barcode wales: dna barcoding the flora of wales natasha de vere, tim rich, col ford, sarah trinder,...

19
Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite, Helena Davies, Joe Moughan, Addie Griffith, Laura Jones, Joel Allainguillaume, Mike Wilkinson, Kevin Walker, Tatiana Tatarinova, Hannah Garbett, Les Baillie, Jenny Hawkins

Upload: zoe-holly

Post on 01-Apr-2015

220 views

Category:

Documents


4 download

TRANSCRIPT

Page 1: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Barcode Wales: DNA barcoding the flora of Wales

Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite, Helena Davies, Joe Moughan, Addie

Griffith, Laura Jones, Joel Allainguillaume, Mike Wilkinson, Kevin Walker, Tatiana Tatarinova, Hannah Garbett, Les Baillie, Jenny Hawkins

Page 2: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

DNA barcoding

• DNA based species identification

• Once reference barcodes are established will always be able to identify that species

• Internationally agreed regions of DNA used: rbcL & matK for plants

• Open science

>Cotoneaster_cambricus

AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGTCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAGGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATAAAACCAAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTC

Page 3: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

What do they eat?

Is this legal?What pollen is it carrying?

What’s in this?

Page 4: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Barcode Wales: Cod Bar Cymru

• DNA barcode the native flowering plants and conifers of Wales

• Develop applications that utilise this research platform

Page 5: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Sample collection

• 1143 native flowering plants and conifers

• 4272 individuals sampled, 3637 herbarium, 635 freshly collected

• All specimens verified by taxonomic expert

• Herbarium vouchers and full collection details for all samples

Page 6: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

DNA barcoding protocol • DNA extraction: Qiagen kits,

modified for herbarium material

• Amplification: rbcL 5 & matK 23 primer combinations

• Sanger sequencing• Manual editing, multiple

alignment• Sequences uploaded onto

BOLD & GenBank – publically available

Page 7: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

de Vere N, Rich TCG, Ford CR, Trinder SA, Long C, et al. (2012) DNA Barcoding the Native Flowering Plants and Conifers of Wales. PLoS ONE 7(6): e37945.

Page 8: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Recoverability

rbcL matK rbcL & matKNo. of spp. sequenced (1143) 1117 (98%) 1031 (90%) 1025 (90%)No. of spp. with > 1 individual sequenced

1041 (91%) 814 (71%) 808 (71%)

Mean no. of individuals per spp.

3 2 2

Mode of individuals per spp. 3 3 3Range of individuals per spp. 1 - 9 1 - 8 1 - 8Total no. of individuals sequenced

3304 2419 2349

In total 5,723 barcode sequences obtained for the 1143 species

Page 9: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Effect of herbarium specimen age

Spearman Rank Correlation:rbcL rho = 0.993***matK rho = 0.986***

Page 10: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Relative discrimination808 species with multiple individuals sequenced for both rbcL & matK

69

75

5756

74

68

99

1009899

9695

Page 11: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

rbcL & matK discrimination

Scale n Mean discrimination % (SD)

10x10 km 253 82 (3)

2x2 km 1116 93 (6)

Species lists generated for each square, discrimination assessed by presence of a barcode gap

Page 12: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Roots, shoots and pollen

• Root analysis• Identification at

single pollen grain resolution

• Identification of pollen products

Gives a feeling “of Youthful Exuberance!”

Page 13: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Honey and drug discovery

• Collect honey from throughout the UK.

• Test antibacterial properties of honey against MRSA and Clostridium difficile.

• DNA barcode honey using next generation DNA sequencing (454).

• Identify plant derived phytochemicals that increase antimicrobial activity.

Page 14: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

MRSA – prelim results

Page 15: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,
Page 16: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

DNA barcoding and phylogenetics

ML tree for rbcL,RAxML (GTR+CAT)1000 bootstraps, on the CIPRES supercomputer cluster

56% of species form monophyletic groups

44% with bootstrap support >70%

Page 17: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

DNA barcoding and phylogenetic ecology

ML tree for rbcL, threatened species traced using Mesquite

Page 18: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

What’s next?

• Barcode UK• Barcode Alien• Phylogeny for the

UK flora• Development of

bioinformatic tools• Diet analysis of

endangered species • Pollinator services

Page 19: Barcode Wales: DNA barcoding the flora of Wales Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite,

Thank you!

• Funding from Welsh Government, National Botanic Garden of Wales, National Museum Wales, Countryside Council for Wales

• Sponsorship from the people of Wales• www.gardenofwales.org.uk• Science at the Garden of Wales on Facebook