the obtained progenies for agronomic performance and
tolerances - NOT yet scheduled
A 4.3 Application of the developed allele-specific primers for genotype selection. -
NOT yet scheduled
NEIKER: Only involved in A4.3,.NOT yet scheduled
Related to Output 5 according to Specific Objective 5: Dissemination and Transfer
of Project results and Products. A 5.1 Establishment of a Knowledge Base on Analysis and Evaluation of Resistance
/ Tolerance to stresses in Potato
Available external resources of Potato on stress tolerance such as sequences, publications
and others were compiled and all project results including sequences, markers and
primers were integrated into a large database.
The POTATO Knowledge Database for Stress Tolerance has been established in form
of the PATVIEW browser Software. Fig 5.1 in the Annex shows a partial view of the
Software.
The PATVIEW browser pretends to integrate all results obtained within the
PAPACLIMA project with relevant external information and data which are available
elsewhere.
The Main Menu of PATVIEW has currently the following options:
PROJECT - Displays the Workplan of the Project and all Project Results
DATABASES - Displays several Databases used in the PAPACLIMA Project
• CG Database displays the Database of Candidate genes for Stress Tolerance
which are being detected
• AM-Results will display the upcoming Results of Association Mapping in the
future.
SEQUENCES - For retrieving information on molecular resources of
PAPACLIMA, and viewing internal and external sequences with the following options
and sub-options:
• Internal Sequences
- Sequence DB Feedable Sequence Database of genes of interest for the
user
- FASTA File (The corresponding FASTA file)
- External Sequences
- Mol. Resources of Solanum tuberosum
BROWSE-Libs
You can browse and process public available sequences in Solanum spp.
Currently we have implemented S. tuberosum Nucleotides, EST and GSS, as well as the
sequences of the Potato chromosomes and unassembled Contigs.
The integrated Support Database is useful to organize your tasks and research activities.
LIBRARIES
Several Databases are associated which contain information about “Useful Literature”,
“Useful Links” and “external and internal Sequences” of useful genes and transcripts.
These databases can be fed with additional data within the PATVIEW program.
OTHER - Contains options for Configuration and realizing security copies with
the following options:
• Configuration
• DB Security Copies
BLAST - Contains options for performing BLAST searches in local and public
Databases, with the following options:
• Local BLAST Starts the PATBLAST Program
• NCBI Blast Link to the NCBI Blast Page
Most important, it is possible to exploit the data with the coupled PATBLAST tool. (Fig.
5.1 and see User manual for details)
The aim of this program is to provide a simple tool for integrating the PAPACLIMA
Sequence Resources and for performing local Blast searches using a WINDOWS
interface.
This program allows to make BLAST Databases, to perform any BLAST search, to
Browse the available molecular resources as mentioned above and contains several
utilities for merging tables, converting formats and others.
Tis program was mainly used to process the detected candidate genes.
A 5.2: Establishment of a Project WEB Page
Initially the domain: http://www.PAPACLIMA.com has been acquired.
An informative project WEB Page has been established which contains information about
the PPACLIMA project and its participants. Fig. 5.2 in the Annex shows an image of the
Web Page.
Several sections are implemented which will be extended when appropriate. The main
menu of the WEB Page has the topics: General which will contain the WORKPLAN and
all upcoming results.
The topic “Plant Materials & Assays” contains information about the plant material used
and the planned assays by each partner.
The “Methodology” topic contains some general information about agronomic
evaluations, specific protocols on how to evaluate abiotic stresses (drought, cold, others)
and how to evaluate resistance levels to Phytophthora and other pathogens.
Under “Breeding” the different breeding activities of the partners will be shown when
scheduled.
The “Molecular Marker” topic contains several sub-topics such as “CG detection” with
molecular markers for abiotic and stress resistance and the CG database for abiotic
stresses which has been mentioned above.
In the future we will implement here also information and results of Association Mapping
and Model Building.
In the “Dissemination” section all upcoming publications presentations and dissemination
events will be shown.
Finally the “Link” topic presents currently useful links to the POTATO GENOME and
will be further enhanced with additional links in the future.
A 5.3 Dissemination at the scientific / technical level
- The partners participated in the conference:” ALAP 2016 Panamá: XXVII Congreso
de la Asociación Latinoamericana de la Papa”, Panama City, August 22 to 26, 2016.
At his occasion also a Poster was presented with the Title: “MARKER ASSISTED
SELECTION OF USEFUL POTATO GERMPLASM ADAPTED TO BIOTIC
AND ABIOTIC STRESSES CAUSED BY GLOBAL CLIMATE CHANGE”
Moreover, in the frame of this event also a Planning Meeting for the PAPACLIMA
project was held.
- A public, project specific PAPACLIMA Workshop is planned in the frame of the VII
Congreso Ecuatoriano de la Papa, Tulcan, Ecuador, June 29- July 1st 2017
(https://www.congresodelapapa.com), and a Technical Course at INIAP Santa Catalina-
Quito on July 3-7, 2017.
A 5.4 Transfer to the sector (productive chain) A press note about the PAPACLIMA Project will be released by NEIKER in 2017 with
the title: “NEIKER participa en el desarrollo de nuevas variedades de Patata
adaptadas al cambio climático”
INIAP:
Late blight workshop with the participation of 40 assistants among technicians from
different areas: seed production, agrochemicals companies and universities was
developed in INIAP-Sta. Catalina, from 28 to 30 September, 2016. A lecture about potato
breeding for resistance to late blight, was given, a mention was made of the contribution
of “Papaclima” project for the development of breeding potato clones with resistance to
late blight.
Additionally, a field visit was performed in the experiment of late blight and low
temperature tolerance strategies in potato within “Papaclima” project.
For the VII National Potato Congress and the National Potato Day 20 potato varieties that
we are evaluating into the project were planted in Carchi location in two dates: February
14 and April 4. For a field day, that will be conducted on July 1 in Carchi Province.
A 5.5 Establishment of Demonstration Plots
(Not yet scheduled)
2.2.3 Stakeholder/beneficiary group(s) The following individuals, groups of farmers and organizations are the most benefited
from the implementation of the project so far.
IBT
Dr. Noemí Zúñiga and M.Sc Jesús Arcos researchers from The Institute of National
Agrarian Innovation (INIA) at Huancayo and Puno, Perú, respectively, are collaborating
with the Project. They maintain and evaluate potato germplasm for different traits since
more than 10 years ago. Their fields are visited for groups of farmers and will be visited
for the purposes of the project. There is an equal participation of man and women local
beneficiary farmers. Also the National Agrarian University La Molina (UNALM) has a
potato collection from Cuzco region, which are evaluated for agronomic performance and
abiotic stressors since 2013 in collaboration with the local University Universidad
Nacional San Antonio Abad Cuzco (UNSAAC) and three Peasant Communities. The best
clones from these evaluations were included for genotyping on frost tolerance.
INIAP/USFQ
In each of the places for field experiments are local collaborators.
The activities in Chimborazo and Carchi were organized with farmer organizations. Each
organization, provide the field, they are in charge of the crop management and have
active participation in the trial evaluation at flowering, harvest and post harvest. Women
have active participation.
In Carchi the demonstration plots for the Potato Congress, is carried out with a San Juan
farmer organization composed by 15 farmers, 10 men and 5 women (33%).
In Chimborazo in the location Sta. Isabel 30 farmers from the community are involved in
the trial, 18 women have active participation, it represents 60% of the organization.
Furthermore, in the Yacupamba place (Chimborazo): an organization named: “Granito de
Oro” is involved in the experiment, it is composed by 14 women (78%) and 4 men
(22%).
Farmers were contacted in Lasso, Pastocalle, and Cangahua to settle field trials and later
on Field Days.
Staff and their responsabilitties. Percentage woman.
IBT:
Dr. Enrique N. Fernández-Northcote. Project Coordinator. Overall technical and financial
project management, the performance and evaluation of the field trials and for the
dissemination and promotional events.
Dr. Raul Blas. Phenotyping, breeding activities and molecular analysis.
M.Sc. Joel Flores Ticona. Assistant to field trials, breeding activities, molecular analysis
and molecular markers assisted selection.
Dr. Noemí Zúñiga, INIA, Huancayo. Field trials, breeding activities and molecular
marker assisted selection.
M.Sc. Jesús Arcos, INIA, Puno. Field trials, breeding activities and molecular marker
assisted selection.
20% of Women (Dr. Noemi Zuñiga) participation..
Farmers and other stakeholders have been contacted for setting up field trials,
demonstration trials, field days and dissemination at the scientific and technical level at
five regions in Perú: Cajamarca, Junín (Huancayo), Huancavelica, Cuzco, and Puno.
Contacts with farmers/stakeholders ongoing for performing breeding activities trials, and
demonstration of breeding material.
INIAP:
Dr. Xavier Cuesta. Breeding, Drought evaluation. Coordinator at INIAP.
M.C. Jorge Rivadeneira: Progenies and Late Blight evaluation.
MsC. Cecilia Monteros: Cold evaluation.
MsC. Paul Comina: Dissemination and Transfer of Project results and Products. Eng. Johanna Buitron: Biotechnology
40% of Women participation.
Since the 90´s INIAP is working with the active participation of farmers in the selection
of new potato varieties and including gender analysis.
For the activities in Chimborazo and Carchi we organize the different experiments
described above in 2.2.2; A 1.1, A1.2 with farmer organizations.
In Carchi the demonstration plots for the potato Congress, is carried out with a San Juan
farmer organization composed by 15 farmers.
In Chimborazo in the location Sta. Isabel 30 farmers from the community are involved in
the trial, 18 women have active participation.
Furthermore, in the Yacupamba place: an organization named: “Granito de Oro” is
involved in the experiment, it is composed by 14 women and 4 men.
For the breeding activities INIAP is working with the main actors of the potato value
chain (farmers, traders and consumers) using the participatory plant breeding approach.
The experiments actually planted for late blight resistance cold tolerance, additionally to
the technical information, will be evaluated in a participatory way at flowering, harvest
and post-harvest time, and the best varieties will be selected using the criteria of the main
actors of the potato value chain. From the farmers organizations of each location a small
group of 5 – 8 people will be selected and trained in selection of potato varieties, 3 -4
traders will be invited at harvest time. For the taste quality an evaluation panel will be
used. These activities will be developed with the farmers groups of Chimborazo and
Carchi.
USFQ:
Dr. Antonio Leon. Management of the project, Project execution.
B.Sc. Fernando Herrera. Project implementation. Field trials.
Tech. Esteban Espinoza. Lab and field Assistant.
Farmers in Lasso, Pastocalle and Cangahua have been contacted to settle field trials and
later on for Field Days.
About 40% Women farmers participation.
NEIKER: The PAPACLIMA project belongs to WINDOW 3B - IMMEDIATE IMPACT
PROJECTS of the Call and considers mainly transfer of technology.
NEIKER is the Technology Provider and performs intensively Technology transfer to the
other partners by means of training stages and workshops as described in the workplan.
In this sense the stakeholder/beneficiary groups are mainly in the developing partner
countries and targeted particularly by the other partners.
The staff of the PAPACLIMA project is composed of:
Dr. Enrique Ritter (Scientist in charge) involved in the overall project management and
particularly in the Data Analyses aspects in A2i and Model building in A3i.
Dr Jose Ignacio Ruiz de Galarreta involved in setting up experiments in A2.1 and
collaborating in all data analyses.
Dra. Leire Baradalla and collaborating technicians are responsible for the molecular work
in A2i. All staff collaborates in dissemination and transfer activities A5. The share of
woman is around 50%.
OTHER BENEFICIARY GROUPS
At the “ALAP 2016 Panamá: XXVII Congreso de la Asociación Latinoamericana de la
Papa” there were around 500 participants (scientists, farmers and stakeholders; 30%
women). All of them were informed about the activities of the PAPACLIMA project.
Fruitful discussions were established.
2.3. Activities not completed 2.3.1. Describe those activities that were due within the current reporting period but not met and the related changes to the outputs and performance indicators with respect to the initial project proposal.
2.3.2. Provide reasons for non-completion of activities and propose any corrective actions to be taken within the remaining period of project implementation. Implications for the expenditure against the budget should be documented in the Financial Report.
IBT: None were due.
The PAPACLIMA Project is running now (as the end of Februry, 2017) for 8 months
since the FAO signature and 4 months since IBT-UNALM signature. Furthermore funds
were received by the mid of November 2016, and FAO instructions for field materials
availability has not been accomplished yet since an Amendment to the Letter of
Agreement is pending. This has affected initial implementation, local contacts and
agreements and establishment of field trials.
INIAP:
Some field experiments had a delay for the excessive rain, however, at present all the
experiments are planted and will be completed according with the workplan, except the
drought experiment that will be planted on May 2017 under controlled conditions.
USFQ: None NEIKER: None were due. All tasks scheduled in the workplan have been completed
successfully in the reporting period. Good progress has been made towards achieving
pending deliverables.
3. PROJECT RELEVANCE
3.1. Beneficiaries and gender considerations 3.1.1. Specify which individuals, groups and organizations benefited the most from the implementation of the project so far, ensuring that this description is disaggregated according to gender criteria and socio-economic status of people involved.
3.1.2. Specify whether and how project activities took into account the specific needs and interests of women, their knowledge and experience, and specify whether project achievements so far are leading to equitable access and sharing of benefits arising from project activities.
3.1.1 Beneficiaries
The project is eight months in execution, but the expected deliverables are on the pipe.
Field trials are in execution and soon the Andean farmers will have recommended
cultivars or accessions at their disposal that can be grown under harsh and adverse agro-
climatical conditions. Breeding activities are already being performed. In the near future
Potato varieties with improved properties such as tolerances and resistances to abiotic and
associated biotic stresses which are adapted to the global climate change will be obtained
for sustainable agriculture. Supported by the different planned dissemination actions we
expect to target over 500 farmers and their families in each country.
Useful candidate genes for stress adaptation are already available and the molecular work
is underway. Breeders and researchers will have a set of molecular markers and
predictive models useful for assessing adaptation to abiotic stresses in germplasm,
progenitors and breeding clones at their disposal, which can be used to develop novel
Potato varieties.
The project WEB Page and the foreseen congress presentations of project results will
allow targeting at least 500 scientists.
3.1.2 Gender Considerations
There are no restrictions upon the diffusion of results.
Due to the nature of this project, Men and Woman will benefit equal from the output.
3.2. Contribution to science and innovation for better conservation and use of PGRFA. 3.2.1. Describe any scientific achievements and innovative practices related to PGRFA conservation and use introduced so far trough the activities of the project specifying the methodology used and people involved.
3.2.2. Describe the achievements of this project so far in terms of identification and development of climate change adaptation strategies trough better use of PGRFA.
3.2.3. Describe any relevant findings related to collection, characterization, evaluation, breeding improved monitoring capacities for pests and diseases, dissemination among farmers of improved varieties, introduction of better crop management technologies/systems etc. carried out to date, specifying the methodology used and people involved.
3.2.1 Contribution to science and innovation and
3.2.2 Contribution to better conservation and use of PGRFA
Promising accessions selected for validation by the project methodology and genomic
attributes detected by molecular markers could be soon used by farmers.
The partners have sent around 180 POTATO accessions to NEIKER in order to extract
DNA and continue with the tasks of amplicon sequencing and association mapping.
Fiftyseven novel candidate genes for stress adaptation in Potato have been already
detected and the molecular work is underway. The knowledge and molecular data
generated by the project are useful to increase the information about the entries of a
Germplasm Bank, and can be integrated in the passport data. They will provide
guidelines for the functional biodiversity conservation of useful gene alleles for
characters of interest, improving the representativeness and usefulness of the entries in a
Germplasm Bank. The available information increases the use of such banks by the
breeders, due to the availability of markers for assisted selection in genetic improvement
programs.
Potato breeders will have improved breeding clones as progenitors at their disposal which
can be used to develop novel Potato varieties.
3.2.3 Relevant Findings From the cold trial in Pichincha 5 varieties were selected with tolerance to frost and good
agronomic performance.
Sequences of 57 novel candidate genes for stress adaptation or they orthologs have been
detected in Potato.
Amplicons can be obtained in Potato using the designed primers.
3.3. Contribution to capacity development List the main training and capacity building activities undertaken in the reporting period, subjects addressed trough training, capacities developed, the type of activities undertaken and the number of direct and indirect beneficiaries of these activities making sure to disaggregate the analysis by gender and socio-economic status of people involved.
The project is only eight months in execution, but there is already some planning to start
the training stages at NEIKER as described above.
On the other hand a public Workshop on stress adaptation in Potato is planned at the end
of June, 2017 at INIAP (Ecuador). All generated project results, knowledge,
methodologies will be transferred to the public. In addition, in a specific TT workshop
partners will be trained in data analyses and Software will be transferred to partners in
order to strengthen their capacities. Partners will in turn transfer the acquired items to
their national researchers and project target groups.
4. METHODOLOGY OF THE MIDTERM MONITORING
4.1. Monitoring approach
Briefly describe who was involved in conducting the monitoring process, their roles and responsibilities, the overall monitoring approach, methods and instruments used to collect data and information (e.g. individual interviews, household interviews/surveys, focus groups discussions, observations etc.) as well as places visited during the reporting process.
Monitoring was performed by the members of the implemented Management structure
described above.
General communication between the project partners were realized frequently via email
or Skype. In addition, to enhance the exchange of data and ideas and to enable the
coordinator to closely follow the progress (and interfere if necessary) each partner
provided regularly the coordinator with informal progress reports, who distributed the
information via email.
The monitoring of activities and progress was greatly facilitated by the chronogram for
the planned R&D tasks which had been established.
An initial Planning Meeting for the PAPACLIMA project was held in the frame of ALAP
2016 “XXVII Congreso de la Asociación Latinoamericana de la Papa” in August 2016
with all partners in order to plan and coordinate the R&D activities, to present and
discuss the obtained results and to discuss training and TT courses.
The next annual meeting is foreseen for July 2017 at INIAP, Ecuador, within the frame of
the Workshop and TT course.
4.2. Challenges and major issues identified in conducting the monitoring
Provide a short description of the major constraints encountered during the monitoring process.
NO mayor issues or difficulties were found when conducting the monitoring.
5. RISK ASSESSMENT AND MANAGEMENT Fill in the Risk Assessment Matrix in Annex1. It is intended to reveal possible risks in the project implementation and identify possible management strategies for tackling such risks. The risk management strategies may require modifications in the project framework, work plan and distribution of funds.
See below the completed Matrix.
6. BEST PRACTICES Identify good practices, successful experiences or transferable examples arising from the activities carried out during the reporting period and specify to what extent those have been shared and disseminated among stakeholders.
The project is only 8 months in execution and it is early to describe all expected best
practices.
However, during the ALAP congress 2016 where the project was presented the
participating scientists, farmers and stakeholders showed large interest in the project and
its activities. Fruitful discussions could be established with the participants.
Also the farmers which were observing the field trial and breeding activities showed large
interest in the project.
Most of the farmers involved in the field activities are aware of the negative effects of the
climate change, they explain us that in some places there is no planting dates as in the
past, the rain in some months is extremely excessive, while in others places drought and
frost are growth restricting factors, late blight is more difficult to control.
For these reasons they are very interested in the project, since they expect that the new
germplasm obtained could be an important tool of adaptation to climate change of potato
crop.
7. SIGNATURE
......................………………………………. …………………………………. Contact person (Name, position) Author of this report (name and
position). Enrique N. Fernandez-Northcote, Enrique N. Fernandez-Northcote, Project Coordinator, Project Coordinator, Institute of Biotechnology Institute of Biotechnology UNALM UNALM his report must be signed by: i) the contact person; and ii) the responsible designated for monitoring the project as per information provided in the Project Proposal Form. Explicatory note: Please indicate the name and the position of the person who is signing. Any variation with the information provided in the Project Proposal Form should be reported to the Secretariat of the IT-PGRFA.
ANNEX 1: RISK ASSESSMENT MATRIX
Risk factor
Indicator of Risk
Indicate the level
of risk
Brief explanation of risk level (provide here below information
you deem necessary to justify the level of risk) Max 100 words
Strategy for risk management adopted (if the level of risk is medium or high)
Max 100 words
Environmental conditions
Low risk: Project area is not affected by severe weather events or environmental stress factors.
Medium Risk: Project area is subject to more or less predictable climate events (link from below): 1. Drought 4. Hailstones 7. Diseases 2. Runoff 5. Excessive rains 8. Noxious weeds 3. Cold weather 6. Pests
High Risk: Project area has very harsh environmental conditions (link from below): 1. Drought 4. Hailstones 7. Diseases 2. Runoff 5. Excessive rains 8. Noxious weeds 3. Cold weather 6. Pests
“HIGH” According to the nature of the project the field trials are specifically conducted in these areas in order to identify tolerant or resistant accessions
Social, cultural and economic
factors
Low Risk: There are no apparent economic, social, and/or cultural issues that may affect project performance and results.
LOW
Medium Risk: Social or economic issues pose challenges to project implementation but mitigation strategies have been developed.
High Risk: Project implementation is highly sensitive to socio-economic issues and cultural barriers.
Capacity issues
Low Risk: Sound technical and managerial capacity of the implementing institution and the project partners.
LOW
Medium Risk: Weaknesses exist but have been identified and actions taken to build the necessary capacity.
Risk factor Indicator of Risk Indicate the level
of risk
Brief explanation of risk level (provide here below information
you deem necessary to justify the level of risk) Max 100 words
Strategy for risk management adopted (if the level of risk is medium or high)
Max 100 words
Stakeholder involvement
Low Risk: All partners involved and positive feedback from stakeholders and partners received.
LOW The participating institutions are well connected to the potato sector.
Medium Risk: Consultation and participation processes seem strong but ignore some groups or relevant partners.
High Risk: Signs of conflict with critical stakeholders or evidence of lack of interest from partners and /or stakeholders detected.
Management structure
Low Risk: Roles are stable and responsibilities are clearly defined and understood.
LOW A project management board and appropriate management structures have been installed as described. All partners have large experience in managing international R&D Projects
Medium Risk: Individuals understand their role but are unsure of responsibilities of others.
High Risk: Unclear responsibilities or overlapping functions which lead to management problems.
Governance structure
Low Risk: Steering Committee and/or other project bodies meet periodically and provide effective direction/inputs.
LOW Local Steering Committees are in place at each partner institution monitoring finances and technical progress of the project
Medium Risk: Project bodies meet periodically but guidance/input provided to project is inadequate.
High Risk: Members lack commitment (rarely meet) and therefore the project body/ies do not fulfill their functions.
Short term/long
Low Risk: Project is meeting short term needs and results within a long term perspective, particularly sustainability and replicability.
LOW As can be seen in the proposal special emphasis is given to
term balance achieve a long term Sustainability of the project. The different tools for dissemination and transfer implemented in the project are useful to achieve this goal, as well as the connections with the national and international Potato sectors.
Medium Risk: Project is focused on the short term outlook with little consideration or interest in the long term perspective.
High Risk: Longer term issues are deliberately ignored or neglected.
Risk factor
Indicator of Risk
Indicate the level
of risk
Brief explanation of risk level (provide here below information
you deem necessary to justify the level of risk) Max 100 words
Strategy for risk management adopted (if the level of risk is medium or high)
Max 100 words
Co-financing (indicate the
amount) USD:
Low Risk: Co-financing is secured and payments are received on time. LOW The co-financing is secured and the payments are received on time. No problems with the first payment, despite a smaller delay!
Co-Financing (US$) IBTI: 132 000 INIAP: 130 500 USFQ: 127 500 NEIKER: 132 000
Medium Risk: Co-financing is secured but payments are slow and bureaucratic.
High Risk: A substantial part of pledged co-financing may not materialize.
Subcontracting and
procurement
Low Risk: Sub-contracting is guaranteed and procurement arranged on time.
LOW The partners have networks of well-known and reliable sub-contractors.
Medium Risk: Sub-contracting is guaranteed but procurement of goods is slow and bureaucratic.
High Risk: Sub-contracting is compromised and so is the procurement of goods.
Budget
Low Risk: Activities are progressing within planned budget. LOW As can be seen in this report the activities are progressing within planned budget.
Nevertheless, with respect to Field trail materials a Procurement Issue with FAO is pending which has to be solved quickly!. There have been already expenses to be covered with available funds.
Medium Risk Minor budget reallocation is needed.
High Risk: Reallocation between budget lines exceeding XXXX of original budget is needed.
Workflow
Low Risk: : Project is progressing according to work plan LOW As can be seen in this report the project is progressing according to the workplan
Medium Risk : Changes in project work plan occurred without major effect on overall implementation.
High Risk: Major delays or changes in work plan or method of implementation have occurred.
34
ANNEX NEIKER: Tables and Figures Table 2.1: Materials and Treatments used for Library constructions Nº GT Treatments I5 I7 Nº of poly RAD 1 Rudolph Control D501 D701 2 Rudolph Drought D501 D702 3 Rudolph Cold D501 D703 4 Rudolph Heat D501 D704 5 Atlantic Control D502 D701 6 Atlantic Drought D502 D702 7 Atlantic Cold D502 D703 8 Atlantic Heat D502 D704
I5/I7 = Illumina Indexes
Fig. 2.1: Scheme for producing barcoded amplicons from restriction fragments (RF) in Library Construction Fig. 2: Scheme for producing new Illumina Indexed amplicons from restriction fragments (RF) in Lib Construction
Adapter Ligation IL-A IL-B
RF with adapters Rest.Frag. (RF) /CG
IL-A IL-B
Illumina Primers: IL5, IL7 P5 I5 I7 P7
PCR I
Final Amplicon P5 I5 IL-A IL-B I7 P7
* I5 = SA5xx, SB5xx, SC5xx ; I7 = SA7xx, SB7xx, SC7xx
35
Table 2.2: Primer, Adapter and Index Primer sequences used for Library construction (TruSeq HT Kits)
1. Index Adapters:
P5 with I5ii Indexes: 5’ AATGATACGGCGACCACCGAGATCTACAC[I5ii]ACACTCTTTCCCTACACGACGCTCTTCCGATCT <xxxxx CG or RF ...
Same as for the PCR reaction! P7 with I7ii Indexes: ...xxxx CG or RF > GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[I7ii]ATCTCGTATGCCGTCTTCTGCTTG
But for the PCR the reverse complements are used: (also SA7ii etc have to be inverted!) 5’ CAAGCAGAAGACGGCATACGAGAT[I7ii_i]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
In RED Flow Cell Adapter P5 or P7 respectively! In yellow Sequencing Primers, In Bold CG /RF specific Adapter Parts
2. RF Adapters:
ASE TAQ
5´ AT↓TA AT.... .... 5' T↓CG A 3' 3´ TA AT↑TA.... .... 3' A GC↑T 5'
a) ASE Adapter CGACGCTCTTCCGATCTTAAT .... ASE Top: 5´CGACGCTCTTCCGATCT
GAGAAGGCTAGAATTA ... ASE Bot: 5´TAAGATCGGAAGAG
b) TAQ Adapter .... TCG GATCGGAAGAGCA TAQ Top: 5´ CGGATCGGAAGAGCA
.... AGC CTAGCCTTCTCGTGTG TAQ Bot: 5´ GTGTGCTCTTCCGATC
Preamp Adapter ASE: Preamp Adapter TAQ:
ACACGACGCTCTTCCGATCTTA AGACGTGTGCTCTTCCGATCTC
3. INDEX Sequences:
D501 TATAGCCT D701 ATTACTCG
D502 ATAGAGGC D702 TCCGGAGA
D703 CGCTCATT
D704 GAGATTCC
36
Fig. 2.2: Partial view of the CG Database for Stress tolerance genes
37
Fig. 5.1: Partial view of the PATVIEW Knowledge DB
38
Fig. 5.2: Partial view of the coupled PATBLAST tool
39
Fig. 5.3: Partial view of the PAPACLIMA Project WEB page (http://www.papaclima.com)
40
ANNEX INIAP: Table 2.2.2.1.1
Table 2.2.2.1.1 Average of yield and its components, tuber maturity and frost damage in INIAP-
Sta. Catalina Research Station, Pichincha, 2017.
Varieties t/ha TP RP E1 E2 E3 MT
Calvache 37.57 g* 13 bcdef 1.54 f 2 ab 1 a 1 ab 5
I-Natividad 35.32 fg 11 abdef 1.41 def 3 abc 1 ab 1 abc 4
I-Raymipapa 33.97 efg 9 abc 1.39 cdef 3 abc 2 ab 1 abc 4
I-Catalina 33.84 efg 16 fg 1.45 ef 1 a 1 a 0 a 4
I-Josefina 31.99 defg 12 abdef 1.23 bcdef 2 ab 1 a 1 ab 3
Jubaleña 31.18 cdefg 16 efg 1.44 ef 1 a 1 a 0 a 5
I-Victoria 30.64 cdefg 12 abdef 1.23 bcdef 2 abc 1 a 1 abc 3
I-Estela 30.4 cdefg 14 cdefg 1.32 bcdef 3 abc 1 a 2 bc 4
Superchola 26.73 bcdefg 12 bcdef 1.23 bcdef 3 abc 2 abc 1 ab 4
I-Gabriela 26.29 bcdefg 16 efg 1.05 abcdef 2 abc 1 ab 1 abc 5
I-Puka Shungo 25.62 bcdefg 10 abdef 1.16 bcdef 2 abc 1 a 1 abc 3
Capiro 25.42 bcdefg 12 bcdef 0.85 abcde 3 abc 1 a 2 c 4
Tushpa 25.42 bcdefg 16 fg 1.23 bcdef 1 a 1 a 0 a 5
I-Cecilia 24.28 bcdefg 20 g 1.19 bcdef 3 abc 1 ab 2 bc 5
I-Fripapa 23.7 bcdefg 9 abc 0.96 abcdef 2 abc 1 ab 1 abc 3
Uvilla 21.89 bcdef 16 fg 1.1 abcdef 3 abc 2 abc 1 ab 5
Allypacha 21.18 bcdef 14 bcdefg 1.09 abcdef 2 abc 2 ab 1 ab 3
Puña Negra 20.64 bcdef 15 defg 1.12 abcdef 2 abc 2 abc 0 a 5
Premium 19.17 abcde 11 abdef 0.77 abc 4 cb 3 bc 1 ab 3
Carolina 17.78 abcd 9.2 abcd 0.8 abcd 4 bc 3 abc 1 ab 2
Leona Negra 17.57 abcd 13.13 bcdef 1 abcdef 3 abc 2 abc 0 a 5
I-Libertad 16.53 abc 7.5 ab 0.81 abcd 4 bc 3 bc 0 a 2
Lila Shungo 13.67 ab 9.6 abcde 0.7 ab 3 abc 3 abc 0 a 3
I-Yana
Shungo
5.49 a 5.53 a 0.5 a 5 c 4 c 1 ab 3
t/ha yield in ton per hectare; TP Number of tubers per plant; RP yield per plant; E1 E2 E3 frost damage; MT tuber
maturity; MT: 1 very early (<120 days); 2 Early (120-139 days); 3 Intermediate (140-159 days); 4 Late (160-a 180
days); 5 Very Late (>180 days)
* Different letters indicate significant differences between varieties according to the Tukey HSD test (P<0.05).