balestrini et al defining atm-independent functions of the ... · balestrini et al 1 defining...
TRANSCRIPT
![Page 1: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/1.jpg)
Balestrini et al
1
Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse
Model
Alessia Balestrini1, Laura Nicolas2, Katherine Yang-lott3,4, Olga A. Guryanova5,
Ross L. Levine5, Craig H. Bassing3,4, Jayanta Chaudhuri2, John H.J. Petrini1 *
1Molecular Biology Program, Sloan-Kettering Institute, New York, NY, USA
2 Immunology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA
3 Department of Pathology and Laboratory Medicine, Center for Childhood Cancer
Research, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania, PA
4 Abramson Family Cancer Research Institute, Department of Pathology and Laboratory
Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA
5 Human Oncology and Pathogenesis Program, Leukemia Service, Department of
Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY, USA
*Corresponding author: John H. J. Petrini, Memorial Sloan-Kettering Cancer Center,
1275 York Avenue, New York, NY 10065. Phone: 212-639-2927, Fax: 646-422-2062,
Email: [email protected]
Keywords:
Mre11 complex, ATM, ATR, DNA repair, lymphomagenesys, common fragile sites, DDR
network
Conflict of Interest
The authors disclose no potential conflicts of interest
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 2: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/2.jpg)
Balestrini et al
2
ABSTRACT
The Mre11 complex (Mre11, Rad50 and Nbs1) occupies a central node of the DNA
damage response (DDR) network, and is required for ATM activation in response to
DNA damage. Hypomorphic alleles of MRE11 and NBS1 confer embryonic lethality in
ATM deficient mice, indicating that the complex exerts ATM independent functions that
are essential when ATM is absent. To delineate those functions, a conditional ATM
allele (ATMflox) was crossed to hypomorphic NBS1 mutants (Nbs1∆B/∆B mice). Nbs1∆B/∆B
Atm-/- hematopoietic cells derived by crossing to vavcre were viable in vivo. Nbs1∆B/∆B
Atm-/- VAV mice exhibited a pronounced defect in double strand break (DSB) repair, and
completely penetrant early onset lymphomagenesis. In addition to repair defects
observed, fragile site instability was noted, indicating that the Mre11 complex promotes
genome stability upon replication stress in vivo. The data suggest combined
influences of the Mre11 complex on DNA repair, as well as the responses to DNA
damage and DNA replication stress.
Implications: A novel mouse model was developed, by combining a vavcre inducible
ATM Knock-out mouse with a NBS1 hypomorphic mutation, to analyze ATM-
independent functions of the Mre11 complex in vivo. These data show that the DNA
repair, rather then DDR signaling functions of the complex are acutely required in the
context of ATM deficiency to suppress genome instability and lymphomagenesis.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 3: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/3.jpg)
Balestrini et al
3
INTRODUCTION
The maintenance of genome stability and suppression of malignancy depend on
the DNA damage response (DDR), a network of pathways comprising signal
transduction, cell cycle regulation, and DNA repair (1). The Mre11 complex, composed
of Mre11, Rad50 and Nbs1, plays a central role in the DDR. In addition to sensing DNA
double strand breaks (DSB) and promoting DNA repair, the complex is required for
Ataxia-telangiectasia mutated (ATM) kinase activation and signaling to govern DNA
damage checkpoints and apoptosis (2).
Ataxia-telangiectasia (A-T) and Nijmegen breakage syndrome (NBS) are two
distinct, but related single gene disorders caused by mutation in ATM and NBS1,
respectively. A-T and NBS patients share several clinical and cellular phenotypes
characterized by immunodeficiency, sterility, radiosensitivity and cancer predisposition
(3, 4). These phenotypic similarities highlight the functional relationship between the
Mre11 complex and ATM.
ATM and the Mre11 complex are involved in specialized DSB-repair mechanisms
including V(D)J recombination, class-switching (2, 3, 5). Most of the studies concerning
the role of the Mre11 complex in these processes rely on effects observed upon
deletion of one of its subunits (6) (7). However, it is conceivable that abnormal cell
cycle progression, proliferation and increased mortality consequent to Mre11 complex
ablation have impeded an appropriate characterization of its influence, as well as its
relationship with ATM, in the repair of physiological breaks.
Despite phenotypic similarities between the Mre11 complex and ATM mutants,
and the requirement for the Mre11 complex to activate ATM, several lines of evidence
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 4: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/4.jpg)
Balestrini et al
4
indicate that the Mre11 complex exerts ATM independent functions. First, ATM null
mice are viable, whereas loss of any subunit of the Mre11 complex is lethal in cultured
cells and in vivo (4). Second, ATM deficiency is synthetically lethal with Mre11 complex
hypomorphic mutations (Nbs1∆B and Mre11ATLD1 ) (8-10). We consider two non-
exclusive possibilities for the embyronic lethality observed. First, reduction of
checkpoint functions ensuing from ATM deficiency may be lethal in combination with
DNA repair defects associated with Nbs1 hypomorphism. Second, the Mre11 complex
may influence ATM independent DDR signaling. In this scenario, a decrement in ATR
or DNAPKcs activation may be incompatible with the viability of ATM deficient embryos.
Recent data suggest that the Mre11 complex may influence the activation of ATR
(11, 12). These data predict roles for the Mre11 complex in the cellular response to
DNA replication stress, which is mediated predominantly by ATR, in addition to its role
in activating ATM in response to DNA damage (13, 14). However, the significance of
Mre11 complex-dependent regulation of ATR has not been assessed in vivo. Here we
crossed a conditional ATM mutant, ATMflox (15) with Nbs1∆B/∆B mice to circumvent the
synthetic embryonic lethality of Atm-/- Nbs1∆B/∆B double mutants, and create a context in
which the ATM independent functions of the Mre11 complex could be assessed in vivo.
We used a vavcre mouse (16) to ablate ATM in hematopoietic stem cells of
Nbs1∆B/∆B Atmflox/- mice. Nbs1∆B/∆B Atm-/- VAV mice exhibited defects in lymphoid
development, with impaired developmental progression during class switching (CSR),
reflective of a severe defect in DSB repair during CSR. Double mutant mice also
displayed increased spontaneous chromosomal instability and completely penetrant
lymphomagenesis by eight months of age. These data support the view that the DNA
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 5: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/5.jpg)
Balestrini et al
5
repair functions of the Mre11 complex are acutely required in the absence of ATM.
Conversely, the DDR signaling phenotype of Nbs1∆B/∆B Atm-/- mice is not consistent with
the Mre11 complex exerting a strong influence on ATR activation in vivo. The data
suggest that synergy of Mre11 complex hypomorphism and ATM deficiency primarily
reflects the importance of the Mre11 complex as an effector of DNA repair.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 6: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/6.jpg)
Balestrini et al
6
EXPERIMENTAL PROCEDURES Mice
Animal use protocols were approved by the Institutional Animal Care and Use
Committee of Memorial Sloan-Kettering Cancer Center. ATMflox and vavcre mice were
obtained from F. Alt and M. Stadfeld, respectively. Nbs1ΔB mouse was described (8).
Mice were housed in ventilated rack caging in a pathogen-free facility and genotyped by
PCR (details upon request).
Cell purification and culture
Murine embryo fibroblasts (MEFs) were generated, cultured and immortalized as
described (41). SV40 immortalized Nbs1∆B/∆B Atm-/- MEFs were generated from
Nbs1∆B/∆B Atmflox/- mice by infection with cre-green fluorescent protein vector-based
lentivirus. Lentiviral production, concentration, and titering were carried out using
previously described methods (42, 43). 5 × 104 cells were resuspended in 3 mL of
DMEM supplemented with 10% CCS containing 5 μg/mL polybrene and cre-lentivirus at
a multiplicity of infection (m.o.i.) of 10 followed by clonal selection. Positive clones were
identified by PCR and suppression of ATM gene product expression was confirmed by
western blot. Atm-/- genotyping was carried out with the following primers:
ATMgF86723 (5’ ATCAAATGTAAAGGCGGCTTC 3’), and ATM BAC7 (5’
GCCCATCCCGTCCACAATATCTCTGC 3’). The 903 bp product corresponding to
ATM deletion was detected by agarose gel electophoresis.
Murine splenic B cells were isolated using CD43 Microbeads (Miltenyi Biotec) and
cultured at a density of 1 × 106 cells/ml in RPMI 1640 supplemented with 15% (v/v) FBS,
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 7: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/7.jpg)
Balestrini et al
7
100 U/ml of penicillin, and 0.1 mg/ml of streptomycin, 1% (v/v) glutamine and 10 mM β-
mercaptoethanol. Stimulation for CSR was achieved with 1 μg/ml anti-CD40 antibody
(eBioscience) and 12.5 μg/ml IL-4 (R&D Systems).
Lymphocyte analyses and flow cytometry
Lymphocyte populations were analysed by flow cytometry in single cell suspensions
from thymus and bone marrow. Cells were depleted of red blood cells by hypotonic
lysis and maintained in PBS. Labelled antibodies specific for CD45R/B220
(phycoerythrin), IgM (FITC), CD43 (FITC), Cd11b (phycoerythrin), Gr-1 (FITC), TER119
(FITC), CD8a (FITC), CD4 (phycoerythrin) were from BD Biosciences PharMingen.
Dead cells were excluded by DAPI staining. The data were collected on an LSR-
Fortessa flow cytometer (Becton Dickinson) and were analysed with FlowJo software
(TreeStar).
For flow cytometric analyses of CSR, cells were resuspended in PBS with 2% BSA and
stained with APC-conjugated-anti-IgG1 antibody (X56, BD Pharmingen).
Cell proliferation by SNARF labelling was performed as described (44).
Germline transcripts were analysed as described (45).
For the analysis of switch junctions, genomic DNA was prepared from B cells stimulated
with αCD40/IL-4 for 72 h. Sμ-Sγ1 junction DNA was amplified by PCR (38 cycles) using
Sμ and Sγ1 primers (46). The PCR products, which spanned from 1–2 kb, were gel-
extracted, cloned, sequenced and analyzed as previously described (44).
Immuno-FISH was carried out as previously described (47).
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 8: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/8.jpg)
Balestrini et al
8
FISH probes
We detected the 3′ end of the IgH locus using BAC199 and the 5′ end using BAC207 (a
gift of Fred Alt lab, Howard Hughes Medical Institute, The Children's Hospital, Boston).
BAC 97L3 and BAC 307011 that mark either side of the CFS were used for Fra8E1.
Chromosome analysis and fluorescence in situ hybridization (FISH).
Chromosome spreads preparation from splenocytes and SV40 immortalized MEFs were
performed as previously described (41). Briefly, cells were incubated in 50 ng/ml
colcemid (KaryoMAX, GIBCO), harvested, hypotonically swelled with 0.075 M KCl for
15 min at 37°C, fixed, washed in ice-cold 3:1 methanol:acetic acid, and dropped on
slides. Slides were stained with 5% Giemsa (Sigma) for 10 min and rinsed with distilled
water, and coverslips were mounted with Permount (Fisher). Images were captured
using an Olympus IX60 microscope and imaged with a Hammamatsu CCD camera.
More than 50 spreads were scored for each sample. Two-Color FISH was performed
as described (23).
Spectral karyotyping
Metaphases from thymic lymphomas were obtained as described (48). Spectral
karyotyping was performed per instructions (Applied Spectral Imaging, ASI). Slides
were examined with a BX61 microscope (600x magnification) from Olympus controlled
by a LAMBDA 10-B Smart Shutter (Sutter Instrument). Images were captured using a
LAMBDA LS light source (Sutter) and a COOL-1300QS camera (ASI), and analyzed by
Case Data Manager Version 5.5 (ASI).
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 9: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/9.jpg)
Balestrini et al
9
Thymocyte apoptosis
Thymi were harvested in 10 ml of RPMI/3% FCS from 6- to 9-week-old animals, and
washed twice before plating. For each genotype and treatment, 1 × 106 thymocytes
were plated in triplicate in 1 ml of supplemented RPMI. 20 h after the mock or 5 Gy IR
treatments, cells were harvested for AnnexinV-FITC staining (BD Biosciences). Cells
were analyzed within 3 h after staining on a LSR-Fortessa flow cytometer (Becton
Dickinson) and were analysed with FlowJo software (TreeStar).
Immunoblotting
Western blots were carried out on 40 μg of protein extracted with NTEN (20 mM Tris at
pH 8, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) plus protease and phosphatase
inhibitors. All of the antibodies were incubated overnight at 4°C in 2% milk. The
antibodies used were rabbit anti-Rad50 polyclonal, rabbit anti-Nbs1 polyclonal, and
rabbit anti-Mre11 polyclonal previously described (49), ATM (Cell Signaling), RPA32
pSer4/Ser8 (Bethyl Laboratories), Chk1 (C9358, Sigma), Chk1 pSer345 (Cell
Signaling), AID (50)), GAPDH (6C5, Millipore) and Smc1 (Cell Signaling).
RESULTS
To define ATM independent functions of the Mre11 complex, we established Nbs1∆B/∆B
Atmflox/- double mutant mice. Cre-mediated deletion of the residual wild type ATM allele
(ATMflox) was effected in immortalized fibroblasts in vitro via infection with cre-encoding
lentivirus, and in vivo by vavcre, the expression of which is restricted to hematopoietic
stem cells (Fig. 1A and Supplementary Fig. 1A).
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 10: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/10.jpg)
Balestrini et al
10
DNA-repair defects in Nbs1∆B/∆B Atm-/- double mutant cells
Although Nbs1∆B/∆B Atm-/- embryos were inviable (8), we determined that viable
Nbs1∆B/∆B Atm-/- MEFs could be obtained. Immortalized Nbs1∆B/∆B Atmflox/- fibroblasts
were infected with a cre-expressing lentivirus and plated for colony formation. From
approximately 80 colonies, seven Nbs1∆B/∆B Atm-/- colonies were obtained and their
DDR function(s) characterized.
The response to ionizing radiation (IR) was examined first. The growth
properties of double mutant MEFs precluded a conventional colony forming assay;
double mutants cells were essentially unable to form colonies even without IR, whereas
they were readily obtained in the Atm-/- single mutant (Supplementary Fig. 1B). This
phenotype was not due to a defect in cell growth since both single and double mutant
cells showed a comparable growth profile (data not shown).
As an alternative, we monitored the appearance and disappearance of nuclear
foci formed by single-strand DNA binding proteins RPA and Rad51 as an index of DNA
repair capacity (Fig. 1Bi, Bii and 1Biii, Biv). Following exposure to IR (4 Gy), RPA and
Rad51 foci persisted longer in Nbs1∆B/∆B Atm-/- clones than any other genotype. An
average of 70% of Nbs1∆B/∆B Atm-/- cells exhibited RPA nuclear foci 5 h after treatment,
with a 10% reduction observed in Atm-/- cells. 16 h post IR-treatment RPA foci were
present in virtually 100% of two independent double mutant clones whereas the RPA
signal was reduced to 20% in WT and Nbs1∆B/∆B, and 34% of Atm-/- cells (Fig. 1C). A
similar result was obtained for Rad51 foci (Fig. 1D). These data suggest that DSB
repair is markedly defective in Nbs1∆B/∆B Atm-/- double mutants relative to Atm-/- or
Nbs1∆B/∆B single mutants.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 11: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/11.jpg)
Balestrini et al
11
The Mre11 complex is essential for lymphocyte development in the absence of
ATM
Vavcre mediated deletion of the ATMflox allele in the bone marrow of Nbs1∆B/∆B
Atmflox/- mice was carried out to examine the phenotype of Nbs1∆B/∆B Atm-/- double
mutants in a physiological setting. The bone marrow was chosen for this analysis
because the Mre11 complex and ATM influence developmental stages that rely upon
chromosome rearrangements initiated by programmed induction of DSBs—V(D)J
recombination and immunoglobulin class switching (CSR) (17, 18).
The development of T and B cells was examined. Five week old double mutant
mice showed approximately ten fold reduction in the cellularity of the thymus compared
to Atm-/- VAV (Fig. 2Ai and Supplementary Fig. 2A). Flow cytometric analysis also
revealed significant alterations in the developmental distribution of Nbs1∆B/∆B Atm-/- VAV
thymocytes. The stages of T cell development can be differentiated by the individual
presence or coincidence of CD4 and CD8 surface receptors; double negative (DN) are
most primitive, double positive (DP) intermediate, single positive (SP), most mature. A
three fold accumulation in the percentage of DN cells (15%) was observed in Nbs1∆B/∆B
Atm-/- VAV thymus compared to Atm-/- VAV (6%). This result was accompanied by a
concomitant reduction in the percentage (average reduction of 1.2 fold) and the cell
number of DP thymocytes, while no variation in the percentage of SP cells was evident
(Fig. 2B and Supplementary Fig. 2A). These data suggest a temporal effect on T cell
development at the transition from the DN to DP stages.
ATM inhibition in Mre11ATLD1/ATLD1 lymphocytes leads to the accumulation of
unrepaired DSBs ends induced during V(D)J recombination (19). We reasoned that the
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 12: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/12.jpg)
Balestrini et al
12
developmental delays observed may reflect an analogous block in V(D)J recombination
in both T and B lineages. Thymocytes were stained for CD25 and CD44 surface
markers to pinpoint the DN stage at which maturation defect occurs. DN T-cell
maturation is further subdivided into four stages of differentiation (DN1, DN2, DN3 and
DN4) based on CD44 and CD25 expression. At this early developmental stage the
progression through DN2 to DN4 depends upon successful V(D)J recombination events
(20). We found that ATM deletion led to an accumulation at the DN3 stage in Nbs1∆B/∆B
cells (39% versus 13 % of Atm-/- VAV) with a concomitant attrition of the DN4 population
(44% versus 80%, double versus single mutant, respectively) (21) (Fig. 2C).
Similarly, flow cytometric analysis of bone marrow revealed a lag in B cell
development at the transition from pro- to pre-B cells, a point at which immunoglobulin
gene rearrangement is initiated; a two fold reduction in the number of pre-B cells in
Nbs1∆B/∆B Atm-/- VAV was observed (Fig. 2D). In contrast, no variation in cellularity, or the
relative numbers of erythroid and myeloid cells was observed in any of the mutants Fig.
2Aii. and Supplementary Fig. 2B-C). These data suggest an additive effect of Nbs1∆B/∆B
Atm-/- VAV mutants in resolution of programmed DSBs.
CSR defects in Nbs1∆B/∆B Atm-/- VAV
To further examine the effect Nbs1∆B/∆B Atm-/- VAV on programmed gene
rearrangement, CSR was analyzed in double mutant splenocytes. B cells isolated from
WT, single and double mutant spleens were stimulated ex vivo with antisera recognizing
CD40 (αCD40) in the presence or absence of interleukin 4 (IL-4). Co-administration of
IL-4 induces CSR to IgG1 in this setting (22). Analysis of cell surface IgG1 was
monitored by FACS following stimulation with αCD40 and IL-4. WT splenocytes
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 13: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/13.jpg)
Balestrini et al
13
exhibited 18.3% IgG1 positivity at four days post stimulation, compared to 13.5% of
Nbs1∆B/∆B splenocytes. In contrast, Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV cultures were
markedly CSR defective, exhibiting approximately 4.5% IgG1 positivity (Fig. 3A). These
differences were not attributable to variation in proliferation rates, apoptotic index, or to
defects in switch region transcription and AID induction (17) (Supplementary Fig. 3A-
3D).
To examine DSB rejoining directly, we performed a two-color FISH analysis with
probes specific for sequences upstream of the Igh variable domain (5’ Igh, labeled for
green signal), and sequences immediately downstream of the Igh constant region exons
(3’ Igh, labeled for red signal) (23). In this experiment, unbroken chromosomes 12
exhibit closely spaced green and red signals, whereas unresolved or improperly
resolved DSBs appear as separated green and red “split signals” (Fig. 3D i, ii, iii)
manifest in three outcomes: liberation of a small telomeric fragment (green in Fig. 3
Diii); translocation between chromosome 12 telomeric fragment (that contains the 5’ Igh
green probe) and another chromosome (Fig. 3 Dii); translocation of a centric
chromosome 12 (carrying the red signal) with another centric chromosome to form a
dicentric chromosome (red signal between two fused chromosomes in Fig. 3 Diii).
Whereas a split Igh signal was rarely detected in WT and AID-/- control B cells (less than
4%), split signals, indicative of IgH locus breaks, were observed in 49% of Nbs1∆B/∆B
Atm-/- VAV cells, a significantly higher level than Atm-/- VAV (23.7%) or Nbs1∆B/∆B (8.8%)
(Fig. 3B, 3C and Supplementary Fig. 3E).
This apparent defect in DSB rejoining was accompanied by increased usage of
microhomology at the residual switch region junctions that did form. The majority (15%)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 14: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/14.jpg)
Balestrini et al
14
of the junctions in the double mutant had microhomology length of ten nucleotides or
more, roughly two fold higher than all other genotypes (Fig. 3E and Supplementary Fig.
3F). These data clearly indicate an additive defect in the repair of DSBs induced to
initiate immunoglobulin class switch recombination in Nbs1∆B/∆B Atm-/- VAV mice.
Genomic instability in Nbs1∆B/∆B Atm-/- VAV mice
In addition to defects in rejoining DSBs during CSR, Nbs1∆B/∆B Atm-/- VAV cells
exhibited gross defects in the rejoining of spontaneous DSBs. Splenocytes stimulated
to proliferate with αCD40 exhibited pronounced karyotypic instability. 52% of Nbs1∆B/∆B
Atm-/- VAV exhibited chromosomal aberrations compared to 17% in the Atm-/- VAV single
mutant (Fig. 4A grey bars, Ai and B). A similar metaphase spreads pattern was also
observed in MEFs (Supplementary Fig. 4C). Co-administration of αCD40 and IL-4
further increased the number of aberrations observed in both single, as well as in
Nbs1∆B/∆B Atm-/- VAV double mutants (Fig. 4A black bars and Supplementary Fig. 4A).
In each genotype, the spectrum of spontaneous aberrations observed were
suggestive of defects in the response to DSBs arising during DNA replication, but their
abundance was markedly increased in Nbs1∆B/∆B Atm-/- VAV cells. The vast majority (over
90%) were either chromatid breaks and fragments or chromatid fusions and exchanges
(Fig. 4C and Supplementary Fig. 4B). Chromosome fragility was associated with a
three fold increased staining of 53BP1, a marker for DNA breaks, in double mutant cells
(7%) compared to single mutants (average of 2.2%) (Supplementary Fig. 4D).
Consistent with the gross level of instability observed karyotypically, 15% of Nbs1∆B/∆B
Atm-/- VAV cells exhibited micronuclei, indicative of cell division in the presence of broken
chromosomes (Fig. 4D). These data clearly indicate that ATM deficiency combined with
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 15: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/15.jpg)
Balestrini et al
15
Mre11 complex hypomorphism results in severe DSB repair deficiency.
ATR function in Nbs1∆B/∆B Atm-/- VAV cells
An alternative, and non-exclusive interpretation for the phenotypic synergy
observed was based on potential role of the Mre11 complex in the activation of ATR (11,
12). In this scenario, the severity of the phenotype observed would reflect concomitant
impairment of both the ATM and ATR arms of the DDR network.
To address this possibility, we assessed aphidicolin- and CPT-induced
phosphorylation of Chk1 on Ser345, both of which depend on ATR (24). Use of ATR-45,
an ATR inhibitor (12) provided evidence that Chk1 phosphorylation was dependent on
ATR after aphidicolin- and CPT treatment (Fig. 5A and Supplementary Fig. 5A). In WT
cells, Chk1 phosphorylation was evident at 1 h and decreased 5 h after treatment.
Similar levels of Chk1-Ser345 signal were observed in Nbs1∆B/∆B and Atm-/- VAV cells.
However, a moderate but reproducible reduction in Ser345 phosphorylation was
detected in Nbs1∆B/∆B Atm-/- VAV (Fig. 5A-B). A second ATR-dependent phosphorylation,
RPA32 Ser4/Ser8 (25) was also compromised in Nbs1∆B/∆B Atm-/- VAV (Fig. 5B). The
modest reduction of Chk1 phosphorylation observed in the double mutants would
appear to argue against a primary role for the Mre11 complex in regulating ATR.
Further supporting this interpretation, we found that Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV
cells exhibited a comparable defect in the maintenance of the G2/M checkpoint, which
is governed cooperatively by ATM and ATR (Supplementary Fig. 5B) (26).
Aphidicolin treatment causes instability of common fragile site (CFS). The
frequency of that outcome is heavily dependent upon ATR and Chk1 (27, 28).
Therefore, we assessed CFS stability in Nbs1∆B/∆B Atm-/- VAV cells as an index of ATR
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 16: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/16.jpg)
Balestrini et al
16
function. Fra8E1 (ortholog of human FRA16D (29)) was analyzed by a two-color FISH
assay analogous to that used for CSR (Fig. 3Ci) using DNA probes adjacent to the
Fra8E1 fragile site. Chromosome breakage was indicated by the appearance of
separated green and red signals (Fig. 5Ci and 5Cii). Breakage of Fra8E1 was elevated
relative to WT or Nbs1∆B/∆B in untreated cells; Atm-/- VAV, Nbs1∆B/∆B Atm-/- VAV and WT
cells treated with ATR inhibitor each exhibited approximately 10% breakage.
Aphidicolin treatment doubled the frequency of breakage in Nbs1∆B/∆B, Nbs1∆B/∆B Atm-/-
VAV and ATR inhibited WT cells, but had no effect on Atm-/- VAV, consistent with the view
that fragile site induction by aphidicolin is ATM independent (27) (Fig. 5C). Aphidicolin
induced breakage at other loci as well (Supplementary Fig. 5C). Collectively, these
data suggest that CFS stability is compromised in Nbs1∆B/∆B Atm-/- VAV cells. The
observation that aphidicolin induced fragile site breakage in Nbs1∆B/∆B suggests that the
Mre11 complex may also contribute to its stability in an ATM proficient setting. Our data
raise the possibility that the Mre11 complex-dependent protection of CFS is attributable
to a function independent on both ATM and ATR.
Highly penetrant lymphomagenesis in Nbs1∆B/∆B Atm-/- VAV mice
The high degree of spontaneous genomic instability in Nbs1∆B/∆B Atm-/- VAV
hematopoietic cells was correlated with increased risk of lymphomagenesis. Cohorts of
25 mice per each genotype were aged and monitored for malignancy. No malignancy
was observed in Nbs1∆B/∆B whereas 50% of the Atm-/- VAV cohort succumbed to thymic
lymphoma within 12 months. Lymphomagenesis was completely penetrant in Nbs1∆B/∆B
Atm-/- VAV mice, with tumors observed by six months of age in 91% of the mouse cohort
(Fig 6A). The increased risk of malignancy in Nbs1∆B/∆B Atm-/- VAV was not attributable
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 17: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/17.jpg)
Balestrini et al
17
to a differential effect on apoptosis, as Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV thymocytes
exhibited comparable apoptotic defects (Fig. 6B)
Thymic lymphomas arising in Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV were
histologically similar (Supplementary Fig. 6), but spectral karyotype analysis (SKY)
revealed a highly complex genome rearrangements in Nbs1∆B/∆B Atm-/- VAV, many of
which were clonal in the tumor (Fig. 6C). This outcome is consistent with the
observation of gross chromosomal instability in Nbs1∆B/∆B Atm-/- VAV cells.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 18: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/18.jpg)
Balestrini et al
18
DISCUSSION
Hypomorphic mutations of the Mre11 complex confer embyronic lethality in the
context of ATM deficiency (8, 10). These observations indicate that in addition to being
required for ATM activation, the Mre11 complex specifies ATM independent functions.
That these functions are essential to embryonic viability suggests that the Mre11
complex normally mitigates pathologic outcomes of ATM deficiency.
In this study, we examined the ATM independent functions of the Mre11 complex
using a conditional allele of ATM (ATMflox) in combination with Nbs1∆B which models the
canonical Nbs1 allele inherited in Nijmegen Breakage Syndrome patients (8, 30).
Expression of cre in Nbs1∆B/∆B Atmflox/- MEFs revealed that viable Nbs1∆B/∆B Atm-/- cells
could be obtained in vitro. Nbs1∆B/∆B Atm-/- cells exhibited severe cellular phenotypes
such as impaired DNA repair, extensive chromosome instability and reduced activation
of ATR, the replication-stress checkpoint kinase. Ablation of ATM in hematopoietic
lineages in vivo was effected by crossing Nbs1∆B/∆B Atmflox/- mice to hematopoietic stem
cell specific vavcre mice. Hematopoietic cells were viable in the Nbs1∆B/∆B Atm-/-VAV mice,
but they exhibited pronounced defects in lymphoid development, impaired class
switching, and completely penetrant early onset lymphomagenesis.
Previous studies analyzing the relationship between ATM and the Mre11
complex have been carried out in cultured cells with siRNA or chemically mediated
suppression of Mre11 complex and ATM functions (31, 32). The mouse model
presented here allowed us to examine that relationship in vivo in the context of
hematopoietic development in a physiological context that also affords the opportunity
to assess tumor risk.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 19: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/19.jpg)
Balestrini et al
19
Collectively, the Nbs1∆B/∆B Atm-/- phenotypes appear primarily attributable to
defects in DSB repair. The severe defect in the joining of AID induced DSBs during
CSR strongly suggests that non-homologous end joining (NHEJ) is impaired in
Nbs1∆B/∆B Atm-/- VAV cells (Fig. 3D). Recent data regarding the influence of 53BP1 and
Rif1 on DSB resection suggest a possible mechanistic basis for this outcome. ATM-
dependent phosphorylation of 53BP1 induces the recruitment of Rif1 to DSBs and to
dysfunctional telomeres. This event likely underlies the inhibitory effect of 53BP1 on
DSB resection. Because resected DSB ends are poor substrates for NHEJ, inhibition of
resection by 53BP1 and Rif1 effectively promotes NHEJ (33). The effect of ATM
deficiency on CSR may partially reflect the failure to inhibit resection of AID-induced
DSBs. Similarly, the Mre11 complex has been implicated in promoting NHEJ at
dysfunctional telomeres (34), as well as in NHEJ during CSR and VDJ recombination
(Fig. 3A) (5, 7, 19, 35). Although in those contexts, defects in NHEJ-mediated rejoining
must at least partially reflect a decrement in ATM activation associated with Mre11
complex hypomorphism, the additive defects in Nbs1∆B/∆B Atm-/- cells reveal a direct
(i.e., ATM-independent) role for the Mre11 complex in NHEJ.
On the other hand, residual NHEJ functions are evident in Nbs1∆B/∆B Atm-/- cells
as indicated by the development of mature B and T cells, and the frequent occurrence
of radial structures which require NHEJ to form (Fig. 2, 4B and Supplementary Fig. 4C).
Because the Mre11 complex is involved in DSB repair mediated by homology directed
repair (HDR) (36), the coincident impairment of NHEJ and homologous recombination
(HR) in Nbs1∆B/∆B Atm-/- cells may also account for the phenotypic severity observed.
Following ionizing radiation treatment, persistent RPA and Rad51 nuclear foci (Fig. 1B
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 20: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/20.jpg)
Balestrini et al
20
and C) are observed in Nbs1∆B/∆B Atm-/- compared to Atm-/-. As RPA and Rad51
assemblies are intermediates in the HR process, their persistence indicates that the
completion of HDR is impaired or delayed in double mutant cells. We propose that
combined defects in DSB repair DDR signaling associated with ATM deficiency
underlies the phenotype of Nbs1∆B∆B Atm-/- VAV mutants.
Defects in the response to replication stress were also evident in Nbs1∆B/∆B Atm-/-
VAV cells, as inferred from expression of common fragile sites induced by aphidicolin
treatment. The suppression of fragile sites instability is strongly dependent on ATR (27).
Consequently, the simplest explanation for this result is that ATR function is impaired in
Nbs1∆B/∆B Atm-/- VAV cells. However, the effect on Chk1 and RPA phosphorylation in
double mutants was extremely mild, arguing against altered ATR functions as the
underlying basis of CFS expression. Consequently, we favor the possibility that Nbs1
plays a more direct role in maintaining stability at common fragile sites, or that the
stability of CFS depends both on ATR and ATM in mouse cells.
While previous studies in in vitro and in culture cells suggest the existence of a
Nbs1-dependent ATR activation pathway (11, 12) (37), our data do not support the
interpretation that the Mre11 complex exerts a strong influence on ATR activity in ATM
proficient cells. In this regard, the use of an in vivo genetic system that allowed the
derivation of primary cells provided a sensitive setting for the assessment of the Mre1
complex influence on ATR activation. It is also conceivable that because the product of
the Nbs1∆B allele retains the RPA-interacting domain that appears to influence ATR
activation (11), the influence of the Mre11 complex on ATR may not be fully revealed in
Nbs1∆B/∆B cells.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 21: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/21.jpg)
Balestrini et al
21
The development of aggressive T- cell lymphoma in Nbs1∆B/∆B Atm-/- VAV mice
demonstrates that Nbs1 contributes substantially to suppressing the oncogenic potential
of ATM deficiency . Despite the fact that genome instability per se is not sufficient to
elicit the onset of lymphomagenesis in Mre11 complex hypomorphic mice, it is sufficient
to promote the penetrance of an initial mutation such as p53 heterozygosity (9). Indeed,
recent data have highlighted a role of the Mre11 complex acting as a barrier to
oncogene-driven breast tumorigenesis (38). We propose that the higher rate of genome
instability exhibited by double mutant cells, combined with reduced DDR signaling,
underlie the basis for the observed increase in tumor predisposition. Supporting the idea
that reduced ATR activity in Nbs1∆B/∆B Atm-/- VAV mice accelerates lymphomagenesis,
ATR+/- mice have been reported to show increase in tumor incidence (39). In addition,
we found that Nbs1∆B/∆B Atm-/- VAV cells show a synergistic increase in spontaneously
arising and CSR-associated chromosomal aberrations (Fig. 3B and 4A).
The development of an animal model in which the ATM independent functions of
the Mre11 complex can be analyzed offers a novel perspective for analyzing
relationships among the components of the DDR network. The profound defects
associated with coincident inhibition of the ATM and ATR arms of the DDR (40), support
the idea that the simultaneous inhibition of both DNA damage signaling protein kinases
could be exploited to improve the efficacy of clastogenic therapies.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 22: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/22.jpg)
Balestrini et al
22
ACKNOWLEDGMENTS
We are grateful to Fred Alt for ATMflox mice and genotyping, and Matthias Stadtfeld and
Thomas Graf for vavcre mice; Monica Gostissa and Ryan L. Ragland for reagents and
technical advice; and members of the Petrini laboratory and Thomas J. Kelly for
providing helpful comments and suggestions throughout the course of this study. This
work was supported by the Geoffrey Beene Center at MSKCC and NIH grant GM59413
to J.H.J.P., grants from the National Institutes of Health (1RO1AI072194) and the Starr
Cancer Research Foundation to J.C., Department of Pathology and Laboratory
Medicine of the Children's Hospital of Philadelphia Research Institute, a Leukemia and
Lymphoma Society Scholar Award, and the National Institutes of Health R01 Grants
CA125195 and CA136470 (C.H.B), NIH/NCI 1K99CA178191 to O.A.G., American-
Italian Cancer Foundation fellowship and EMBO fellowship (EMBO ALTF 43-2011) to
A.B.. R.L.L. is a Leukemia and Lymphoma Society Scholar.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 23: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/23.jpg)
Balestrini et al
23
REFERENCES
1. Ciccia A, Elledge SJ. The DNA damage response: making it safe to play with knives. Mol Cell. 2010;40:179-204. 2. Stracker TH, Petrini JH. The MRE11 complex: starting from the ends. Nature reviews Molecular cell biology. 2011;12:90-103. 3. Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer. 2003;3:155-68. 4. Stracker TH, Theunissen JW, Morales M, Petrini JH. The Mre11 complex and the metabolism of chromosome breaks: the importance of communicating and holding things together. DNA repair. 2004;3:845-54. 5. Deriano L, Stracker TH, Baker A, Petrini JH, Roth DB. Roles for NBS1 in alternative nonhomologous end-joining of V(D)J recombination intermediates. Mol Cell. 2009;34:13-25. 6. Saidi A, Li TL, Weih F, Concannon P, Wang ZQ. Dual Functions of Nbs1 in the Repair of DNA Breaks and Proliferation Ensure Proper V(D)J Recombination and T-Cell Development. Mol Cell Biol. 2010;30:5572-81. 7. Reina-San-Martin B, Nussenzweig MC, Nussenzweig A, Difilippantonio S. Genomic instability, endoreduplication, and diminished Ig class-switch recombination in B cells lacking Nbs1. Proc Natl Acad Sci U S A. 2005;102:1590-5. 8. Williams BR, Mirzoeva OK, Morgan WF, Lin J, Dunnick W, Petrini JH. A murine model of Nijmegen breakage syndrome. Curr Biol. 2002;12:648-53. 9. Theunissen JW, Kaplan MI, Hunt PA, Williams BR, Ferguson DO, Alt FW, et al. Checkpoint failure and chromosomal instability without lymphomagenesis in Mre11(ATLD1/ATLD1) mice. Mol Cell. 2003;12:1511-23. 10. Morales M, Theunissen JW, Kim CF, Kitagawa R, Kastan MB, Petrini JH. The Rad50S allele promotes ATM-dependent DNA damage responses and suppresses ATM deficiency: implications for the Mre11 complex as a DNA damage sensor. Genes Dev. 2005;19:3043-54. 11. Shiotani B, Nguyen HD, Hakansson P, Marechal A, Tse A, Tahara H, et al. Two distinct modes of ATR activation orchestrated by Rad17 and Nbs1. Cell reports. 2013;3:1651-62. 12. Duursma AM, Driscoll R, Elias JE, Cimprich KA. A role for the MRN complex in ATR activation via TOPBP1 recruitment. Mol Cell. 2013;50:116-22. 13. Flynn RL, Zou L. ATR: a master conductor of cellular responses to DNA replication stress. Trends Biochem Sci. 2011;36:133-40. 14. Lopez-Contreras AJ, Fernandez-Capetillo O. The ATR barrier to replication-born DNA damage. DNA repair. 2010;9:1249-55. 15. Zha S, Sekiguchi J, Brush JW, Bassing CH, Alt FW. Complementary functions of ATM and H2AX in development and suppression of genomic instability. Proc Natl Acad Sci U S A. 2008;105:9302-6. 16. Stadtfeld M, Graf T. Assessing the role of hematopoietic plasticity for endothelial and hepatocyte development by non-invasive lineage tracing. Development. 2005;132:203-13. 17. Stavnezer J, Guikema JE, Schrader CE. Mechanism and regulation of class switch recombination. Annu Rev Immunol. 2008;26:261-92.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 24: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/24.jpg)
Balestrini et al
24
18. Revy P, Buck D, le Deist F, de Villartay JP. The repair of DNA damages/modifications during the maturation of the immune system: lessons from human primary immunodeficiency disorders and animal models. Adv Immunol. 2005;87:237-95. 19. Helmink BA, Bredemeyer AL, Lee BS, Huang CY, Sharma GG, Walker LM, et al. MRN complex function in the repair of chromosomal Rag-mediated DNA double-strand breaks. J Exp Med. 2009;206:669-79. 20. Fehling HJ, Krotkova A, Saint-Ruf C, von Boehmer H. Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature. 1995;375:795-8. 21. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68:869-77. 22. Gordon J, Millsum MJ, Guy GR, Ledbetter JA. Resting B lymphocytes can be triggered directly through the CDw40 (Bp50) antigen. A comparison with IL-4-mediated signaling. J Immunol. 1988;140:1425-30. 23. Franco S, Gostissa M, Zha S, Lombard DB, Murphy MM, Zarrin AA, et al. H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol Cell. 2006;21:201-14. 24. Liu Q, Guntuku S, Cui XS, Matsuoka S, Cortez D, Tamai K, et al. Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes Dev. 2000;14:1448-59. 25. Anantha RW, Vassin VM, Borowiec JA. Sequential and synergistic modification of human RPA stimulates chromosomal DNA repair. J Biol Chem. 2007;282:35910-23. 26. Brown EJ, Baltimore D. Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance. Genes Dev. 2003;17:615-28. 27. Casper AM, Nghiem P, Arlt MF, Glover TW. ATR regulates fragile site stability. Cell. 2002;111:779-89. 28. Durkin SG, Arlt MF, Howlett NG, Glover TW. Depletion of CHK1, but not CHK2, induces chromosomal instability and breaks at common fragile sites. Oncogene. 2006;25:4381-8. 29. Krummel KA, Denison SR, Calhoun E, Phillips LA, Smith DI. The common fragile site FRA16D and its associated gene WWOX are highly conserved in the mouse at Fra8E1. Genes Chromosomes Cancer. 2002;34:154-67. 30. Varon R, Vissinga C, Platzer M, Cerosaletti KM, Chrzanowska KH, Saar K, et al. Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell. 1998;93:467-76. 31. Xie A, Kwok A, Scully R. Role of mammalian Mre11 in classical and alternative nonhomologous end joining. Nature structural & molecular biology. 2009;16:814-8. 32. Rass E, Grabarz A, Plo I, Gautier J, Bertrand P, Lopez BS. Role of Mre11 in chromosomal nonhomologous end joining in mammalian cells. Nature structural & molecular biology. 2009;16:819-24. 33. Chapman JR, Barral P, Vannier JB, Borel V, Steger M, Tomas-Loba A, et al. RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol Cell. 2013;49:858-71. 34. Deng Y, Guo X, Ferguson DO, Chang S. Multiple roles for MRE11 at uncapped telomeres. Nature. 2009;460:914-8.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 25: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/25.jpg)
Balestrini et al
25
35. Dinkelmann M, Spehalski E, Stoneham T, Buis J, Wu Y, Sekiguchi JM, et al. Multiple functions of MRN in end-joining pathways during isotype class switching. Nature structural & molecular biology. 2009;16:808-13. 36. Williams RS, Williams JS, Tainer JA. Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Biochem Cell Biol. 2007;85:509-20. 37. Stiff T, Reis C, Alderton GK, Woodbine L, O'Driscoll M, Jeggo PA. Nbs1 is required for ATR-dependent phosphorylation events. EMBO J. 2004. 38. Gupta GP, Vanness K, Barlas A, Manova-Todorova KO, Wen YH, Petrini JH. The Mre11 complex suppresses oncogene-driven breast tumorigenesis and metastasis. Mol Cell. 2013;52:353-65. 39. Brown EJ, Baltimore D. ATR disruption leads to chromosomal fragmentation and early embryonic lethality. Genes Dev. 2000;14:397-402. 40. Al-Ahmadie H, Iyer G, Hohl M, Asthana S, Inagaki A, Schultz N, et al. Synthetic Lethality in ATM-Deficient RAD50-Mutant Tumors Underlies Outlier Response to Cancer Therapy. Cancer discovery. 2014;4:1014-21. 41. Theunissen JW, Petrini JH. Methods for studying the cellular response to DNA damage: influence of the Mre11 complex on chromosome metabolism. Methods Enzymol. 2006;409:251-84. 42. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998;72:8463-71. 43. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 2002;295:868-72. 44. Lee-Theilen M, Matthews AJ, Kelly D, Zheng S, Chaudhuri J. CtIP promotes microhomology-mediated alternative end joining during class-switch recombination. Nature structural & molecular biology. 2011;18:75-9. 45. Nowak U, Matthews AJ, Zheng S, Chaudhuri J. The splicing regulator PTBP2 interacts with the cytidine deaminase AID and promotes binding of AID to switch-region DNA. Nature immunology. 2011;12:160-6. 46. Ehrenstein MR, Rada C, Jones AM, Milstein C, Neuberger MS. Switch junction sequences in PMS2-deficient mice reveal a microhomology-mediated mechanism of Ig class switch recombination. Proc Natl Acad Sci U S A. 2001;98:14553-8. 47. Hasham MG, Snow KJ, Donghia NM, Branca JA, Lessard MD, Stavnezer J, et al. Activation-induced cytidine deaminase-initiated off-target DNA breaks are detected and resolved during S phase. J Immunol. 2012;189:2374-82. 48. Bassing CH, Suh H, Ferguson DO, Chua KF, Manis J, Eckersdorff M, et al. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 2003;114:359-70. 49. Stracker TH, Couto SS, Cordon-Cardo C, Matos T, Petrini JH. Chk2 suppresses the oncogenic potential of DNA replication-associated DNA damage. Mol Cell. 2008;31:21-32. 50. Chaudhuri J, Tian M, Khuong C, Chua K, Pinaud E, Alt FW. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature. 2003;422:726-30.
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 26: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/26.jpg)
Balestrini et al
26
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 27: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/27.jpg)
Balestrini et al
27
FIGURE LEGENDS
Figure 1. The Mre11 complex functions to promote DNA repair independently of ATM
(A) Western blot of splenocyte lysates from the indicated genotypes. Membranes were
probed with antibodies for ATM, Nbs1, Mre11, Rad50 and Smc1 (loading control).
Analysis of WT, Nbs1∆B/∆B, Atm -/- and two Nbs1∆B/∆B Atm -/- clones (C1 and C2) repair
defect in SV40 immortalized MEFs.
(B) Representative RPA (biii and biv) and Rad51(bi and bii) immunofluorescence foci 16
h and 24 h after 4 Gy IR (left), respectively. Rad51 and RPA foci are green; DNA
counterstained with 4,6-diamidino-2-phenylindole (DAPI), is in blue. Bar graphs (graph)
represent percentage of RPA (C) and Rad51 (D) foci-positive cells (> 10 foci) at the
indicated times: 0 (mock), 4 and 16 h or 24 h following IR treatment, respectively. Error
bars represent standard deviation from three independent experiments. P values were
determined by unpaired t-test.
Figure 2. Developmental block at early stage of maturation in Nbs1∆B/∆B Atm -/-
lymphocytes
(A) Total number of cells in thymus (i) and bone marrow (ii) of the indicated genotypes.
Flow-cytometric analysis of haematopoietic tissues from 4 week-old mice.
(B) T cell populations were identified in thymus based on CD4 and CD8 markers.
Percentages of DN, DP, CD4, and CD8 single positive cells are reported.
Representative CD4 versus CD8 staining profiles of each genotype is shown, together
with the quadrant gates used to identify DN (CD4-, CD8-), DP (CD4+, CD8+), and SP
(CD4+, CD8- and CD4-, CD8+) thymocytes (bottom).
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 28: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/28.jpg)
Balestrini et al
28
(C) Expression of CD25 and CD44 on DN thymocytes with the percentages of DN1–4
subsets (DN1, CD44+CD25-; DN2, CD44+CD25+; DN3, CD44-CD25+; and DN4, CD44-
CD25-).
(D) Absolute B cell numbers are shown for the different populations in the bone marrow
and gated as follow: proB (B220+, CD43+, IgM-), preB ( B220+, CD43-, IgM-), Immature
B (B220+, CD43-, IgM+) cells. In each graph (a-d) bars denote the average ± standard
error of mean (SEM), and p values were calculated using an unpaired t-test. Each
symbol represents one animal.
Figure 3. Persistent breaks in Nbs1∆B/∆B Atm -/- VAV B cells activated for class switch
recombination
(A) Quantification of IgG1 surface expression in WT, Nbs1∆B/∆B, Atm-/- VAV , Nbs1∆B/∆B Atm-
/- VAV, B cells stimulated for 4 days with αCD40 in the presence of IL-4. Error bars
indicate SEM, and p values were calculated using an unpaired t-test. Each symbol
represents one animal.
(B) Chromosome breakage in the IgH locus. Percentage of metaphases with split
signal for 3’IgH and 5’IgH BACs on the indicated B cell genotypes stimulated with
αCD40/IL-4 for 4 days. 60 metaphases were scored per genotype. Bars represent the
mean of 3 experiments and p values were calculated using an unpaired t-test.
(C) Bar graph depicting the percentage of metaphases with different type of aberrations
from αCD40/IL-4 stimulated B cells in (B). Error bars represent standard deviation from
three independent experiments and p values were calculated using an unpaired t-test.
(D) The representative examples show signal from an intact IgH locus (di) and IgH
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 29: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/29.jpg)
Balestrini et al
29
associated aberrations in Nbs1∆B/∆B Atm-/- VAV: IgH rearrangement (dii), IgH break and
IgH fusion (diii).
(E) Genomic DNA was amplified by PCR, and Sµ/Sγ1 junctions were sequenced.
Percentage of sequences with indicated nucleotide (nt) overlap for Sμ and Sγ1 junctions
are indicated. Three mice of each genotype were analyzed. A two-tailed Fisher's exact
test was applied for analyses of microhomology length at switch junctions. The
difference in the percentage of junctions with blunt ends (0 nt) and microhomology of ≥
ten nucleotides was statistically significant between WT and Nbs1∆B/∆B Atm -/- VAV
(P=0.03), Nbs1∆B/∆B and Nbs1∆B/∆B Atm -/- VAV (P=0.006), Atm -/- VAV and Nbs1∆B/∆B Atm -/-
VAV (P=0.01).
Figure 4. Loss of ATM exacerbates the chromosome instability conferred by Nbs1∆B/∆B
(A) Genomic instability of primary splenocytes stimulated with αCD40 in the presence or
absence of IL-4 for 4 days. Shown is the average ±SD of at least three independent
experiments per genotype. > 50 metaphases were scored per genotype. The p value
was determined by two tailed t-test. Examples of chromosome instability from a
αCD40/IL-4 treated in Nbs1∆B/∆B Atm-/- VAV spread is shown: two combinations of radial-
fusion and exchanges are indicated (right).
(B) Percentages of normal (0) and aberrant metaphases (subdivided in two categories
of 1 to 3 or > 3 aberrations/metaphase) in the indicated B cell genotypes stimulated with
αCD40.
(C) Percentage of metaphases with different type of chromosome aberrations
spontaneously occurring in αCD40 stimulated B cells in (a). Error bars denote standard
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 30: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/30.jpg)
Balestrini et al
30
deviation.
(D) Bar graph reporting the percentage of αCD40 stimulated B cells with micronuclei (a
representative image, with micronuclei indicated by arrows, is on the right). Values
plotted represent the mean percentage from three experimental replicates. Error bars
represent the SD of the replicate means and the p value was determined by two tailed t-
test.
Figure 5. Reduced ATR activation in Nbs1∆B/∆B Atm-/- VAV cells
Western blot of B cell lysates from the indicated genotypes. (A) Membranes were
probed with antibodies for ATM, Nbs1, Chk1 pSer345 and Chk1 at various times after
treatment with 2 µM of Aph. Showed is a representative image of three independent
experiments. Note that Chk1 phosphorylation gives rise to multiple forms of decreased
electrophoretic mobility (26). In (a) and (b) Chk1 phospho-specific band on the top is the
results of several bands grouped together. Reduction of Chk1 phosphorylation in,
Nbs1∆B/∆B Atm-/- VAV, is highlighted by the lower band. Total Chk1 was used as loading
control. ATR inhibitor (ATR-45) was used as control for Aph specific ATR activation.
(B) Western blot of splenocytes probed with ATM, Nbs1, Chk1 (loading control), Chk1
pSer345 and RPA2 pSer4/8 at the indicated times after treatment with 1.5 µM CPT.
Showed is a representative image of three experimental replicates.
(C) Percentage of metaphases with Fra8E1 expression. Fragile site expression was
induced by adding 0.6 µM Aph to αCD40 stimulated B cells 24 h before harvest.
Positive control for fragile site expression was achieved by treating cells with 0.1 µM
ATR inhibitor (ATRi). Split signal for proximal-Fra8E1 and distal-Fra8E1 BACs of the
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 31: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/31.jpg)
Balestrini et al
31
indicated genotypes was used as index of chromosome gaps and breaks at the Fra8E1
CFS. Error bars represent the SD of the replicate means and the p value was
determined by an unpaired t-test. The representative examples show Fra8E1
associated aberrations in Aph-treated Nbs1∆B/∆B Atm -/- VAV cells with DAPI staining
(right) and FISH probe hybridization (left): Fra8E1rearrangements (i), Fra8E1 break (ii).
The inset in (ci) depicts a higher-magnification image of a co-localized green and red
signal obtained from an intact Fra8E1 locus.
Figure 6. Nbs1∆B/∆BAtm -/- VAV double mutant mice are predisposed to a more
aggressive lymphomagenesis.
(A) Kaplan-Meier survival curves of Atm -/-VAV (n=39), Nbs1∆B/∆BAtm -/- VAV (n=33), WT
and Nbs1∆B/∆B (n=50) mice. Mice survival was not assessed beyond 12 months, and
thus the events were censored at that age. P values were calculated using the two-
tailed log rank test, relative to the Nbs1∆B/∆B and Atm -/- VAV genotypes.
(B) Thymocytes from the indicated genotypes were mock treated or exposed to 5 Gy of
IR in culture and analyzed 20 h post-treatment. Viability ratios (= AnnexinV/PI double
negative % after mock treatment and 20h after 5 Gy, divided by the average percentage
of viability after mock treatment) are plotted for each genotype, and experiments were
performed in triplicate. The error bars denote standard deviation, and p values were
calculated using two-sided Wilcoxon rank sum test.
(C) Thymic lymphomas from Atm -/- VAV and Nbs1∆B/∆BAtm -/- VAV mice harboring clonal
translocations. Representative metaphase spreads of one lymphoma from both
genotypes, with DAPI staining, spectral karyotype (SKY) image of the metaphase
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 32: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/32.jpg)
Balestrini et al
32
spread and translocations indicated. Summary of chromosome translocations in
lymphomas are reported on the table (right).
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 33: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/33.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 34: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/34.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 35: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/35.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 36: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/36.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 37: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/37.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 38: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/38.jpg)
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281
![Page 39: Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,](https://reader034.vdocuments.us/reader034/viewer/2022050717/5e1464bf364c52711879653f/html5/thumbnails/39.jpg)
Published OnlineFirst November 4, 2015.Mol Cancer Res Alessia Balestrini, Laura Nicolas, Katherine Yang-lott, et al. with a Novel Mouse ModelDefining ATM-independent Functions of the Mre11 Complex
Updated version
10.1158/1541-7786.MCR-15-0281doi:
Access the most recent version of this article at:
Material
Supplementary
http://mcr.aacrjournals.org/content/suppl/2015/11/04/1541-7786.MCR-15-0281.DC1
Access the most recent supplemental material at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://mcr.aacrjournals.org/content/early/2015/11/04/1541-7786.MCR-15-0281To request permission to re-use all or part of this article, use this link
on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281