bacterialdegradationofbenzoate - digital csicdigital.csic.es/bitstream/10261/49890/3/j. biol....

Bacterial Degradation of BenzoateCROSS-REGULATION BETWEEN AEROBIC AND ANAEROBIC PATHWAYS*□S

Received for publication, September 30, 2011, and in revised form, February 1, 2012 Published, JBC Papers in Press, February 2, 2012, DOI 10.1074/jbc.M111.309005

J. Andrés Valderrama1, Gonzalo Durante-Rodríguez1,2, Blas Blázquez3, José Luis García, Manuel Carmona,and Eduardo Díaz4

From the Department of Environmental Biology, Centro de Investigaciones Biológicas-Consejo Superior de InvestigacionesCientíficas, 28040 Madrid, Spain

Background: The specific transcriptional regulation of the box pathway for aerobic benzoate degradation is unknown.Results: The BoxR/benzoyl-CoA couple controls the induction of the box genes.Conclusion: BoxR is the regulator of the box pathway in bacteria.Significance: There is cross-regulation between anaerobic and aerobic benzoate degradation pathways.

We have studied for the first time the transcriptional regula-tory circuit that controls the expression of the box genes encod-ing the aerobic hybrid pathway used to assimilate benzoate viacoenzyme A (CoA) derivatives in bacteria. The promotersresponsible for the expression of the box cluster in the�-proteo-bacteriumAzoarcus sp., their cognate transcriptional repressor,the BoxRprotein, and the inducermolecule (benzoyl-CoA) havebeen characterized. The BoxR protein shows a significantsequence identity to the BzdR transcriptional repressor thatcontrols the bzd genes involved in the anaerobic degradation ofbenzoate. Because the boxR gene is present in all box clusters sofar identified in bacteria, the BoxR/benzoyl-CoA regulatory sys-tem appears to be a widespread strategy to control this aerobichybrid pathway. Interestingly, the paralogous BoxR and BzdRregulators act synergistically to control the expression of theboxand bzd genes. This cross-regulation between anaerobic andaerobic pathways for the catabolismof aromatic compounds hasnever been shown before, and it may reflect a biological strategyto increase the cell fitness in organisms that survive in environ-ments subject to changing oxygen concentrations.

Aromatic compounds comprise one-quarter of the earth’sbiomass and are the second most widely distributed class oforganic compounds in nature next to carbohydrates. Somemicroorganisms have evolved a complex machinery for themineralization of aromatic compounds, and therefore, theybecome crucial in the biogeochemical cycles and in the sustain-

able development of the biosphere (1–4). There are two majormicrobial strategies to degrade aromatic compounds depend-ing on the presence or absence of oxygen. In the aerobic catab-olism, molecular oxygen is not only the final electron acceptorbut also an essential cosubstrate of oxygenases involved in thehydroxylation (activation) and cleavage (dearomatization) ofthe aromatic ring (5, 6). The anaerobic catabolism, however,relies on a completely different strategy based on coenzyme A(CoA)-dependent activation of the aromatic ring followed byreductive dearomatization and then hydrolytic ring cleavage (3,4). A third degradation strategy has been described for the aer-obic mineralization of some aromatic compounds (e.g. benzo-ate, phenylacetate, and 2-aminobenzoate) that incorporatesfeatures of both the classical aerobic and anaerobic pathways.These aerobic hybrid pathways start with the CoA-dependentactivation of the aromatic acids, but then the dearomatizationstep requires molecular oxygen and the mechanism of ringcleavage is hydrolytic rather than oxygenolytic (3, 7–9).Benzoate has been widely used as a model compound for the

study of the bacterial catabolism of aromatic compounds (4,10). The anaerobic degradation of benzoate by either facultativeor strict anaerobes is initiated by its activation to benzoyl-CoAby the action of an ATP-dependent (AMP-forming) benzoate-CoA ligase. Benzoyl-CoA is then subject of aromatic ringreduction and a modified �-oxidation pathway that ends withan aliphatic C7-dicarboxyl-CoA derivative (Fig. 1A) (3, 4, 11).On the contrary, the classical aerobic benzoate degradation inbacteria relies on the hydroxylation of the aromatic ring to pro-duce catechol, which is then dearomatized (cleaved) by a dioxy-genase (Fig. 1A) (12). A thirdmechanism to degrade benzoate isvia an aerobic hybrid pathway (box pathway) that initiates theactivation of benzoate to benzoyl-CoA by a benzoate-CoAligase (BclA). Then, a benzoyl-CoA 2,3-epoxidase (BoxAB) andaBoxCdihydrolase are responsible for the dearomatization andring-cleavage steps, respectively. The 3,4-dehydroadipyl-CoAsemialdehyde formed becomes converted to succinyl-CoA andacetyl-CoA by a �-oxidation-like metabolism (box lower path-way) (Fig. 1A) (8, 13–22).A search in the bacterial genomes revealed that the box genes

are present in many �- and �-proteobacteria and in some�-proteobacteria (14, 20). Moreover, several bacterial strains

* This work was supported by grants BIO2009-10438 and CSD2007-00005from the Comisión Interministerial de Ciencia y Tecnología.

□S This article contains supplemental Figs. S1–S4.The nucleotide sequence(s) reported in this paper has been submitted to the Gen-

BankTM/EBI Data Bank with accession number(s) HE589495.1 Recipients of predoctoral fellowships from the Plan Nacional de Formación

de Personal Investigador-Ministry of Science and Innovation.2 Present address: Systems Biology Program, Centro Nacional de Biotec-

nología-Consejo Superior de Investigaciones Científicas, Darwin 3, Cam-pus de Cantoblanco, 28049 Madrid, Spain.

3 Present address: Chemistry and Biochemistry Dept., University of NotreDame, Notre Dame, IN46556.

4 To whom correspondence should be addressed: Dept. of EnvironmentalBiology, Centro de Investigaciones Biológicas-Consejo Superior de Inves-tigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid, Spain. Tel.:34-918373112; Fax: 34-915360432; E-mail: [email protected].

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 13, pp. 10494 –10508, March 23, 2012© 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

10494 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287 • NUMBER 13 • MARCH 23, 2012

at CSIC

- Centro de Investigaciones B

iológicas on September 14, 2017

http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/content/full/M111.309005/DC1

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

contain both the classical and the hybrid pathway for aerobicbenzoate degradation. The box pathway was suggested to bespecially active at reduced oxygen tension (20, 23, 24). An insilico search among the available bacterial genomes revealedthat most box clusters are organized into at least two majorfunctional catabolic units; 1) the activationmodule (encoded bythe bclA gene) and 2) the dearomatization and ring-cleavagemodule encoded by the boxAB and boxC genes, respectively. Alower pathway module (encoded by other box genes) can bephysically associated or not to the activation and dearomatiza-tion/ring-cleavage modules (Fig. 1B). Although the box path-way becomes a major route for aerobic benzoate degradationand its biochemistry and genetics have been investigated insome bacteria, thus far there is no information about the regu-latory mechanism that controls the inducible expression of thebox genes (14, 22, 24). Interestingly, a common feature of mostbox clusters is the presence of a boxR gene, first described inAzoarcus strains (14, 25), that encodes a protein thatmight be amember of the BzdR subfamily of prokaryotic transcriptionalregulators (26, 27) and, therefore, might constitute the regula-tory unit of the box cluster (Fig. 1B).

SomeAzoarcus/Aromatoleum strains (�-proteobacteria) areable to degrade benzoate both aerobically and anaerobically (4,13, 25). The regulation of the bzd genes involved in the anaer-obic benzoate degradation has been studied inAzoarcus sp. CIB(26–28). On the other hand, Azoarcus sp. CIB is also able todegrade benzoate aerobically (26), although the genes involvedhave not been yet described. In this paperwe have identified thebox cluster of Azoarcus sp. CIB and studied for the first timethe specific regulatory circuit that controls the expression ofthe box genes in bacteria. Moreover, we have shown the exis-tence of an unexpected transcriptional cross-regulationbetween the aerobic and anaerobic benzoate degradationpathways.

EXPERIMENTAL PROCEDURES

Bacterial Strains, Plasmids, and Growth Conditions—TheEscherichia coli and Azoarcus strains as well as the plasmidsused for this study are indicated in Table 1, and the oligonu-cleotides employed for PCR amplification of the cloned frag-ments and othermolecular biology techniques are summarizedin Table 2. To construct the plasmids pSJ3PX and pSJ3PD,

FIGURE 1. Major biochemical strategies for benzoate degradation and genetic arrangements of the box clusters in proteobacteria. A, schemes of thefirst biochemical steps of the classical aerobic (black box) and anaerobic (gray box) benzoate degradation pathways and that of the aerobic hybrid box pathway(white box) are shown. The activation and the dearomatization/ring-cleavage steps are indicated by white and striped arrows, respectively. The lower pathwaythat funnels the dehydroadipyl-CoA semialdehyde into the central metabolism is represented by a dotted arrow. OX, benzoate dioxygenase; DH, benzoatedihydrodiol dehydrogenase; DOX, catechol dioxygenase (ortho (intradiol) or meta (extradiol) cleavage). The Box enzymes responsible for the activation anddearomatization/ring-cleavage reactions are indicated: BclA, benzoate-CoA ligase; BoxA, NADPH-dependent reductase; BoxB, benzoyl-CoA 2,3-epoxidase;BoxC, 2,3-epoxybenzoyl-CoA dihydrolase. B, schemes of the major arrangements of the functional modules within the box clusters from proteobacteria areshown. The activation (C1, bclA gene), dearomatization/ring-cleavage (C2, boxABC genes), and lower pathway (C3) catabolic modules are shown by white,striped, and dotted arrows, respectively. The putative regulatory module (boxR gene) is shown by black arrows. It should be noted that the gene compositionand arrangement within the C3 module can differ even among strains of the same genus. Type 1 box clusters are present in many �-proteobacteria, e.g. strainsof the Azoarcus/Aromatoleum, Burkholderia, Bordetella, Polaromonas, Rhodoferax, Delftia, Variovorax, Leptothrix, Verminephrobacter, Comamonas, Achromobac-ter, Ralstonia, Cupriavidus genera. Type 2 box clusters are present in some �-proteobacteria where the C1 module can be associated, e.g. strains of the Silicibacterand Jannaschia genera, or not, e.g. Magnetospirillum sp. AMB-1, to the box cluster. Although types 1 and 2 usually contain the boxA gene within the C2 module,in some strains this gene is missing. Type 3 box clusters are present in other �-proteobacteria where the C3 module contains only one gene and the C2 modulelacks the boxA gene, e.g. strains of the Rhodopseudomonas and Bradyrhizobium genera, or in some �-proteobacteria, e.g. Thauera aromatica, where the C3module is not found between the C1 and C2 modules. In the genome of some �-proteobacteria, e.g. Sorangium cellulosum, there is a boxR gene divergentlyoriented to the C2 module (boxBC genes).

Cross-regulation of Benzoate Degradation in Azoarcus sp. CIB

MARCH 23, 2012 • VOLUME 287 • NUMBER 13 JOURNAL OF BIOLOGICAL CHEMISTRY 10495

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

775-bp PCR-amplified fragments that include the boxD-boxRintergenic region were obtained by using Azoarcus sp. CIBgenomic DNA as template and the oligonucleotides 5�pboxR/3�pboxR (PX fragment) and 5�pboxD/3�pboxD (PD fragment)(Table 2). The PX and PD fragments were digested with KpnIand XbaI restriction enzymes and ligated to the KpnI/XbaIdouble-digested pSJ3 promoter-probe vector, rendering plas-mids pSJ3PX and pSJ3PD, respectively (Table 1). The correctlacZ translational fusions were confirmed by nucleotidesequence analysis. The pQE32-His6BoxR plasmid was con-structed by cloning into BamHI/PstI double-digested pQE32plasmid (Table 1) a 903-bp BamHI/PstI fragment harboring theboxR gene obtained by PCR amplification of Azoarcus sp. CIBgenomic DNA with oligonucleotides 5�Hisbox and 3�Hisbox(Table 2). The recombinant plasmid pQE32-His6BoxRexpresses under control of the T5 promoter and two lac oper-ator boxes the protein His6-BoxR that carries 13 amino acids(MRGSHHHHHHGIL) fused to its N terminus (second aminoacid). To construct plasmid pCK01BoxR (Table 1), the His6-boxR gene cloned into pQE32-His6BoxR plasmid was EcoRI/BamHI double-digested and subcloned into an EcoRI/BamHIdouble-digested pCK01 plasmid. E. coli cells were grown at37 °C in Luria-Bertani (LB) medium (37). When required,E. coli cells were grown aerobically or anaerobically (using 10mM nitrate as the terminal electron acceptor) in M63 minimalmedium (38) at 30 °C using the corresponding necessary nutri-tional supplements and 20 mM glycerol as carbon source. Azo-arcus strains were grown aerobically or anaerobically (using 10

mM nitrate as the terminal electron acceptor) at 30 °C in MCmedium as described previously (26). Where appropriate, anti-biotics were added at the following concentrations: ampicillin(100 �g/ml), chloramphenicol (30 �g/ml), kanamycin (50�g/ml), and streptomycin (50 �g/ml).Molecular Biology Techniques—Recombinant DNA tech-

niques were carried out by published methods (37). PlasmidDNAwas preparedwithHigh pure plasmid isolationKit (RocheApplied Science). DNA fragments were purified with GeneClean Turbo (Q-BIOgene). Oligonucleotides were supplied bySigma. All cloned inserts and DNA fragments were confirmedby DNA sequencing with an ABI Prism 377 automated DNAsequencer (Applied Biosystems). Transformation of E. coli wascarried out by using the RbCl method or by electroporation(Gene Pulser, Bio-Rad) (37). Plasmids were transferred fromE. coli S17–1�pir or E. coli SM10�pir (donor strains) into Azo-arcus sp. CIB (recipient strains) by biparental filter mating asdescribed previously (26). Proteins were analyzed by SDS-PAGE (39).Sequence Data Analyses—The nucleotide sequence of the

box cluster from Azoarcus sp. CIB has been submitted to theGenBankTM with accession number HE589495. Nucleotidesequence analyses were done at the National Center for Bio-technology Information (NCBI) server (available at WorldWide Web at www.ncbi.nlm.nih.gov). Open reading framessearches were performed with the ORF Finder program at theNCBI server (www.ncbi.nlm.nih.gov). Gene cluster search wasperformed at the KEGG server. The codon adaptation index

TABLE 1Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype or phenotypea Ref. or source

E. coli strainsCC118 �(ara-leu) araD �lacX74 galE galK phoA20 thi-1 rpsE (Spr) rpoB (Rfr) argE (Am) recA1 29DH10B F�,mcrA �(mrr hsdRMS-mcrBC) �80dlac�M15 �lacX74 deoR recA1 araD139 �(ara-leu)7697 galU galK rpsL

(Smr) endA1 nupGInvitrogen

M15 Strain for regulated high level expression with pQE vectors QiagenMC4100 araD139 �(argF-lac)U169 rpsL150 (Smr) relA1 flbB5301 deoC1 ptsF25 rbsR 30AFMCPN Km

r Rfr, MC4100 spontaneous rifampicin-resistant mutant harboring a chromosomal insertion of the PN::lacZtranslational fusion

27

SM10�pir Kmr thi-1 thr leu tonA lacY supE recA::RP4–2-Tc::Mu �pir lysogen 31

S17-1�pir Tpr Smr recA thi hsdRM� RP4::2-Tc::Mu::Km Tn7 �pir lysogen 32Azoarcus sp. strainsCIB Wild type strain 26CIBdbzdR Km

r, Azoarcus sp. strain CIB with a disruption of the bzdR gene 27CIBdboxR Smr, Azoarcus sp. strain CIB with a disruption of the boxR gene This workCIBdboxRbzdR Km

r, Smr, Azoarcus sp. strain CIB with a disruption of bzdR and boxR This workCIBdbclA Km

r, Azoarcus sp. strain CIB with a disruption of the bclA gene This workPlasmidspQE32 Apr, oriColE1, T5 promoter lac operator, � to /E. coli rrnB T1 terminators, N-terminal His6 QiagenpQE32-His6BzdR Apr, pQE32 derivative harboring the His6-bzdR gene 27pQE32-His6BoxR Apr, pQE32 derivative harboring the His6-boxR gene This workpREP4 Km

r, plasmid that expresses the lacI repressor QiagenpECOR7 Apr, pUC19 harboring a 7.1 kb EcoRI DNA fragment containing the bzdRNO genes 26pK18mob Km

r, oriColE1 Mob� lacZ�, used for directed insertional disruption. 33pK18mobbzdR Km

r; 499-bp blunt-ended bzdR internal fragment cloned into SmaI-digested pK18mob 27pK18mobbclA Km

r; 578-bp bclA internal fragment cloned into EcoRI/SmaI-digested pK18mob This workpSJ3 Apr, oriColE1, ´lacZ, promoter probe vector; lacZ fusion flanked by NotI 34pSJ3PX Apr, pSJ3 derivative carrying the translational fusion PX::lacZ This workpSJ3PD Apr, pSJ3 derivative carrying the translational fusion PD::lacZ This workpKNG101 Smr, oriR6K, Mob�, suicide vector used for directed insertional disruption 35pKNG101boxR Smr, 525-bp BamHI/SpeI boxR internal fragment cloned into BamHI/SpeI double digested pKNG101 vector This workpCK01 Cmr, oripSC101, low copy number cloning vector with polylinker flanked by NotI sites 36pCK01BzdR Cmr, pCK01 derivative harboring a 1.6-kb DNA fragment from pECOR7 containing the bzdR gene under

control of Plac27

pCK01BoxR Cmr, pCK01 derivative harboring a 1.0 kb DNA fragment from pQE32-His6BoxR containing the His6-boxRgene under control of Plac

This work

a Apr, ampicillin-resistant; Cmr, chloramphenicol-resistant; Kmr, kanamycin-resistant; Rfr, rifampicin-resistant; Smr, streptomycin-resistant; Spr, spectinomycin-resistant.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(CAI) was determined at the CAIcaI server (40) using the Azo-arcus sp. CIB whole genome nucleotide sequence. The aminoacid sequences of the open reading frames were compared withthose present in databases using the TBLASTN algorithm (41)at the NCBI server (blast.ncbi.nlm.nih.gov). Pairwise and mul-tiple protein sequence alignments were made with the Clust-alW program (42) at the EMBL-EBI server. Phylogenetic anal-ysis of BoxR-like proteins was carried out according to theKimura two-parameter method (43), and a tree was recon-structed using the neighbor-joiningmethod (44) of the PHYLIPprogram (45). Protein secondary structure prediction was per-formed by using the JPred3 program (46).Construction of Azoarcus sp. CIBdboxR, Azoarcus sp. CIBd-

boxRbzdR, and Azoarcus sp. CIBdbclA Strains—For insertionaldisruption of the boxR gene through single homologous recom-bination, a 525-bp internal fragment of the boxR genewas PCR-amplified with primers 5�boxRmut and 3�boxRmut (Table 2),and it was cloned into the BamHI/SpeI-digested pKNG101plasmid. The resulting construct, pKNG101boxR (Table 1), wastransferred from E. coli SM10�pir (donor strain) into Azoarcussp. CIB (recipient strain) by biparental filter mating. An excon-jugant, Azoarcus sp. CIBdboxR, was isolated aerobically onstreptomycin-containing MC medium harboring 10 mM

glutarate as the sole carbon source for counterselection of thedonor cells. Themutant strain was analyzed by PCR to confirmthe disruption of the target gene. For the construction of the

Azoarcus sp. CIBdboxRbzdR strain, we used the E. coli S17–1�pir (pK18mobbzdR) as the donor strain, and Azoarcus sp.CIBdboxRwas used as recipient strain in a biparental filtermat-ing. An exconjugant, Azoarcus sp. CIBdboxRbzdR, was isolatedaerobically on streptomycin- and kanamycin-containing MCmedium harboring 10 mM glutarate as the sole carbon sourcefor counterselection of donor cells. The mutant cells were ana-lyzed by PCR to confirm the disruption of the target gene. Forinsertional disruption of the bclA gene through single homolo-gous recombination, a 578-bp internal fragment of the bclAgene was PCR-amplified with primers 5�LigO21055 and3�LigO21633 (Table 2), and it was cloned into the EcoRI-SmaI-digested pK18mob plasmid, giving rise to pK18mobbclA (Table1). The pK18mobbclA plasmid was transferred from E. coliS17–1�pir (donor strain) into Azoarcus sp. CIB (recipientstrain) by biparental filter mating. An exconjugant, Azoarcussp. CIBdbclA, was isolated aerobically on kanamycin-contain-ing MC medium harboring 10 mM glutarate as the sole carbonsource for counterselection of the donor cells. The mutantstrain was analyzed by PCR to confirm the disruption of thetarget gene.Overproduction of His6-BoxR and His6-BzdR—The recombi-

nant plasmids pQE32-His6BoxR and pQE32-His6BzdR (Table1) carry the boxR and bzdR genes, respectively, without theATG start codon and with a His6 tag coding sequence at its5�-end, under control of the PT5 promoter and two lac operator

TABLE 2Oligonucleotides used in this study

Primers Sequence (5�–3�)a Use

5� Hisbox CGGGATCCTTAGCCTCGAACCCACCACCG (BamHI) 903-bp boxR fragment cloned into BamHI/PstIdouble digested pQE32 to generate plasmidpQE32-His6BoxR

3� Hisbox AACTGCAGTCAGCCCAGTACGAGCTGGCG(PstI)

5� pboxD GGGGTACCCAGCGGCATCAGGAAGTGCTG(KpnI) 775-bp boxDR intergenic region cloned into theKpnI/XbaI digested pSJ3 vector to give riseto plasmid pSJ3PD

3�pboxD GCTCTAGAGGGAGGCTCATCTGGGTTCCTTTCTTG (XbaI)

5�pboxR GCTCTAGAGGCAGCGGCATCAGGAAGTGCTG (XbaI) 775-bp boxDR intergenic region cloned into theKpnI/XbaI digested pSJ3 vector to give riseto plasmid pSJ3PX

3�pboxR CCGGTACCGAGGCTCATCTGGGTTCCTTTCTTG(KpnI)

FPAdh 5� CGGAATTCGCACCTTCGATCCATTGCCC (EcoRI) 234-bp boxDR intergenic fragment forfootprinting assaysFPAdh 3� bis AAAAGTACTCGGTTGCTGTGATGCTGTGTC (ScaI)

5�FPAdhRev AAAAGTACTAATACACGCGCGAAATTCCTC (ScaI) 266-bp boxDR intergenic fragment for gelretardation and footprinting assays3�FPAdhRev CGGAATTCTGCTGCGGTTCGGTGGTG (EcoRI)

5�boxRmut CGGGATCCGCAACGTGTCCATCGTCCTGC (BamHI) 525-bp boxR internal fragment cloned intoBamHI/SpeI digested pKNG101 vector togenerate pKNG101boxR

3�boxRmut GGACTAGTGCCATGTGTTCTTCCGGCTGC (SpeI)

5�boxRq ACTTCGGCCACGAGGAAGCTG 152-bp boxR fragment for RT-PCR assays3�boxRq GATGCCGGTTTCCTTCTCGATC5� bzdRq CGATGAGAACTCATCACGGCTC 124-bp bzdR fragment for RT-PCR assays3�bzdRq CAGCATCTTGCGCGTCATTC5�pboxdQ CAACTCCAGTGCCTGTGCG 153-bp PD promoter fragment for RT-PCR

assays3�pboxdQ GAGAGGAGACAATCAGGTGAAGC5�RTpN1 GCAACACATCAGAGGAGATAG 141-bp PN promoter fragment for RT-PCR

assays3�RTpN2 GTGTAGGTACACATCGTTGC5�boxDext TGCGACGTCGATACCGTGGGA Used in primer extension assays of boxDLac 57 CGATTAAGTTGGGTAACGCCAGGG Used in primer extension assays of boxRF24 CGCCAGGGTTTTCCCAGTCAGGAC Used to analyze by PCR disruption insertions

with pK18mobR24 AGCGGTAACAATTTCACACAGGA Used to analyze by PCR disruption insertions

with pK18mobFpKNG101 GTCGCCGCCCCGTAACCTGTCG Used to analyze by PCR disruption insertions

with pKNG101RpKNG101 CGGGCCTCTTGCGGGATAACTGC Used to analyze by PCR disruption insertions

with pKNG1015�POLIIIHK CGAAACGTCGGATGCACGC 166-bp internal fragment of dnaE (encoding the

� subunit of DNA polymerase III) used asinternal control in RT-PCRs

3�POLIIIHK GCGCAGGCCTAGGAAGTCGAAC

5�LigO21055 GCGAATTCGAAATGCTGCACATCTTCCTGTC (EcoRI) 578-bp bzdA internal fragment cloned intoEcoRI/SmaI digested pK10mob vector togenerate pK18mobbclA

3�LigO21633 GCCCGGGTTGAAGCGCTGGATCTTGCC (SmaI)

a Engineered restriction sites are underlined, and the corresponding restriction enzyme is shown in parentheses.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

boxes. The His-tagged BoxR and BzdR proteins were overpro-duced in E. coli M15 strain-harboring plasmids pQE32-His6BoxR and pQE32-His6BzdR, respectively, and the pREP4plasmid (Table 1) that produces the LacI repressor to strictlycontrol gene expression from pQE32 derivatives in the pres-ence of isopropyl-1-thio-�-D-galactopyranoside. E. coli M15(pREP4, pQE32-His6BoxR) and E. coli M15 (pREP4, pQE32-His6BzdR) cellswere grown at 37 °C in 100ml of ampicillin- andkanamycin-containing LB medium until the cultures reachedmidexponential growth phase. Overexpression of the His-tagged proteins was then induced during 5 h by the addition of0.1 mM isopropyl-1-thio-�-D-galactopyranoside. Cells wereharvested at 4 °C, resuspended in 10 ml FP buffer (20 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM �-mercaptoethanol, and 50mM KCl), and disrupted by passage through a French press(Aminco Corp.) operated at a pressure of 20,000 p.s.i. The celllysate was centrifuged at 26,000 � g for 25 min at 4 °C. Theprotein concentrations in cell extracts were determined follow-ing themethod of Bradford (47) using bovine serum albumin asthe standard. The amount of His6-BoxR and His6-BzdR pro-teins in the cell extracts was estimated by densitometry of thecorresponding bands in a Coomassie Brilliant Blue-stained12.5% SDS-PAGE, and it was about 12 and 10% of the totalprotein, respectively (supplemental Figs. S1).Gel Retardation Assays—The PN probe was obtained as

described previously from plasmid pECOR7 (27). The boxDRprobe was PCR-amplified from pSJ3PR plasmid (Table 1) byusing oligonucleotides 5�FPAdhRev and 3�FPAdhRev (Table 2).The amplified DNA was then digested with ScaI and EcoRIrestriction enzymes and labeled by filling in the overhangingEcoRI-digested endwith [�-32]dATP (6000Ci/mmol; PerkinEl-mer Life Sciences) and the Klenow fragment of E. coli DNApolymerase I as described previously (37). The retardation reac-tion mixtures in FP buffer contained 0.5 nM DNA probe, 500�g/ml bovine serum albumin, 25 �g/ml herring sperm (com-petitor) DNA, and His6-BoxR cell extracts in a 9-�l final vol-ume. After incubation of the retardationmixtures for 20min at30 °C, the reactions were analyzed by electrophoresis in 5%polyacrylamide gels buffered with 0.5 � TBE (45 mM Trisborate, 1 mM EDTA). The gels were dried on Whatman No.3MM paper and exposed to Hyperfilm MP (AmershamBiosciences).DNase I Footprinting Assays—The boxD-boxR intergenic

fragments were obtained by PCR amplification from pSJ3PDand pSJ3PR plasmids (Table 1) with the oligonucleotide pairsFPAdh5�/FPAdh3�bis and 5�FPAdhRev/3�FPAdhRev (Table 2),respectively. To label the fragment at the boxD end, the ampli-fied DNA was digested with ScaI and EcoRI restrictionenzymes, and the resulting 234-bp fragment was single end-labeled by filling in the overhanging EcoRI-digested end with[�-32]dATP (6000 Ci/mmol; PerkinElmer Life Sciences) andthe Klenow fragment of E. coliDNA polymerase I, as describedpreviously (27). To label the fragment at the boxR end, the PCRamplification reaction was performed with the 3�FPAdhRevprimer previously labeled at its 5�-end with phage T4 polynu-cleotide kinase and [�-32P]ATP (3000 Ci/mmol; PerkinElmerLife Sciences). For DNase I footprinting assays, the reactionmixture contained 2 nM DNA probe, 1 mg/ml bovine serum

albumin, and cell extracts in 15�l of FP buffer (see above). Thismixture was incubated for 20 min at 30 °C, after which 3 �l(0.05 unit) of DNase I (Amersham Biosciences) (prepared in 10mMCaCl2, 10mMMgCl2, 125mMKCl, and 10mMTris-HCl, pH7.5) was added, and the incubation was continued at 37 °C for20 s. The reaction was stopped by the addition of 180 �l of asolution containing 0.4 M sodium acetate, 2.5 mM EDTA, 50�g/ml calf thymus DNA, and 0.3 �g/ml glycogen. After phenolextraction, DNA fragments were analyzed as previouslydescribed (27). A�G Maxam and Gilbert reactions (48) werecarried out with the same fragments and loaded on the gelsalong with the footprinting samples. The gels were dried onWhatman No. 3MM paper and exposed to Hyperfilm MP(Amersham Biosciences).Primer Extension Analysis—E. coli CC118 cells harboring

pSJ3PD or pSJ3PR plasmids were grown aerobically on LBmedium until mid-exponential growth phase. Total RNA wasisolated by using RNeasy Mini kit (Qiagen) according to theinstructions of the supplier. Primer extension reactions werecarried out with the avian myeloblastosis virus reverse tran-scriptase (Promega) and 10 �g of total RNA as described pre-viously (27) using oligonucleotides 5�boxDext andLac57 (Table2), whichhybridizewith the coding strandof the boxD and boxRgenes, respectively, labeled at their 5�-end with phage T4 poly-nucleotide kinase and [�-32P]ATP (3000 Ci/mmol; PerkinEl-mer Life Sciences). To determine the length of the primerextension products, sequencing reactions of pSJ3PD andpSJ3PRwere carried out with oligonucleotides 5�boxDext and Lac57,respectively, using the T7 sequencing kit and [�32P]dATP(PerkinElmer Life Sciences) as indicated by the supplier. Prod-ucts were analyzed on 6% polyacrylamide-urea gels. The gelswere dried on Whatman No. 3MM paper and exposed toHyperfilm MP (Amersham Biosciences).RT-PCR and Real-time RT-PCR Assays—Total RNA was

extracted from Azoarcus sp. CIB cells grown aerobically oranaerobically inMCmediumharboring the appropriate carbonsource. Cells were then harvested at themid-exponential phaseof growth and stored at �80 °C. Pellets were thawed, and cellswere lysed in TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA)containing 5 mg/ml lysozyme. RNA was extracted using theRNeasy mini kit (Qiagen), including a DNase I treatmentaccording to the manufacturer instructions, precipitated withethanol, washed, and resuspended in RNase-free water. Theconcentration and purity of the RNA samples were measuredby using a ND1000 Spectrophotometer (Nanodrop Technolo-gies) according to the manufacturer’s protocols. Synthesis oftotal cDNA was carried out with 20 �l of reverse transcriptionreactions containing 1 �g of RNA, 0.5 mM concentrations ofeach dNTP, 200 units of SuperScript II reverse transcriptase(Invitrogen), and 5 �M concentrations of random hexamers asprimers in the buffer recommended by themanufacturer. Sam-ples were initially heated at 65 °C for 5 min, then incubated at42 °C for 2 h, and the reactions were terminated by incubationat 70 °C for 15 min. In standard RT-PCR reactions, the cDNAwas amplified with 1 unit of AmpliTaq DNA polymerase(Biotools) and 0.5 �M concentrations of the correspondingprimer pairs. Control reactions in which reverse transcriptasewas omitted from the reaction mixture ensured that DNA



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from


http://www.jbc.org/

products resulted from the amplification of cDNA rather thanfrom DNA contamination. For real-time RT-PCR assays, thecDNA was purified using Geneclean Turbo kit (MP Biomedi-cals), and the concentration was measured using a ND100Spectrophotometer (Nanodrop Technologies). The IQ5Multi-color Real-time PCR Detection System (Bio-Rad) was used forreal-time PCR in a 25-�l reaction containing 10 �l of dilutedcDNA (5 ng in each reaction), 0.2 �M primer 5�, 0.2 �M primer3�, and 12.5 �l of SYBR Green Mix (Applied Biosystems). Thepairs of oligonucleotides used to amplify the mRNA driven bythe PD (boxD) and PN promoters and that of the boxR and bzdRgenes were 5�pboxdQ/3�pboxdQ, 5�RTpN1/3�RTpN2,5�boxRq/3�boxRq, and 5�bzdRq/3�bzdRq, respectively, andtheir sequences are detailed in Table 2. The dnaE gene encod-ing the�-subunit ofDNApolymerase III was used to provide aninternal control cDNA that was amplified with oligonucleo-tides 5�POLIIIHK/3�POLIIIHK (Table 2) and used to normal-ize the sample data. PCR amplifications were carried out asfollows: 1 initial cycle of denaturation (95 °C for 4min) followedby 30 cycles of amplification (95 °C, 1 min; test annealing tem-perature, 60 °C, 1 min; elongation and signal acquisition, 72 °C,30 s). Each reaction was performed in triplicate. After the PCRamelting curve was generated to confirm the amplification of asingle product. For relative quantification of the fluorescencevalues, a calibration curve was constructed for each ampliconby 5-fold serial dilutions of an Azoarcus sp. CIB genomic DNAsample ranging from 0.5 ng to 0.5 � 10�4 ng. This curve wasthen used as a reference standard for extrapolating the relativeabundance of the cDNA targets within the linear range of thecurve. Results were normalized relative to those obtained forthe dnaE internal control.

�-Galactosidase Assays—The �-galactosidase activities weremeasured with permeabilized cells when cultures reachedmid-exponential phase as described by Miller (38).Cell Viability Assays—Azoarcus sp. CIB, Azoarcus sp. CIBd-

boxR,Azoarcus sp. CIBdbzdR, andAzoarcus sp. CIBdboxRbzdRstrains were grown anaerobically in MC medium (in theabsence of antibiotics) with 10 mM glutarate as the sole carbonsource until the cells reached an A600 of 0.1. The number ofviable cells in four replicates was determined on MC mediumagar plates containing 10 mM glutarate as the unique carbonsource, and no antibiotic was added to the medium to avoid itsnegative effect on the growth yield. The plates were incubatedfor 72 h at 30 °C, and then the number of colony forming units(CFUs)5 was calculated.

RESULTS AND DISCUSSION

boxR Gene Encodes a Transcriptional Regulator of box Genesin Azoarcus sp. CIB—During the course of a genome sequenc-ing project of Azoarcus sp. CIB, we identified a set of 16 genesthat show a high identity (�90%) and a similar organization tothe box cluster previously characterized in Azoarcus evansii(14) and also a significant identity (�80%) with that predictedin Aromatoleum aromaticum EbN1 (25) and Azoarcus sp.BH72 (49), strongly suggesting the existence of identical ben-

zoate-degradation pathways in these bacteria (supplementalFigs. S2). The construction of an Azoarcus sp. CIBdbclA strainharboring a disrupted bclA gene (Table 1) and the observationthat this mutant strain lacked the ability to grow aerobically onbenzoate as the sole carbon source (data not shown) confirmedthe participation of the identified box cluster in the aerobicdegradation of benzoate in Azoarcus sp. CIB.As occurs inA. evansii (14), the box cluster fromAzoarcus sp.

CIB is arranged in at least two divergent operons driven by thePD and PX promoters (supplemental Figs. S2). The boxR genefrom Azoarcus sp. CIB, which corresponds to orf10 in the boxcluster from A. evansii (14), encodes a protein of 300 aminoacids that shows an overall 47% sequence identity and a similardomain organization than the BzdR transcriptional repressorthat controls the bzd genes responsible for the anaerobic deg-radation of benzoate in this strain (27). Thus, whereas theN-terminal region of BoxR (residues 1–93) exhibits significantsimilaritywith transcriptional regulators of theHTH-XRE fam-ily, theC-terminal domain of BoxR (residues 133–300) presentshigh identity with shikimate kinases (Fig. 2). The central regionof BoxR (residues 94–132) corresponds to the linker region ofBzdR involved in the transmission of the conformationalchange from the C-terminal effector binding domain to theN-terminal DNA binding domain (50). Interestingly, the cen-tral regions of both regulators show the lowest amino acidsequence identity (24%) (Fig. 2).To demonstrate whether boxR regulates the box pathway,

the expression of the box genes was monitored by RT-PCRanalysis in the wild-type strain and in the Azoarcus sp.CIBdboxRmutant strain that harbors a disruption insertion ofthe boxR gene (Table 1).Whereas the wild-type strain showed abenzoate-inducible expression of the boxD gene, this catabolicgene was efficiently expressed both in the presence or in theabsence of benzoate in the boxR mutant strain (Fig. 3A), thussuggesting that boxR encodes a transcriptional repressor of thebox genes.To further investigate the regulatory role of the BoxR protein

on the expression of the box genes, the activity of the PD and PXpromoters was monitored in a heterologous host, i.e. E. coli, inthe absence or presence of the boxR gene. To accomplish this,the boxD-boxR intergenic region was PCR-amplified andcloned in both orientations in the pSJ3 promoter probe vector,giving rise to plasmids pSJ3PD and pSJ3PX that express thePD::lacZ and PX::lacZ translational fusions, respectively (Table1). On the other hand, the boxR gene was cloned under thecontrol of the heterologous Plac promoter-producing plasmidpCK01BoxR (Table 1). The �-galactosidase assays of permea-bilized E. coli CC118 (pSJ3PD) and E. coli CC118 (pSJ3PX) cellsgrown aerobically in glycerol-containing minimal mediumrevealed that both promoters were active, although PD wasabout 3.5-fold more active than PX (Fig. 3B). Remarkably, theactivity of both promoters was drastically reduced in the pres-ence of the boxR gene as shown by the low �-galactosidaselevels measured in permeabilized E. coli CC118 (pSJ3PD,pCK01BoxR) and E. coli CC118 (pSJ3PX, pCK01BoxR) cells(Fig. 3B), suggesting that the regulatory circuit alsoworks in theheterologous host. Therefore, these results confirm that PD and

5 The abbreviations used are: CFU, colony forming units; HTH,helix-turn-helix.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from




http://www.jbc.org/

PX are functional promoters whose activity becomes negativelyregulated by the product of the boxR gene.All these results taken together reveal that the boxR gene

product behaves as a transcriptional repressor of the box genesin Azoarcus sp. CIB, and most probably a similar regulatorysystemmay account for the transcriptional control of the box

genes in other bacteria. A phylogenetic tree of all members ofthe BzdR subfamily present in the databases reveals a goodcorrelation between the taxonomical position of the orga-nism, i.e. �-, �-, and �-proteobacteria, and the level of iden-tity among BoxR homologues (supplemental Figs. S3). Thephylogenetic analysis also suggests that in the evolution of

FIGURE 2. Amino acid sequence comparison between BzdR and BoxR proteins from Azoarcus sp. CIB. The amino acid sequences of BzdR (AAQ08805) andBoxR (CCD33120) were aligned using the multiple sequence alignment program ClustalW. The amino acid residues of each sequence are numbered at the right.Amino acids are indicated by their standard one-letter code. Dark gray shows identical residues in the two sequences, whereas light gray indicates functionalsimilarity between residues. The �-helices and �-strands predicted for the BzdR (top) and BoxR (bottom) proteins are also drawn. The N terminus, linker, andC-terminal regions of both proteins are indicated at the top. The predicted helix-turn-helix (HTH) motif for DNA binding is marked within the N-terminal region.

FIGURE 3. The boxR gene encodes a transcriptional repressor of the box genes. A, agarose gel electrophoresis of RT-PCR products is shown. TotalRNA was isolated from Azoarcus sp. CIB (CIBwt) or Azoarcus sp. CIBdboxR (CIBdboxR) cells grown in alanine (0.4%)-containing MC medium in the presence(lanes 1 and 5) or in the absence (lanes 3 and 7) of 1 mM benzoate (Bz). RT-PCRs were performed as indicated under “Experimental Procedures” with theprimer pair 5�pboxdQ/3�pboxdQ (Table 2) that amplifies a 153-bp fragment of the boxD gene (arrow). Lanes 2, 4, 6, and 8, control reactions in whichreverse transcriptase was omitted from the reaction mixture. Lane M, molecular size markers (HaeIII-digested �X174 DNA). Numbers on the rightrepresent the sizes of the markers (in base pairs). B, shown is �-galactosidase activity of E. coli CC118 cells grown aerobically in glycerol-containingminimal medium and harboring plasmids pSJ3PD (PD::lacZ) (white bars) or pSJ3PX (PX::lacZ) (black bars) and the pCK01BoxR (BoxR) or the control plasmidpCK01 (�). Values for �-galactosidase activity (in Miller units) were determined as indicated under “Experimental Procedures.” Each value is the averagefrom three separate experiments; error bars indicate S.D.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from


http://www.jbc.org/

the BzdR-like regulators, the widespread BoxR proteinsmight have evolved and give rise to the anaerobic BzdR reg-ulators that are found so far only in some Azoarcus/Aroma-toleum strains.Identification of BoxR Binding Sites and Benzoyl-CoA as

InducerMolecule—To further study the interaction of theBoxRprotein with the PD and PX promoters, we first mapped thetranscription start sites of the promoters and overproduced theregulatory protein in recombinant E. coli cells.Primer extension analyses were performed with total RNA

isolated from exponentially grown E. coli CC118 (pSJ3PD) andE. coliCC118 (pSJ3PX) cells (Figs. 4,A andB). The transcriptionstart site at the PD promoter was mapped in a cytosine located85 nucleotides upstream of the GTG translation initiationcodon of the boxD gene. The transcription start site at the PXpromoter was mapped in a cytosine located 34 nucleotidesupstream of the ATG translation initiation codon of the boxRgene (Fig. 4C). An identical �35 box (TTGACG) and two verysimilar �10 boxes (TATT (C or G) T) that resemble the con-

sensus�35 and�10 boxes typical of�70-dependent promoters(51) were identified in the PD and PX promoters (Fig. 4C).

To overproduce the BoxR protein, the boxR gene was clonedinto the pQE32 vector under the control of the strong PT5promoter to render plasmid pQE32-His6BoxR (Table 1), andgene expression was induced in E. coli as detailed under“Experimental Procedures.” Unfortunately, the His6-BoxRprotein purified through affinity chromatography in nickel-nitrilotriacetic acid columns forms inactive aggregates, andtherefore, we have been obliged to use crude cell extracts ofE. coli M15 (pQE32-His6BoxR) as the source of an activeBoxR protein.To demonstrate in vitro that the BoxR regulatory protein

directly interacts with the PD and PX promoters, gel retardationassays were performed using as probe the boxD-boxR inter-genic region (boxDR probe). As expected, BoxR was able toretard the migration of the boxDR probe in a protein concen-tration-dependent manner (Fig. 5A). Because the addition ofthe unlabeled DNA probe prevented the formation of the pro-

FIGURE 4. Identification of the transcription start site in the PD and PX promoters. Total RNA was isolated from E. coli CC118 cells bearing the lacZtranslational fusion plasmid pSJ3PD (PD::lacZ) or pSJ3PX (PX::lacZ) as described under “Experimental Procedures.” The size of the extended product (lanesPD and PX) was determined by comparison with the DNA sequence ladder (lanes A, T, C, and G) of the PD (A) and PX (B) regions. Primer extension andsequencing reactions were performed with primers 5�boxDext (A) and Lac57 (B), respectively, as described under “Experimental Procedures.” Anexpanded view of the nucleotides surrounding the transcription initiation site (asterisk) in the noncoding strand is shown. C, shown is an expanded viewof the boxD-boxR intergenic region. The nucleotide sequence between the translation initiation codons (italics) of the divergent boxD (GTG) and boxR(ATG) genes is shown. The transcription initiation site (�1) of the boxD and boxR genes is indicated with white letters. The ribosome-binding site (RBS)and the inferred �10 and �35 regions of each promoter are underlined. The BoxR-mediated protection of the intergenic region from digestion by DNaseI is shown with boldface letters. The TGC(A) sequences within the protected region are underlined with broken lines, and some of them form part ofpalindromic structures (convergent arrows).



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tein-DNAcomplex (Fig. 5C), the BoxR bindingwas shown to bespecific.To determine the BoxR binding regions in the PD and PX

promoters, we performed DNase I footprinting assays. TheBoxR protein protected nucleotide sequences throughout theentire intergenic boxD-boxR region (Fig. 6). Moreover, bindingof BoxR induces changes in the DNA structure as revealed byseveral phosphodiester bonds that become hypersensitive toDNase I cleavage (Fig. 6). The DNase I-hypersensitive siteswere spaced at�10-nucleotide intervals (Fig. 6), correspondingto about 1 helix turn, which suggests binding of BoxR to oneside of the double helix. The BoxR binding regions in PD andPX promoters span the transcription initiation sites as well asthe �10 and �35 sequences for recognition of the �70-de-pendent RNA polymerase (Figs. 4C and 6), which is in agree-ment with the observed repressor role of BoxR at both pro-moters (Fig. 3). The protected regions usually contain directrepetitions of the TGCA sequence that, in some cases, islocated within longer palindromic structures (Fig. 4C). Thispromoter architecture based on short direct repeats resem-bles that of promoters regulated by other members of theHTH-XRE family of transcriptional regulators (52). In thissense the TGCA direct repeats have been shown to be pres-ent also at the PN promoter controlling the anaerobic bzdoperon in Azoarcus sp. CIB, and they were proposed to bethe BzdR-recognition sites (27, 50). This observation is inagreement with the fact that both BoxR and BzdR proteinscontain highly similar helix-turn-helix (HTH) DNA bindingdomains (Fig. 2), thus suggesting an analogous DNA recog-nition mechanism for these two regulators.As indicated above, the C-terminal region of BoxR shows a

significant similarity to the C-terminal domain of BzdR (Fig. 2)that has been proposed to interact with the inducer moleculebenzoyl-CoA (50). Because benzoyl-CoA is also the first inter-mediate in the aerobic degradation of benzoate via the boxpathway (Fig. 1A), it was tempting to speculate that benzoyl-CoA could be also the inducer molecule that switched on theexpression of the box genes. To check this assumption, differentconcentrations of benzoyl-CoA were added to the gel retarda-tion assays, revealing that 2mM inhibited binding of BoxR to theboxDR probe (Fig. 5B). On the contrary, the addition of 2 mM

benzoate or phenylacetyl-CoAdid not prevent the formation ofthe protein-DNA complex (Fig. 5B). These results were also

confirmed byDNase I footprinting assays. As expected, the spe-cific protection of the target promoter by the BoxR proteincould not be observed in the presence of benzoyl-CoA (Fig. 6,A,lanes 9 and 10, and B, lane 11), suggesting that this moleculealleviates the BoxR-DNA interaction. In contrast, the additionof other benzoyl-CoA analogues, such as phenylacetyl-CoA, orthe CoA-free benzoate did not avoid BoxR binding to the inter-genic boxD-boxR region (Fig. 6,A, lanes 11 and 12, and B, lanes9 and 10). These results suggest that benzoyl-CoA rather thanbenzoate may be the specific inducer molecule that interactswith the BoxR repressor, avoiding its binding to the promotersthat drive the expression of the box genes when Azoarcus sp.CIB grows in benzoate.All these results taken together show for the first time that

BoxR and benzoyl-CoA act as the specific regulator andinducer, respectively, that control the expression of the boxgenes in Azoarcus. Because the boxR gene is present in all boxclusters so far identified (Fig. 1B), the BoxR/benzoyl-CoA reg-ulatory systemmay also be a widespread strategy in bacteria forthe transcriptional control of the aerobic degradation of benzo-ate via the box hybrid pathway.Oxygen-independent Expression of box Cluster in Azoarcus

sp. CIB—It is well known that superimposed upon the specificregulation there is an additional control that links the inductionof aromatic catabolic clusters to the environmental changes (4,53–56). To determine whether oxygen controls the expressionof the box genes in Azoarcus sp. CIB, we checked by real timeRT-PCR analyses the expression of the boxD and boxR geneswhen the cells were cultivated in benzoate in the presence orabsence of oxygen. Because the expression of the box genes waseven higher in cells grown anaerobically than in cells grownaerobically (Fig. 7), oxygen does not appear to play a major rolein the activity of the PD and PX promoters. To confirm that thePD and PX promoters are also active under anaerobic condi-tions, the expression of the PD::lacZ and PX::lacZ translationalfusions was analyzed in recombinant E. coli CC118 cells grownanaerobically in glycerol-containing minimal medium. Asobserved above in the presence of oxygen (Fig. 3B), both pro-moters were active in the absence of oxygen, and they were alsoefficiently repressed by the boxR gene product (supplementalFigs. S4), revealing that PD and PX are oxygen-independentpromoters.

FIGURE 5. Interaction of the BoxR protein with boxD-boxR intergenic region. Gel retardation analyses of BoxR binding to the boxD-boxR intergenic regionwere performed as indicated under “Experimental Procedures.” A, lane 1, free boxDR probe; lane 2, retardation assay containing 1000 ng of E. coli M15 (pREP4,pQE32) control cell extract; lanes 3–5 show retardation assays containing 50, 100, and 200 ng, respectively, of E. coli M15 (pREP4, pQE32-His6BoxR) cell extractharboring the His6-BoxR protein (it represents about 12% of the total protein). B, lane 1, free boxDR probe; lanes 2–5, show retardation assays containing 200ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract and 0, 0.5, 1.0, and 2.0 mM benzoyl-CoA, respectively; lanes 6 and 7 show retardation assays containing200 ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract and 2.0 mM benzoate or phenylacetyl-CoA, respectively. C, lane 1, free boxDR probe; lanes 2–7 showretardation assays containing 200 ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract and 0, 5, 25, 50, 75, and 150 ng of boxDR unlabeled probe, respectively.The boxDR probe and the boxDR-BoxR complex are indicated by the arrows.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from



http://www.jbc.org/

Transcriptional Cross-regulation of Aerobic and AnaerobicBenzoate Degradation Pathways in Azoarcus sp. CIB—Asshown above, the boxR gene is expressed both under aerobicand anaerobic conditions in Azoarcus sp. CIB (Fig. 7). On theother hand, the bzdR gene encoding the specific transcriptionalregulator of the anaerobic bzd genes is also expressed bothunder aerobic and anaerobic conditions (57) and at levels thatdo not differ significantly from those of the boxR gene (Fig. 7).Moreover, because BoxR and BzdR share similar DNA bindingfeatures and use benzoyl-CoA as the inducer molecule, a simi-lar gene repression strategy for the cognate catabolic promoterscould be suggested, and transcriptional cross-regulationbetween the aerobic and anaerobic benzoate degradation path-ways could be anticipated.To experimentally demonstrate that BoxR and BzdR were

able to directly interact with the anaerobic PN promoter andwith the PX/PD promoters of the aerobic box genes, respec-tively, we first accomplished an in vitro approach. To study theinteraction of BoxR with the PN promoter, gel retardationassays were performed using the PN probe and increasing con-centrations of the BoxR protein. As shown in Fig. 8A, the BoxR

FIGURE 7. Expression of the boxD, boxR, and bzdR genes under aerobicand anaerobic conditions. Total RNA was isolated from Azoarcus sp. CIB cellsgrowing aerobically (black bars) or anaerobically (white bars) in 3 mM benzo-ate, and the expression of boxD, boxR, and bzdR genes was measured byreal-time RT-PCR as detailed under “Experimental Procedures.” The relativeexpression of the genes is shown in arbitrary units. Each value is the averagefrom three separate experiments; error bars indicate S.D.

FIGURE 6. DNase I footprinting analysis of the interaction of BoxR with the boxD-boxR intergenic region. The DNase I footprinting experimentswere carried out using the boxD-boxR intergenic fragments labeled at the boxD (A) or boxR (B) ends as indicated under “Experimental Procedures.”A, lane AG shows the A � G Maxam and Gilbert sequencing reaction. Lanes 1 and 13, footprinting assays containing 1600 ng of E. coli M15 (pREP4, pQE32)control cell extract. Lanes 2– 8, footprinting assays containing 25, 50, 100, 200, 400, 800, and 1600 ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extractharboring the His6-BoxR protein (it represents about 12% of the total protein), respectively. Lanes 9 and 10, footprinting assays containing 400 and 800ng, respectively, of cell extracts harboring the His6-BoxR protein and 2 mM benzoyl-CoA. Lanes 11 and 12, footprinting assays containing 400 ng of cellextract harboring the His6-BoxR protein and 2 mM benzoate or phenylacetyl-CoA, respectively. B, lane AG shows the A � G Maxam and Gilbertsequencing reaction. Lane 1, footprinting assay containing 1600 ng of E. coli M15 (pREP4, pQE32) control cell extract. Lanes 2– 8, footprinting assayscontaining 25, 50, 100, 200, 400, 800, and 1600 ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract harboring the His6-BoxR protein, respectively.Lanes 9 –11, footprinting assays containing 1600 ng of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract harboring the His6-BoxR protein and 2 mM

benzoate, phenylacetyl-CoA, and benzoyl-CoA, respectively. The protected regions are marked by brackets, and the phosphodiester bonds hypersen-sitive to DNase I cleavage are indicated by asterisks. The �10 and �35 boxes and the transcription initiation sites (�1) of the PD and PX promoters arealso shown.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

regulator was able to shift the PN probe in a concentration-de-pendent manner and with a similar efficiency than thatobserved with the cognate boxDR probe (Fig. 5). On the otherhand, the BzdR protein was able to retard the migration of theboxDR probe (Fig. 8B) with similar efficiency to that shownwith its cognate PN probe (Fig. 8C). Therefore, these resultsindicate that BoxR and BzdR are able to efficiently bind to theirheterologous PN and PX/PD promoters, respectively, support-ing the hypothesis that theymay act as repressors of their coun-terpart promoters. To demonstrate the last assumption, wemonitored the activity of the PN, PX, and PD promoters inrecombinant E. coli strains that contain the PN::lacZ, PX::lacZ,and PD::lacZ translational fusions, respectively, in the presenceor absence of the boxR or bzdR genes. To this end, the E. coliAFMCPN strain, which harbors a translational PN::lacZ fusionintegrated into the chromosome (27), was transformed withplasmids pCK01BoxR, pCK01BzdR (expresses the bzdR gene),or the control plasmid pCK01 (Table 1). On the other hand, theE. coli CC118 strain containing plasmids pSJ3PX (PX::lacZ) orpSJ3PD (PD::lacZ) was also transformed with plasmidspCK01BzdR or the control plasmid pCK01. The E. coli strainswere grown inMCminimalmedium supplementedwith 20mM

glycerol as sole carbon source under anaerobic conditions(AFMCPN-derived strains) or aerobic conditions (CC118

derived strains). The activity of the promoters was monitoredby measuring the �-galactosidase levels of permeabilized cells.As shown in Fig. 8D, under anaerobic conditions the BoxR reg-ulator was able to inhibit the activity of the PN promoter in ananalogous manner to that shown by the cognate BzdR repres-sor. Similarly, under aerobic conditions the BzdR regulator wasable to inhibit the activity of the PX (Fig. 8E) and PD (Fig. 8F)promoters as previously observed with the cognate BoxR repres-sor (Fig. 3B). All these results indicate thatBoxRandBzdRare ableto repress both the anaerobicPNpromoter and thePX/PDpromot-ers, and they may act synergistically controlling the expression ofthe box and bzd clusters inAzoarcus sp. CIB.To confirm the cross-regulation of the BoxR/BzdR regula-

tors and the catabolic PN and PD promoters, we measured theexpression of the bzdN and boxD genes in the wild-typeAzoar-cus sp. CIB strain and in the mutant strains Azoarcus sp.CIBdboxR (boxR gene disrupted),Azoarcus sp. CIBdbzdR (bzdRgene disrupted), and Azoarcus sp. CIBdboxRbzdR (boxR andbzdR genes disrupted) (Table 1). Interestingly, in the Azoarcussp. CIBdboxRbzdR double mutant strain the activity of the PNand PD promoters under non-inducing conditions (alanine)was similar to that found in the wild-type strain growing underinducing conditions (benzoate), and this activity was about100-fold higher than that in the wild-type strain growing in

FIGURE 8. Cross-interaction between BoxR and PN and between BzdR and PD/PX promoters. Gel retardation analyses of BoxR binding to the PN promoter(A) and BzdR binding to the boxD-boxR intergenic region (B) and PN promoter (C) were performed as indicated under “Experimental Procedures.” Lanes 1, freeprobes. Lanes 2– 6 show retardation assays containing 25, 50, 100, 200, and 400 ng, respectively, of E. coli M15 (pREP4, pQE32-His6BoxR) cell extract harboringHis6-BoxR protein (A) or E. coli M15 (pREP4, pQE32-His6BzdR) cell extract containing His6-BzdR protein (B and C). Lane c (A), retardation assay containing 400 ngof E. coli M15 (pREP4, pQE32) control cell extract. The PN and boxDR probes as well as the PN/BoxR, boxDR/BzdR and PN/BzdR complexes are indicated by thearrows. D, E, and F, expression shown is of the PN::lacZ, PX::lacZ, or PD::lacZ translational fusions, respectively. D, E. coli AFMCPN cells, which harbor a chromosomalPN::lacZ insertion, carrying plasmid pCK01BoxR (BoxR), pCK01BzdR (BzdR) or the control plasmid pCK01 (�) were grown anaerobically in glycerol-containingminimal medium. E and F, E. coli CC118 (pSJ3PX) (PX::lacZ) and E. coli CC118 (pSJ3PD) (PD::lacZ) cells, respectively, carrying plasmid pCK01BzdR (BzdR) or thecontrol plasmid pCK01 (�) were grown aerobically in glycerol-containing minimal medium. Values for �-galactosidase activity (in Miller units) were deter-mined when cultures reached mid-exponential phase as indicated under “Experimental Procedures.” Each value is the average from three separate experi-ments; error bars indicate S.D.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

alanine (Fig. 9). Thus, these results confirm that BoxR andBzdRare the key regulators that control the efficient repression of thetwo catabolic promoters in Azoarcus sp. CIB. Nevertheless, thePN promoter is more strictly repressed by the BzdR regulatorthan by the BoxR regulator (Fig. 9), suggesting that BzdR is themajor repressor of PN in Azoarcus sp. CIB. On the other hand,although the repression of the PDpromoter is significantly allevi-ated in theAzoarcus sp.CIBdboxR strain, theactivity levelsofPD inthe Azoarcus sp. CIBdbzdR strain indicates a BzdR-mediated10-fold repressionofPD (Fig. 9),which suggests that theBzdR-andBoxR-mediatedcontrolofPDarebothphysiologically relevantandnecessary for the tight regulation of the box pathway.All these results taken together reveal the existence of a tran-

scriptional cross-regulation between the anaerobic and the aer-obic benzoate degradation pathways in Azoarcus sp. CIB.Although there are some previous reports on cross-regulationbetween aromatic degradation pathways within the same orga-nism (58–62), a cross-regulation between anaerobic and aero-bic degradation pathways has never been shown before.Adaptive and Evolutionary Considerations about Presence of

boxR and bzdR Paralogs in Azoarcus sp. CIB—The BoxR andBzdR proteins from Azoarcus sp. CIB are homologous BzdR-type transcriptional regulators with distinct functions. How-ever, both proteins respond to the same inducer, benzoyl-CoA,and can recognize the same target promoters. This redundancyraises questions about the need for both regulators. As we haveshown above, the BzdR and BoxR regulators act synergisticallyto tightly control the expression of the bzd and box clusters (Fig.9). Moreover, it is known that functional and/or genetic redun-dancy of regulators is a straightforward solution toward therobustness of the regulatory network mitigating the effect ofnoise during gene regulation (63, 64).

The retention of the bzdR and boxR paralogs in the genomeof Azoarcus sp. CIB may favor the bacterial fitness under somegrowth conditions when the cells do not metabolize benzoate.To check this assumption, we measured the relative fitness ofthe wild-type strain versus that of the single and double mutantstrainswhen the cells were grown in a non-aromatic compoundas the carbon source and under non-optimal conditions, e.g. insolid medium. To accomplish this, cells of Azoarcus sp. CIBwild-type strain,Azoarcus sp. CIBdboxR, andAzoarcus sp. CIB-dbzdR single mutants and the Azoarcus sp. CIBdboxRbzdRdouble mutant were grown in glutarate-containing MC liquidmedium.When these cultures reached an optical density of 0.1,they were plated on glutarate-containing MC solid medium,and the number of viable cells was recorded. Whereas 2 � 108CFUs/ml were obtained from the culture of the wild-typestrain, 108 and 9� 107CFU/mlwere obtained from the culturesof the boxR and bzdRmutant strains, respectively, and only 3�106 CFU/ml were obtained from the culture of theAzoarcus sp.CIBdboxRbzdR double mutant. These results clearly show thatthe cell fitness becomes remarkably reduced in the boxR/bzdRdouble mutant strain. However, although the single boxR orbzdR mutants presented a decreased viability with respect tothat of the wild-type strain, the remaining regulator partiallycompensates for the loss of the other. Therefore, all theseresults taken together suggest that the presence of the boxR andbzdR genes in the genome of Azoarcus sp. CIB contributes tothe fitness of the cell avoiding the constitutive expression of thebox/bzd genes in amedium lacking benzoate and constitutes anadaptive advantagewhen the occasional failure of one regulatoris backed by the functionality of the other regulator. Neverthe-less, because the boxR gene is also present in some bacteria thatdo not harbor a box cluster, such as Rhodopseudomonas palus-

FIGURE 9. Synergistic effect of BzdR and BoxR repressors on the activity of the PD an PN promoters in Azoarcus sp. CIB. Azoarcus sp. CIB (CIBwt), Azoarcussp. CIBdboxR (CIBdboxR), Azoarcus sp. CIBdbzdR (CIBdbzdR), and Azoarcus sp. CIBdboxRbzdR (CIBdboxRbzdR) cells were grown anaerobically in 3 mM benzoate(gray bars) or 0.4% alanine (black bars) until the culture reached mid-exponential phase. Total RNA was isolated from cells, and the activity of the PN (strippedbars) or PD (filled bars) promoters was measured by real time RT-PCR as detailed under “Experimental Procedures.” The relative activity of the promoters isshown in arbitrary units. Each value is the average from three separate experiments; error bars indicate S.D.



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tris CGA009 (65) or some Methylobacterium spp. (www.ncbi.nlm.nih.gov), we cannot discard the fact that this regulatormaycontrol additional functions in the cell that can also compro-mise the bacterial fitness.Some bacteria, e.g. Thauera and Magnetospirillum strains,

that degrade benzoate both aerobically via the box pathway andanaerobically via the bzd pathway share the same benzoate-CoA ligase (bclA gene) for both pathways, and they have a singleboxR gene associated to the box cluster in their genomes (22,66). On the contrary, Azoarcus sp. CIB and A. aromaticumEbN1 strains contain two different regulator/ligase couplesassociated to the aerobic (BoxR regulator/BclA ligase) andanaerobic (BzdR regulator/BzdA ligase) pathways (25, 27). Thisobservation suggests that Azoarcus strains may have recruitedan additional regulatory circuit homologous to that of the boxpathway to tightly control the bzd genes. In this sense we haveshown above that the BoxR repressor is not able to efficientlyrepress the anaerobic PN promoter, and BzdR repressorbehaves as the main regulator of the bzd genes in strain CIB(Fig. 9). Despite the fact that the aerobic BoxR and the anaero-bic BzdR proteins belong to the same BzdR subfamily of regu-lators, the anaerobic BzdR regulators from the Azoarcus/Aro-matoleum strains cluster together in a branch of thephylogenetic tree separated from that of the BoxR regulatorsfrom these bacteria (supplemental Figs. S3). This finding sug-gests that although both types of regulators may have a com-mon ancestor, they have subsequently diverged and adapted tothe corresponding catabolic pathways. Interestingly, the nucle-otide sequences of bzdR and boxR genes from Azoarcus sp. CIBdiffer by379nucleotides among the total 894nucleotides, suggest-ing that either duplication of these regulatory genes in theAzoar-cus cell did not occur very recently or that both genes have differ-ent bacterial origins. In this sense, it is worth mentioning thatwhereas the GC content of the boxR gene (66.4%) matches theaverage GC content of the whole genome (65.8%) and it shows agood codon adaptation index (0.81), the GC content (62.8%) ofbzdR differs from that of the Azoarcus sp. CIB chromosome, andthis gene shows a lowcodonadaptation index (0.66). Interestingly,the bzdA gene also shows a codon adaptation index (0.69) that issignificantly lower than that of other bzd genes and the homolo-gous bclA gene (�0.8). Because such variations inGCcontent andcodon adaptation index are taken as indicators of horizontal genetransfer events (40), it seems likely that the bzdR gene andperhapsalso the bzdA genemight have been evolutionary recruited by thebzd catabolic cluster of someAzoarcus strains fromthebox clusterof adifferentorganism.The recruitedbzdRgenecould thenevolveto tightly regulate theanaerobicbenzoatedegradationbut still par-tially retain the control of the aerobic box pathway, which wouldexplain the observed cross-regulation reported in this work. Thecross-regulationbetween theaerobic andanaerobicbenzoatedeg-radation pathwaysmay reflect a biological strategy to increase thecell fitness in organisms that drive in environments subject tochanging oxygen concentrations.

Acknowledgments—The technical work of A. Valencia is greatly appre-ciated. The help of Secugen S.L. with sequencing is gratefullyacknowledged.

REFERENCES1. Lovley, D. R. (2003) Cleaning up with genomics. Applying molecular bi-

ology to bioremediation. Nat. Rev. Microbiol. 1, 35–442. Díaz, E. (2004) Bacterial degradation of aromatic pollutants. A paradigm

of metabolic versatility. Int. Microbiol. 7, 173–1803. Fuchs, G. (2008) Anaerobic metabolism of aromatic compounds. Ann.

N.Y. Acad. Sci. 1125, 82–994. Carmona, M., Zamarro, M. T., Blázquez, B., Durante-Rodríguez, G.,

Juárez, J. F., Valderrama, J. A., Barragán, M. J., García, J. L., and Díaz, E.(2009) Anaerobic catabolism of aromatic compounds. A genetic andgenomic view.Microbiol. Mol. Biol. Rev. 73, 71–133

5. Parales, R. E., and Resnick, S.M. (2006) in PseudomonasMolecular Biologyof Emerging Issues (Ramos, J. L., and Levesque, R. C., eds) Vol. 4, pp.287–340, Springer, The Netherlands

6. Vaillancourt, F. H., Bolin, J. T., and Eltis L. D. (2006) The ins and outs ofring-cleaving dioxygenases. Crit. Rev. Biochem. Mol. Biol. 41, 241–267

7. Olivera, E. R., Miñambres, B., García, B., Muñiz, C., Moreno, M. A., Fer-rández, A., Díaz, E., García, J. L., and Luengo, J. M. (1998) Molecularcharacterization of the phenylacetic acid catabolic pathway in Pseudomo-nas putida U. The phenylacetyl-CoA catabolon. Proc. Natl. Acad. Sci.U.S.A. 95, 6419–6424

8. Zaar, A., Eisenreich,W., Bacher, A., and Fuchs, G. (2001) A novel pathwayof aerobic benzoate catabolism in the bacteria Azoarcus evansii and Ba-cillus stearothermophilus. J. Biol. Chem. 276, 24997–25004

9. Teufel, R., Mascaraque, V., Ismail, W., Voss, M., Perera, J., Eisenreich,W.,Haehnel, W., and Fuchs, G. (2010) Bacterial phenylalanine and phenylac-etate catabolic pathway revealed. Proc. Natl. Acad. Sci. U.S.A. 107,14390–14395

10. Gibson, J., and SHarwood, C. (2002)Metabolic diversity in aromatic com-pound utilization by anaerobic microbes. Annu. Rev. Microbiol. 56,345–369

11. Harwood, C. S., Burchhardt, G., Herrmann, H., and Fuchs, G. (1999)Anaerobic metabolism of aromatic compounds via the benzoyl-CoApathway. FEMS Microbiol. Rev. 22, 439–458

12. Harwood, C. S., and Parales, R. E. (1996) The �-ketoadipate pathway andthe biology of self-identity. Annu. Rev. Microbiol. 50, 553–590

13. Mohamed, M. E., Zaar, A., Ebenau-Jehle, C., and Fuchs, G. (2001) Rein-vestigation of a new type of aerobic benzoate metabolism in the proteo-bacterium Azoarcus evansii. J. Bacteriol. 183, 1899–1908

14. Gescher, J., Zaar, A., Mohamed, M., Schägger, H., and Fuchs, G. (2002)Genes coding for a new pathway of aerobic benzoate metabolism in Azo-arcus evansii. J. Bacteriol. 184, 6301–6315

15. Zaar, A., Gescher, J., Eisenreich,W., Bacher, A., and Fuchs, G. (2004) Newenzymes involved in aerobic benzoate metabolism in Azoarcus evansii.Mol. Microbiol. 54, 223–238

16. Gescher, J., Ismail, W., Olgeschläger, E., Eisenreich, W., Wörth, J., andFuchs, G. (2006) Aerobic benzoyl-coenzyme A (CoA) catabolic pathwayinAzoarcus evansii. Conversion of ring cleavage product by 3,4-dehydroa-dipyl-CoA semialdehyde dehydrogenase. J. Bacteriol. 188, 2919–2927

17. Bains, J., and Boulanger, M. J. (2007) Biochemical and structural charac-terization of the paralogous benzoate CoA ligases from Burkholderia xe-novorans LB400. Defining the entry point into the novel benzoate oxida-tion (box) pathway. J. Mol. Biol. 373, 965–977

18. Bains, J., and Boulanger, M. J. (2008) Structural and biochemical charac-terization of a novel aldehyde dehydrogenase encoded by the benzoateoxidation pathway in Burkholderia xenovorans LB400. J. Mol. Biol. 379,597–608

19. Bains, J., Leon, R., and Boulanger, M. J. (2009) Structural and biophysicalcharacterization of BoxC from Burkholderia xenovorans LB400. A novelring-cleaving enzyme in the crotonase superfamily. J. Biol. Chem. 284,16377–16385

20. Rather, L. J., Knapp, B., Haehnel, W., and Fuchs, G. (2010) CoenzymeA-dependent aerobic metabolism of benzoate via epoxide formation.J. Biol. Chem. 285, 20615–20624

21. Rather, L. J., Weinert, T., Demmer, U., Bill, E., Ismail, W., Fuchs, G., andErmler, U. (2011) Structure and mechanism of the diiron benzoyl-coen-zyme A epoxidase BoxB. J. Biol. Chem. 286, 29241–29248



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from


http://www.jbc.org/

22. Schühle, K., Gescher, J., Feil, U., Paul, M., Jahn, M., Schägger, H., andFuchs, G. (2003) Benzoate-coenzyme A ligase from Thauera aromatica.An enzyme acting in anaerobic and aerobic pathways. J. Bacteriol. 185,4920–4929

23. Denef, V. J., Patrauchan, M. A., Florizone, C., Park, J., Tsoi, T. V., Verstra-ete, W., Tiedje, J. M., and Eltis, L. D. (2005) Growth substrate- and phase-specific expression of biphenyl, benzoate, and C1� metabolic pathways inBurkholderia xenovorans LB400. J. Bacteriol. 187, 7996–8005

24. Denef, V. J., Klappenbach, J. A., Patrauchan, M. A., Florizone, C., Ro-drigues, J. L., Tsoi, T. V., Verstraete,W., Eltis, L. D., andTiedje, J.M. (2006)Genetic and genomic insights into the role of benzoate-catabolic pathwayredundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol.72, 585–595

25. Rabus, R., Kube, M., Heider, J., Beck, A., Heitmann, K., Widdel, F., andReinhardt, R. (2005) The genome sequence of an anaerobic aromatic-degrading denitrifying bacterium, strain EbN1. Arch. Microbiol. 183,27–36

26. López Barragán, M. J., Carmona, M., Zamarro, M. T., Thiele, B., Boll, M.,Fuchs, G., García, J. L., andDíaz, E. (2004) The bzd gene cluster, coding foranaerobic benzoate catabolism, in Azoarcus sp. strain CIB. J. Bacteriol.186, 5762–5774

27. Barragán, M. J., Blázquez, B., Zamarro, M. T., Mancheño, J. M., García,J. L., Díaz, E., and Carmona, M. (2005) BzdR, a repressor that controls theanaerobic catabolism of benzoate inAzoarcus sp. CIB, is the first memberof a new subfamily of transcriptional regulators. J. Biol. Chem. 280,10683–10694

28. Durante-Rodríguez, G., Zamarro, M. T., García, J. L., Díaz, E., and Car-mona,M. (2006) Oxygen-dependent regulation of the central pathway forthe anaerobic catabolism of aromatic compounds in Azoarcus sp. strainCIB. J. Bacteriol. 188, 2343–2354

29. Herrero,M., de Lorenzo, V., andTimmis, K.N. (1990)Transposon vectorscontaining non-antibiotic resistance selection markers for cloning andstable chromosomal insertion of foreign genes in Gram-negative bacteria.J. Bacteriol. 172, 6557–6567

30. Casadaban, M. J. (1976) Transposition and fusion of the lac genes to se-lected promoters in Escherichia coli using bacteriophage � and �. J. Mol.Biol. 104, 541–555

31. Miller, V. L., andMekalanos, J. J. (1988) A novel suicide vector and its usein construction of insertion mutations: osmoregulation of outer mem-brane proteins and virulence determinants in Vibrio cholerae requirestoxR. J. Bacteriol. 170, 2575–2583

32. de Lorenzo, V., and Timmis, K. N. (1994) Analysis and construction ofstable phenotypes inGram-negative bacteria withTn5- andTn10-derivedminitransposons.Methods Enzymol. 235, 386–405

33. Schäfer, A., Tauch, A., Jäger,W., Kalinowski, J., Thierbach, G., and Pühler,A. (1994) Small mobilizable multipurpose cloning vectors derived fromthe Escherichia coli plasmids pK18 and pK19. Selection of defined dele-tions in the chromosome of Corynebacterium glutamicum. Gene 145,69–73

34. Ferrández, A., Miñambres, B., García, B., Olivera, E. R., Luengo, J. M.,García, J. L., and Díaz, E. (1998) Catabolism of phenylacetic acid in Esch-erichia coli. Characterization of a new aerobic hybrid pathway. J. Biol.Chem. 273, 25974–25986

35. Kaniga, K., Delor, I., and Cornelis, G. R. (1991) A wide-host-range suicidevector for improving reverse genetics in Gram-negative bacteria. Inacti-vation of the blaA gene of Yersinia enterocolitica. Gene 109, 137–141

36. Fernández, S., de Lorenzo, V., and Pérez-Martín, J. (1995) Activation ofthe transcriptional regulator XylR of Pseudomonas putida by release ofrepression between functional domains.Mol. Microbiol. 16, 205–213

37. Sambrook, J., and Rusell, D. W. (2001) Molecular cloning: A LaboratoryManual, 3rd Ed., Cold Spring Harbor laboratory, Cold Spring Harbor, NY

38. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Har-bor Laboratory, Cold Spring Harbor, NY

39. Laemmli, U. K. (1970) Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227, 680–685

40. Puigbò, P., Bravo I. G., and Garcia-Vallvé S. (2008) E-CAI. A novel serverto estimate an expected value of Codon Adaptation Index (eCAI). BMCBioinformatics 9, 65

41. Altschul, S. F., Gish,W.,Miller,W.,Myers, E.W., and Lipman, D. J. (1990)Basic local alignment search tool. J. Mol. Biol. 215, 403–410

42. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) ClustalW. Im-proving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties, and weightmatrix choice. Nucleic Acids Res. 22, 4673–4680

43. Kimura, M. (1980) A simple method for estimating evolutionary rates ofbase substitutions through comparative studies of nucleotide sequences. J.Mol. Evol. 16, 111–120

44. Saitou, N., and Nei, M. (1987) The neighbor-joining method. A newmethod for reconstructing phylogenetic trees.Mol. Biol. Evol. 4, 406–425

45. Felsenstein, J. (1993) PHYLIP (Phylogenetic Inference Package) Version3.5.1. Department of Genetics, University of Washington, Seattle, WA

46. Cole, C., Barber, J. D., and Barton, G. J. (2008) The Jpred 3 secondarystructure prediction server. Nucleic Acids Res. 36,W197–W201

47. Bradford, M. M. (1976) A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle of protein-dyebinding. Anal. Biochem. 72, 248–254

48. Maxam, A. M., and Gilbert, W. (1980) Sequencing end-labeled DNAwithbase-specific chemical cleavages.Methods Enzymol. 65, 499–560

49. Krause, A., Ramakumar, A., Bartels, D., Battistoni, F., Bekel, T., Boch, J.,Böhm, M., Friedrich, F., Hurek, T., Krause, L., Linke, B., McHardy, A. C.,Sarkar, A., Schneiker, S., Syed, A. A., Thauer, R., Vorhölter, F. J., Weidner,S., Pühler, A., Reinhold-Hurek, B., Kaiser, O., and Goesmann, A. (2006)Complete genome of themutualistic, N2-fixing grass endophyteAzoarcussp. strain BH72. Nat. Biotechnol. 24, 1385–1391

50. Durante-Rodríguez, G., Valderrama J. A., Mancheño J. M., Rivas, G., Al-fonso, C., Arias-Palomo, E., Llorca, O., García, J. L., Díaz, E., andCarmona,M. (2010) Biochemical characterization of the transcriptional regulatorBzdR from Azoarcus sp. CIB. J. Biol. Chem. 285, 35694–35705

51. Dombroski, A. J. (1997)) Recognition of the �10 promoter sequence by apartial polypeptide of �70 in vitro. J. Biol. Chem. 272, 3487–3494

52. Cervin, M. A., Lewis, R. J., Brannigan, J. A., and Spiegelman, G. B. (1998)The Bacillus subtilis regulator SinR inhibits spoIIG promoter transcrip-tion in vitro without displacing RNA polymerase. Nucleic Acids Res. 26,3806–3812

53. Shingler, V. (2003) Integrated regulation in response to aromatic com-pounds. From signal-sensing to attractive behavior. Environ. Microbiol. 5,1226–1241

54. Cases, I., and de Lorenzo, V. (2005) Promoters in the environment. Tran-scriptional regulation in its natural context. Nat. Rev. Microbiol. 3,105–118

55. Carmona, M., Prieto, M. A., Galán, B., García, J. L., and Díaz, E. (2008) inMicrobial Biodegradation: Genomics and Molecular Biology (Díaz, E., ed)pp. 97–143, Caister Academic Press, Norfolk, UK

56. Rojo, F. (2010) Carbon catabolite repression in Pseudomonas. Optimizingmetabolic versatility and interactionswith the environment. FEMSMicro-biol. Rev. 34, 658–684

57. Durante-Rodríguez, G., Zamarro, M. T., García, J. L., Díaz, E., and Car-mona, M. (2008) New insights into the BzdR-mediated transcriptionalregulation of the anaerobic catabolism of benzoate in Azoarcus sp. CIB.Microbiology 154, 306–316

58. Cowles, C. E., Nichols, N. N., and Harwood, C. S. (2000) BenR, a XylShomologue, regulates three different pathways of aromatic acid degrada-tion in Pseudomonas putida. J. Bacteriol. 182, 6339–6346

59. Brzostowicz, P. C., Reams, A. B., Clark, T. J., and Neidle, E. L. (2003))Transcriptional cross-regulation of the catechol and protocatechuatebranches of the �-ketoadipate pathway contributes to carbon source-de-pendent expression of theAcinetobacter sp. strainADP1 pobA gene.Appl.Environ. Microbiol. 69, 1598–1606

60. Ezezika, O. C., Collier-Hyams, L. S., Dale, H. A., Burk, A. C., and Neidle,E. L. (2006) CatM regulation of the benABCDE operon. Functional diver-gence of two LysR-type paralogs in Acinetobacter baylyi ADP1. Appl. En-viron. Microbiol. 72, 1749–1758

61. Bleichrodt, F. S., Fischer R., andGerischer, U. C. (2010) The�-ketoadipatepathway of Acinetobacter baylyi undergoes carbon catabolite repression,cross-regulation, and vertical regulation and is affected by Crc. Microbi-ology 156, 1313–1322



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

62. Takeda, H., Shimodaira, J., Yukawa, K., Hara, N., Kasai, D., Miyauchi, K.,Masai, E., and Fukuda,M. (2010)Dual two-component regulatory systemsare involved in aromatic compound degradation in a polychlorinated-biphenyl degrader, Rhodococcus jostii RHA1. J. Bacteriol. 192, 4741–4751

63. Teichmann, S. A., and Babu, M. M. (2004) Gene regulatory networkgrowth by duplication. Nat. Genet. 36, 492–496

64. Silva-Rocha, R., and de Lorenzo, V. (2010) Noise and robustness in pro-karyotic regulatory networks. Annu. Rev. Microbiol. 64, 257–275

65. Larimer, F. W., Chain, P., Hauser, L., Lamerdin, J., Malfatti, S., Do, L.,

Land, M. L., Pelletier, D. A., Beatty, J. T., Lang, A. S., Tabita, F. R., Gibson,J. L., Hanson, T. E., Bobst, C., Torres, J. L., Peres, C., Harrison, F. H.,Gibson, J., and Harwood, C. S. (2004) Complete genome sequence of themetabolically versatile photosynthetic bacterium Rhodopseudomonaspalustris. Nat. Biotechnol. 22, 55–61

66. Kawaguchi, K., Shinoda, Y., Yurimoto, H., Sakai, Y., and Kato, N. (2006)Purification and characterization of benzoate-CoA ligase fromMagneto-spirillum sp. strain TS-6 capable of aerobic and anaerobic degradation ofaromatic compounds. FEMS Microbiol. Lett. 257, 208–213



at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Supplemental Data

FIGURE S1. Overproduction of His6-BoxR and His6-BzdR proteins. 12% SDS-

PAGE of E. coli M15 (pREP4, pQE32-His6BoxR) (A) or E. coli M15 (pREP4, pQE32-

His6BzdR) (B) cell extracts harboring the His6-BoxR or His6BzdR proteins,

respectively. Lanes 1, molecular mass markers (in kDa). Lanes 2, 30 g and 35 g of

soluble E. coli M15 (pREP4, pQE32-His6BoxR) and E. coli M15 (pREP4, pQE32-

His6BoxR) cell extracts, respectively, obtained as indicated under “Experimental

Procedures”. The His6-BoxR and His6-BzdR proteins are shown with arrows.

FIGURE S2. The box pathway from Azoarcus sp. CIB. A, scheme of the proposed

box pathway in Azoarcus sp. CIB according to the biochemical steps characterized in

Azoarcus evansii (20, 21). The activation and the dearomatization/ring-cleavage steps

are indicated by white and stripped arrows, respectively. The lower pathway that

funnels the dehydroadipyl-CoA semialdehyde into the central metabolism is represented

by dotted arrows. The Box enzymes and pathway intermediates are indicated: BclA,

benzoate-CoA ligase; BoxA, NADPH-dependent reductase; BoxB, benzoyl-CoA 2,3-

epoxidase; BoxC, 2,3-epoxybenzoyl-CoA dihydrolase; BoxD, 3,4-dehydroadipyl-CoA

semialdehyde dehydrogenase. The lower pathway enzymes responsible for the

conversion of 3,4-dehydroadipyl-CoA into succinyl-CoA and acetyl-CoA have not been

yet biochemically characterized. B, scheme of the box cluster from Azoarcus sp. CIB

(Acc. No. HE589495). The genes encoding the catabolic enzymes are represented by

arrows with the same colour code as in panel A. The genes encoding a putative

thioesterase, lactonase, thiolase and two proteins of unknown function (Orf1 and Orf2)

are likely involved in the lower box pathway. The putative boxR regulatory gene is

shown in black. The genes encoding a potential ABC transporter are shown by grey

arrows. The PD and PX promoters are shown by white and black bend-arrows,

respectively.

FIGURE S3. Phylogenetic tree of members of the BzdR subfamily of

transcriptional regulators from different Proteobacteria. The bar represents one

inferred amino acid substitution per ten amino acids. Phylogenetic analyses were carried

1

2

out as indicated under “Experimental Procedures”. BoxR and BzdR (shadowed) indicate

the regulatory proteins encoded in the aerobic (box) and anaerobic (bzd) benzoate-

degradation clusters, respectively. , and represent the , and subgroups of

proteobacteria, respectively. The proteins are indicated by their corresponding genome

identification number or by their accession number (in brackets). Abbreviations of the

bacterial strains are: A.evansii; Azoarcus evansii; amb, Magnetospirillum magneticum

AMB-1; AXYL, Achromobacter xylosoxidans; Azo, Azoarcus sp. BH72; AzoCIB,

Azoarcus sp. CIB; BBta; Bradyrhizobium sp. BTAi1; BC1002, Burkholderia sp

CGE1002; Bll, Bradyrhizobium japonicum USDA; Bpet, Bordetella petrii; Bphy,

Burkholderia phymatum; Bphyt, Burkholderia phytofirmans; Bpro, Polaromonas sp.

JS666; BRADO, Bradyrhizobium sp. ORS278; Bxe; Burkholderia xenovorans;

CtCNB1, Comamonas testosteroni; Daci, Delftia acidovorans; EbA, Aromatoleum

aromaticum EbN1; H16, Ralstonia eutropha sp. H16; Jann, Jannaschia_sp. CCS1;

Lcho, Leptothrix cholodnii; Mchl, Methylobacterium chloromethanicum; Mex,

Methylobacterium extorquens AM1; Mnod, Methylobacterium nodulans; Mrad,

Methylobacterium radiotolerans; M446, Methylobacterium_sp. 4-46; Pnap,

Polaromonas naphthalenivorans; RALTA, Cupriavidus taiwanensis; RBRH,

Burkholderia rhizoxinica; Reut, Cupriavidus necator JMP134; Rfer, Rhodoferax

ferrireducens; Rmet, Ralstonia metallidurans; RPA, Rhodopseudomonas palustris

CGA009; Rpal, Rhodopseudomonas palustris TIE-1; RPB, Rhodopseudomonas

palustris HaA2; RPC, Rhodopseudomonas palustris BisB18; RPD, Rhodopseudomonas

palustris BisB5; RPE, Rhodopseudomonas palustris BisA53; sce, Sorangium

cellulosum; SPO, Silicibacter pomeroyi, T. aromatica, Thauera aromatica; Tmz1t,

Thauera sp. MZ1T; Vapar, Variovorax paradoxus; Veis, Verminephrobacter eiseniae.

FIGURE S4. The PD and PX promoters and the BoxR regulator are also active

under anaerobic conditions. E. coli CC118 cells harboring plasmid pSJ3PD (PD::lacZ)

or pSJ3PX (PX::lacZ), and the plasmid pCK01BoxR (BoxR) or the control plasmid

pCK01 (-) were grown anaerobically in glycerol-containing minimal medium until they

reached the mid-exponential phase. Values for -galactosidase activity (in Miller units)

were determined as indicated under “Experimental Procedures”. Results of one

experiment are shown, and values were reproducible in three separate experiments with

standard deviations values of <10%.

http://www.genome.jp/dbget-bin/www_bget?gn:T01341








A B

200

11697.4

45

31

21.5

14.5

His6 -BoxR

1 2

20011697.4

45

31

21.5

14.5

His6 -BzdR

1 2

Fig. S1

thio

este

rase

lact

onas

e

ABC

-tran

spor

ter

bclA

orf1

boxD

boxR

boxC

boxB

boxA

thio

lase

orf2

A

B

Acetyl-CoASuccinyl-CoA

COO- COSCoA COSCoA

CHOBclA

NADP+

BoxA/BoxB

NADPHO2

CoA+ ATP

AMP+ PPi COSCoA

OBox C

2H2 O HCOO-

Box D

NADPH+ H+

NADP+

+ H2 OCOSCoA

COO-

CoA+ H2 O 2[H]

Benzoate Benzoyl-CoA 2,3-epoxy-benzoyl-CoA3,4-dehydroadipyl-CoA semialdehyde

3,4-dehydroadipyl-CoA

PXPD

Fig. S2

Fig. S3

0.1

ebA2762

A.evansii(AAN39374)azo3055T.aromatica (AAN32624)

AzoCIB (CCD33120 )

Tmz1t_3137AzoCIB(AAQ08805)ebA5278

BBta_0746BRADO6792 bll1076 RPA4787Rpal_5273RPB_4657RPD_0877RPC_0098RPE_0475Mex_1p2101Mchl_2388Mrad2831_3773 M446_2399 Mnod_2812 Bbta_6641Bbta_6642SPO3704Jann_0675

H16_A1411

Rmet_1223 RALTA_A1324

Reut_A1326Bphyt_2697Bxe_A1421BC1002_1978 Bxe_C0893Bphy_1541RBRH_00496AXYL_05033Bpet3571Daci_0075CtCNB1_0099Veis_0731Vapar_0092H16_B1915RALTA_B1614Lcho_3658 Bpro_1627 Rfer_0219 Pnap_2945amb0168sce1062

Fig. S4

0

2000

4000

6000

8000

10000

12000

BoxR

-G

alac

tosi

das

eac

tivi

ty(M

ille

ru

nit

s)

0

500

1000

1500

2000

3000

3500

-ga

lact

osid

ase

acti

vity

(Mil

ler

un

its)

BoxR

2500

PD lacZPX lacZ

Manuel Carmona and Eduardo DíazJ. Andrés Valderrama, Gonzalo Durante-Rodríguez, Blas Blázquez, José Luis García,

AEROBIC AND ANAEROBIC PATHWAYSBacterial Degradation of Benzoate: CROSS-REGULATION BETWEEN

doi: 10.1074/jbc.M111.309005 originally published online February 2, 20122012, 287:10494-10508.J. Biol. Chem.

10.1074/jbc.M111.309005Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2012/02/02/M111.309005.DC1

http://www.jbc.org/content/287/13/10494.full.html#ref-list-1

This article cites 62 references, 25 of which can be accessed free at

at CSIC



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M111.309005

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;287/13/10494&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/287/13/10494

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=287/13/10494&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/287/13/10494

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2012/02/02/M111.309005.DC1

http://www.jbc.org/content/287/13/10494.full.html#ref-list-1

http://www.jbc.org/

bacterialdegradationofbenzoate - digital csicdigital.csic.es/bitstream/10261/49890/3/j. biol....

Documents