AMPLIFIED FRAGMENT LENGTH POLYMORPHISM OF PROBIOTIC

BACILLUS SUBTILIS SP

PROJECT REPORT submitted in partial fulfillment of the requirements

for the award of the degree of BACHELOR OF TECHNOLOGY

in BIOTECHNOLOGY

by

NISHA .R 10904176

under the guidance of Mrs.T.ANJU, M.Sc., M.Phil.,

(Lecturer, Department of Biotechnology)

DEPARTMENT OF BIOTECHNOLOGY SCHOOL OF BIOENGINEERING

FACULTY OF ENGINEERING AND TECHNOLOGY SRM UNIVERSITY

KATTANKULATHUR 603 203

April 2008

CERTIFICATE

Certified that the project report entitled AMPLIFIED FRAGMENT

LENGTH POLYMORPHISM OF PROBIOTIC BACILLUS SUBTILIS

SP submitted by NISHA .R (10904176) is a record of project work done by

her under my supervision. This project has not formed the basis for the award

of any degree, diploma, associate ship or fellowship.

INTERNAL GUIDE HEAD OF THE DEPARTMENT (Mrs.T.ANJU) (Dr. KANTHA. D.ARUNACHALAM) For the purpose of viva voce 1. 2.

DECLARATION

I do hereby declare that the project report entitled AMPLIFIED

FRAGMENT LENGTH POLYMORPHISM OF PROBIOTIC BACILLUS

SUBTILIS SP is a record of original work carried out by me under the

supervision of Mrs. T. Anju, Lecturer, Department of Biotechnology, SRM

University, Kattankulathur. This project has not been submitted earlier in part

or full for the award of any degree, diploma, associateship or fellowship.

Kattankulathur (NISHA .R)

Date:

ACKNOWLEDGEMENT

I gratefully thank SRM University which enabled me to educate by the

most experienced professionals in teaching and leading upto the cutting

edge technology in fast growing world.

I express my whole hearted gratitude to Prof. R.Venkataramani,

Principal, SRM engineering college

Immense pleasure in thanking Dr.K.Ramasamy, Dean, and Mrs.Kantha D

Arunachalam, HOD, Department of Biotechnology.

I wish to convey my heartful thanks and gratitude to my institutional

guide Mrs.Anju .T, Lecturer, Department of Biotechnology, SRM

University for her valuable guidance and constant encouragement. .

I also thank Mr. and Mrs. Saravanan, BMERF, Salem for giving me

permission to carry out the project in BMERF Salem.

I convey my special thanks to my friend Mr. S. Mohamed Haneef, who

helped me with the project work.

Finally, I am indebted to my Parents and sister for their love, affection

and strong support in shaping my educational carrier and guiding me in

every possible way.

Above all, I thank the Almighty for his continued blessings.

LIST OF CONTENTS

CHAPTER NO. TITLE PAGE NO.

1 Introduction 1

2 Review of Literature 7

3 Materials and Methods 22

4 Results and Discussions 31

5 Summary 36

6 Conclusion 37

Appendix 38

References i - iv

LIST OF FIGURES

FIGURE NO. TITLE

1 Shrimp Culture

2 Bacillus subtilis

3 Sample Collection

4 AFLP Procedure

5 Isolation of Bacillus subtilis on nutrient agar

6 Genomic DNA Isolation

7 AFLP of Bacillus subtilis strains

ABSTRACT

Amplified Fragment Length Polymorphism (AFLP) is a promising

molecular tool in identifying the best industrial microbiological bacterial strains.

Large scale production of the best Bacillus strains would be of a great benefit for

aquaculture industry. The Bacillus imparts a great impetus in solving many of the

industry problems. Industrial application of the bacterial is regarded as probiotics.

It is not only controlling diseases in these ponds but also partially digests the feed

for easy digestion and assimilation of aquatic animals. Probiotic usage in de-

sulphurizing the ponds is a novel concept. Not all the strains have the capability to

do the latter activity. Therefore an efficient tool for identifying the best strains is

essential. AFLP which is a molecular method could be the best tool. A study was

aimed to utilize the technique for identifying the best probiotic Bacillus strains. As

the outcome of this research study the strain BSI which was reported to be the best

strain by the field study was identified to be having a unique pattern of DNA

bands in the AFLP gel.

CHAPTER 1

INTRODUCTION

Water pollution is one of the burning problems faced by todays world. Water

pollution occurs when a body of water is adversely affected due to the addition of large

amounts of materials to the water. Organic pollution occurs when an excess of organic

matter, such as manure or sewage, enters the water. When organic matter increases in a

pond, the number of decomposers will increase. These decomposers grow rapidly and use

a great deal of oxygen during their growth. This leads to a depletion of oxygen as the

decomposition process occurs.

A type of organic pollution can occur when inorganic pollutants such as nitrogen

and phosphates accumulate in aquatic ecosystems. High levels of these nutrients cause an

overgrowth of plants and algae. As the plants and algae die, they become organic material

in the water. The enormous decay of this plant matter, in turn, lowers the oxygen level.

The process of rapid plant growth followed by increased activity by decomposers and a

depletion of the oxygen level is called eutrophication.

Farms often use large amounts of herbicides and pesticides, both of which are

toxic pollutants. These substances are particularly dangerous to life in rivers, streams and

lakes, where toxic substances can build up over a period of time. Farms also frequently

use large amounts of chemical fertilizers that are washed into the waterways and damage

the water supply and the life within it. Fertilizers can increase the amounts of nitrates and

phosphates in the water, which can lead to the process of eutrophication.

Aquaculture is the worlds fastest growing food production sector, with cultured

shrimp and prawn growing at an annual rate of 168% between 1984 and 1995

(Subasinghe et al., 1998). However, disease outbreaks have caused serious economic

losses in several countries.

During the past 20 years aquaculture industry has been growing tremendously

especially of marine fish and shrimps and bivalves. But as the other industries, this rapid

growth has bought with it the problem of environment pollution contamination of coastal

waters due to aqua culture is posing serious problems among law markers as wells as

scientists. Aquaculture pollution is a major concern among the entrepreneurs, farmers

and researchers.

Excess discharge of phosphorus and nitrogen into the water bodies is the principal

pollutant responsible for this. Plant-based feed ingredients due to its high phytic acid

content enhances both nitrogen and phosphorus discharge thereby increasing the

pollution level. The coastal environment has been seriously damaged often resulting

disease outbreaks. Recently shrimp culture (Fig.1.1) all over the world has been

frequently affected by viral and bacterial diseases inflicting huge loss. This is where

probiotics came into the play.

Feeding and new practices in farming usually play an important role in

aquaculture, and the addition of various additives to a balanced feed formula to achieve

better growth is a common practice of many fish and shrimp feed manufacturers and

farmers. Probiotics, as biofriendly agents such as lactic acid bacteria and Bacillus spp.,

can be introduced into the culture environment to control and compete with pathogenic

bacteria as well as to promote the growth of the cultured organisms. In addition,

probiotics are nonpathogenic and nontoxic microorganisms without undesirable side-

effects when administered to aquatic organisms.

Bacillus subtilis (Fig.1.2) is currently being used for aquaculture, terrestrial

livestock and in human consumption as an oral bacteriotherapy and bacterioprophylaxis

of gastrointestinal disorders. Bacillus species are saprophytic Gram-positive,

nonpathogenic, spore-forming organisms normally found in air, water, dust, soil and

sediments (Gatesoupe, 1999; Green et al., 1999; Moriarty, 1999). Bacillus subtilis was

found to be the most effective probiotic used for special purposes. Starch forms the major

constituent of the aquafeed. Bacillus subtilis secrets the amylase enzyme which can

hydrolyzed the starch content.

Fig. 1.1 Shrimp Culture

Fig. 1.2 .Bacillus subtilis

BIO CHEMICAL TEST FOR BACILLUS SUBTILIS

INDOLE TEST : Negative

CATALASE TEST : Positive

GLUCOSE FERMENTATION : Negative

LACTOSE FERMENTATION : Negative

STARCH HYDROLYSIS : Positive

NITRATE BROTH TEST : Positive (Nitrate to Nitrite)

MOTILITY : Positive

Kennedy et al., (1998) used probiotic bacteria in the culture of marine fish larvae.

They identified and used probionts for the culture of common snook, red drum, spotted

sea trout and striped mullet. They then observed that the application of probiotic bacteria

to larval fish tanks (from egg through transformation) increased survival, size uniformity,

and growth rate. In addition, they noticed that the fish eggs incubated with probiotic

bacteria were less likely to develop bacterial overgrowth and die than those incubated

without probiotic bacteria.

The cell wall hydrophobicity of Bacillus sp. isolated from carp (Cyprinus carpio)

ponds and its changes under different culture conditions were studied on the basis of the

amount of bacteria in a hydrocarbon/water two-phase system. The effect of cell wall

hydrophobicity on the role of these bacteria as probiotics in bioremediation based on

shrimp feed was investigated. (Yan-Bo Wang et al., 2007). The mean bioremediation

capability of treatment with probiotics Bacillus sp. was significantly higher and increased

the rate of survival of the aquaculture.

The experiment conducted with Bacillus subtilis by the Department of

Bacteriology, Oklahoma Agricultural and Mechanical College, (Robert et al., 1954)

verified that Bacillus subtilis species has a direct role in reducing the ammonia and nitrate

content in aqua farms. In vigorously aerated cultures of Bacillus subtilis, which had been

adapted to nitrate nutrition by long serial subculture, extremely rapid disappearance of

Nitrate occurred even when Ammonia was present.

Cell-free extracts of Bacillus subtilis showed greater inhibitory effects against the

growth of Vibrio harveyi isolated by agar antagonism assay from Penaeus monodon with

black gill disease. The probiotic effect of Bacillus was tested by exposing shrimp to

Bacillus subtilis at a density of 106-108 cfu ml for 1 h infection. The combined results of

long- and short-term probiotic treatment of Bacillus subtilis showed a 90% reduction in

accumulated mortality. This study reports that pathogenic vibrios were controlled by

Bacillus under in vitro and in vivo conditions. Results indicated that probiotic treatment

offers a promising alternative to the use of antibiotics in shrimp aquaculture. (B.

Vaseeharan et al., 2003).

The project was designed and executed to solve the problems caused in

aquaculture by pathogenic vibrio culture and also the accumulation of ammonia and

starch in the aqua ponds using bacillus subtilis.

CHAPTER 2

REVIEW OF LITERATURE

Dipesh Debnath et al., (2005) Aquaculture pollution is a major concern among the

entrepreneurs, farmers and researchers. Excess discharge of phosphorus and nitrogen into

the water bodies is the principal pollutant responsible for this. Plant-based feed

ingredients due to its high phytic acid content enhances both nitrogen and phosphorus

discharge thereby increasing the pollution level. Dietary phytase treatment is probably the

best answer to address this problem. This review explains the nature and properties of

phytate, its interactions with other nutrients and the application of phytase in aquafeed to

reduce the pollution. This review also covers the different biotechnological aspects for

lowering the phytic acid level in the common aquafeed ingredients, as an alternate

approach to controlling the pollution level. Some of future research needs have also been

highlighted to attract the attention of more researchers to this area.

Claude E. Boyd et al., (1999) The most common substances used in pond

aquaculture are fertilizers and liming materials. Fertilizers are highly soluble and release

nutrients that can cause eutrophication of natural waters. Fertilizers are also corrosive and

some are highly explosive, so proper handling is necessary to prevent accidents. Some

liming materials are caustic and can be hazardous to workers if proper precautions are not

exercised. Liming materials do not cause environmental problems, and liming and

inorganic fertilizer compounds do not present food safety concerns. An array of other

substances is used less frequently in aquaculture including: oxidants, disinfectants,

osmoregulators, algicides, coagulants, herbicides, and probiotics.

These compounds or biological products quickly degrade or precipitate. They are

not bioaccumulative and do not cause environmental perturbations in natural waters

receiving pond effluents. Accidental spills of some substances could cause environmental

damage. Most substances used in pond aquaculture to improve soil or water quality

present little or no risk to food safety. The use of human wastes in aquaculture or the

contamination of aquaculture systems with agricultural or industrial pollution could result

in product contamination and food safety concerns. Some substances pose safety risks to

workers, explosion or fire hazards, or cause mild pollution.

Arnold L. Demain et al., (1967) Although adenine-requiring auxotrophs of

Bacillus subtilis accumulate large quantities of inosine or hypoxanthine, or of both, they

do not accumulate inosine- 5'-monophosphate (IMP). Experiments directed at

understanding this phenomenon were conducted with an adenine less auxotroph and with

a mutant derived from it which lacked alkaline phosphohydrolase. It was found that

Bacillus subtilis contains four different phosphohydrolases. Only one is an extra cellular

enzyme; it is a 5'-nucleotide phosphohydrolase which can be inhibited by addition of

CuSO4 to the medium. Of the three cellular enzymes, only one, an acid

phosphohydrolase, cannot attack 5'-nucleotides; this enzyme is not repressed by inorganic

phosphate.

One of the two remaining surface-bound enzymes is a nonspecific alkaline

phosphohydrolase which attacks both 5'-nucleotides and p-nitrophenyl phosphate; this is

the only phosphohydrolase that is markedly repressed by inorganic phosphate. The other

surface-bound enzyme is a nonrepressible 5'-nucleotide phosphohydrolase with double

pH optima: one at neutrality and the other near pH 9.0. The experiments indicate that the

absence of IMP in the extracellular broth is due to degradation of internally accumulated

IMP to inosine by the cellular 5'-nucleotide phosphohydrolase.

Leo M. Hall et al., (1954) Despite great theoretical interest and practical

importance, the biochemical pathway of nitrate reduction remains obscure. Considerable

controversy exists, moreover, concerning the ro1e of various probable intermediates in

the reductive process. Indirect evidence that ammonia is an intermediate in the reduction

of nitrate has been presented by Burris and Wilson (1) for Azotobacter and by Marshall et

al., (2) for Pseudomonas fluorescens and Pseudomonas denitrificans.

Direct evidence that ammonia is involved in Nitrogen fixation by the anaerobe

Clostridium pasteurianum (Zelitch et al., (3)) provides additional support for viewing

ammonia as an intermediate in the assimilation of nitrate. This communication presents

direct evidence for the involvement of ammonia in the reduction of nitrate by a strain of

Bacillus subtilis.

David J. W. Moriarty et al., (1999) Shrimp aquaculture production in much of the

world is depressed by disease, particularly caused by luminous Vibrio and/or viruses.

Antibiotics, which have been used in large quantities, are in many cases ineffective, or

result in increases in virulence of pathogens and, furthermore, are cause for concern in

promoting transfer of antibiotic resistance to human pathogens. Probiotic technology

provides a solution to these problems. The microbial species composition in hatchery

tanks or large aquaculture ponds can be changed by adding selected bacterial species to

displace deleterious normal bacteria.

Virulence of luminous Vibrio species can be controlled in this manner.

Abundance of luminous Vibrio strains decreased in ponds and tanks where specially

selected, probiotic strains of Bacillus species were added. A farm on Negros, in the

Philippines, which had been devastated by luminous Vibrio disease while using heavy

doses of antibiotics in feed, achieved survival of 80-100% of shrimp in all ponds treated

with probiotics.

Vaseeharan et al., (2003) Cell-free extracts of Bacillus subtilis BT23 showed

greater inhibitory effects against the growth of Vibrio harveyi isolated by agar

antagonism assay from Penaeus monodon with black gill disease. The probiotic effect of

Bacillus was tested by exposing shrimp to Bacillus subtilis BT23 at a density of 106-108

cfu ml-1 for 6 d before a challenge with V. harveyi at 103-104 cfu ml-1 for 1 h infection.

The combined results of long and short-term probiotic treatment of B. subtilis BT23

showed a 90% reduction in accumulated mortality.

Yan-Bo Wang et al., (2007) The cell wall hydrophobicity of Bacillus sp. YB-

030518 and YB-034325 isolated from carp (Cyprinus carpio) ponds and its changes

under different culture conditions were studied on the basis of the amount of bacteria in a

hydrocarbon/water two-phase system.

We investigated the effect of cell wall hydrophobicity on the role of these bacteria

as probiotics in bioremediation based on shrimp feed. Culture conditions such as growth

phase, pH and temperature influence the hydrophobic properties of the Bacillus sp. cell

surface.

In the exponential growth phase (18 h), the hydrophobicity of both YB-030518

and YB-034325 was significantly higher (P < 0.05) than that at 96 h. The hydrophobicity

of YB-034325 was significantly higher (P < 0.05) than that of YB-030518 (5 C at pH

5.5 and pH 8.5; 20 C at pH 5.5 and pH 7.0). However, for any single probiotic, there

was no statistical difference (P > 0.05) in cell wall hydrophobicity at different pH values

(5.5, 7.0 and 8.5) or at different temperatures (5 C and 20 C). The relative growth rate

of YB-034325 with a high level of hydrophobicity was significantly higher (P < 0.05)

than that of YB-030518.

The bioremediation capability at 48 h and 96 h was significantly higher in YB-

034325 (P < 0.05) compared to YB-030518 and the Control. Moreover, the mean

bioremediation capability of treatment with probiotics Bacillus sp. YB-030518 and YB-

034325 was significantly higher (P < 0.05) than that of the Control.

Rajesh Kumar, Subhas C Mukherjee, Kurcheti Pani Prasad, Asim K Pal. et.al.,

(1998) Bacillus subtilis, a Gram-positive, aerobic, endospore-forming bacterium, was

evaluated for its probiotic potential in Indian major carp, Labeo rohita. Labeo rohita

(152 g) were fed a feed containing B. subtilis in three concentrations for 2 weeks, e.g., 0.5 (T2), 1.0 (T3) and 1.5 (T4) 107CFUg1 feed. The control group (T1) was fed feed without B. subtilis for the same period. Haematological and serum parameters were

monitored at weekly intervals.

The response variables were total erythrocyte count, total leucocyte count (TLC),

haemoglobin, total protein, albumin, globulin, albumin-globulin ratio, alkaline

phosphatase activity, alanine aminotransferase activity and aspartate aminotransferase

activity.

Fish were challenged intraperitoneally with a virulent strain of Aeromonas

hydrophila after 2 weeks of feeding to the treatment groups and positive control group,

while the negative control group was challenged with phosphate-buffered saline only.

Clinical signs and symptoms, and mortality/survival percentage were noted in each

group. The haematological and serum parameters were monitored each week and during

post challenge on the third and tenth day.

The B. subtilis treated fish showed maximum per cent survival (87.50%), weight

gain (35.5%), TLCs haemoglobin content (7.4g%), total protein (2.37gdL1) and globulin content (1.28gdL1) during the pre-challenge. Enzymes showed higher activities during post challenge (P

Angeline Seah Huay Lin, et al. (1983) Antimicrobial compounds from Bacillus

subtilis for use against animal and human pathogens. A novel strain of Bacillus subtilis

was isolated from the gastrointestinal tract of poultry and was found to produce a factor

or factors that have excellent inhibitory effects on Clostridium perfringens, Clostridium

difficile, Campylobacter jejuni, Campylobacter coli, and Streptococcus pneumoniae. The

factor(s) retain full viability and antimicrobial activity after heat treatment. The invention

provides a method of treatment of pathogenic microorganisms including C. perfringens.

Gunther J., Jimenez-Montealegre R. et al. (1978) conducted three experiments to

analyze the effect of the probiotic Bacillus subtilis on the growth of juvenile tilapia

(Oreochromis niloticus) and freshwater prawn (Macrobrachium rosenbergii). The

experiments were conducted under laboratory conditions, minimizing the indirect effects

of the probiotic on the water quality and leaving only the possible bactericidal and

digestion-support effects.

A model of stress was also designed in tilapia to compare the effect with tilapia

under normal conditions. The dose in the food was 0.1% of the probiotic (5 x 10(8)

CFU/g and 99.9 % maltrine) in the dry diet. Every 14 days the animals were weighed in

group (tilapias +/- 0.1 g, prawns +/- 0.001 g) to estimate average body weight. In the first

experiment (tilapia) the specific growth rate (SGR) and the feed conversion ratio (FCR)

were bad in relation with the factor probiotic, but the differences were not significant. In

the second experiment (tilapia) both the SGR and the FCR deteriorated with the addition

of B. subtilis to the diet; the difference was significant to 94%.

The stress factor, on the contrary, caused a notable worsening of both the growth

and the food utilization. In the experiment with prawns the addition of B. subtilis caused

a light deterioration of the growth and of the food utilization, with a statistical probability

of mistake of 10% in case of the growth. During the experiment the direct effects over

the digestive system should have prevailed, either by the contribution of macro- and

micronutrients, or by the enzymes that contribute to the digestion. The negative effect

due to the addition of the probiotic to the food was small (about 10% in both the SGR

and the FCR) being difficult to detect statistically.

The reports on the positive action of probiotics on the growth in aquatic animals

have been conducted mainly in ponds, and our information does not contradict directly a

possible positive action of B. subtilis in this type of systems. Since the effect on the

digestive system seems to be relatively small, in those environments the effect might be

compensated by other positive effects on water quality, and by bactericidal effects on

pathogenic bacteria.

Bushehr, et al. (1983) A feeding experiment was conducted to investigate the

effect of Bacillus subtilis bacterium, on larval growth and development rate of

Macrobrachium rosenbergii during February 28 to April 8, 2005 in University Putra

Malaysia hatchery. Newly hatched larvae of M. rosenbergii were reared with two dietary

treatments consisting of newly hatched Artemia salina nauplii with B. subtilis (108 cells

ml1), and newly hatched A. salina nauplii without B. subtilis carried out in triplicate in

60-L aquarium (50 L1).

After trial, the larvae that fed B. subtilis-treated Artemia naupli were found to

have higher survival and a faster rate of metamorphosis than larvae that were fed with

nontreated Artemia naupli. There were significant differences between B. subtilis-treated

Artemia naupli and nontreated Artemia diet in larval growth and development rate of

metamorphosis (P < 0.05). Larval survival after 40 days was significantly greater

(P < 0.05) in the B. subtilis-treated groups (55.3 1.02) compared with the nontreated

groups (36.2 5.02%).

Ali Farzanfar et al., (2002) Shrimp aquaculture, as well as other industries,

constantly requires new techniques in order to increase production yield. Modern

technologies and other sciences such as biotechnology and microbiology are important

tools that could lead to a higher quality and greater quantity of products. Feeding and new

practices in farming usually play an important role in aquaculture, and the addition of

various additives to a balanced feed formula to achieve better growth is a common

practice of many fish and shrimp feed manufacturers and farmers. Probiotics, as bio-

friendly agents such as lactic acid bacteria and Bacillus spp., can be introduced into the

culture environment to control and compete with pathogenic bacteria as well as to

promote the growth of the cultured organisms. In addition, probiotics are nonpathogenic

and nontoxic microorganisms without undesirable side-effects when administered to

aquatic organisms. These strains of bacteria have many other positive effects, which are

described in this article.

Jiravanichpaisal and Chuaychuwong et al., (1997) Lactobacillus sp. was used as

the probiotic bacteria in the giant tiger shrimp (P. monodon Fabricius). They designed to

investigate an effective treatment of Lactobacillus sp. against vibriosis and white spot

diseases in P. monodon. They investigated the growth of some probiotic bacteria, and

their survival in the 20 ppt sea water for at least 7 days. Inhibiting activity of two

Lactobacillus sp. against Vibrio sp., E. coli, Staphylococcus sp. and Bacillus subtilis was

determined. Direkbusarakom and Yoshimizu et al., (1997) reported Vibrio spp. which

dominate in shrimp hatchery against some fish pathogens..

Two isolates of Vibrio spp. which are the dominant composition of the flora in

shrimp hatchery, were studied for antiviral activity against infectious haematopoietic

necrosis virus (IHNV) and Oncorhynchus masou virus (OMV). Both strains of bacteria

showed the antiviral activities against IHNV and OMV by reducing the number of

plaque. Their results demonstrate the possibility of using the Vibrio flora against the

pathogenic viruses in shrimp culture.

M J Weickert and G H Chambliss et al., (2001) The amyR2 allele of the Bacillus

subtilis alpha-amylase cis-regulatory region enhances production of amylase and

transcription of amyE, the structural gene, by two- to threefold over amyR1. The amylase

gene bearing each of these alleles was cloned on plasmids of about 10 to 15 copies per

chromosome. Transcription of the cloned amylase gene by each amyR allele was

activated at the end of exponential growth and was subject to catabolite repression by

glucose.

The amount of amylase produced was roughly proportional to the copy number

of the plasmid, and cells containing the amyR2-bearing plasmid, pAR2, produced two- to

threefold more amylase than cells with the amyR1 plasmid, pAMY10. Deletion of DNA

5' to the alpha-amylase promoter, including deletion of the A + T-rich inverted repeat

found in amyR1 and amyR2, had no effect on expression or transcription of alpha-

amylase. Deletion of DNA 3' to the amyR1 promoter did not impair temporal activation

of chloramphenicol acetyltransferase in amyR1-cat-86 transcriptional fusions, but

catabolite repression was abolished. When an 8-base-pair linker was inserted in pAMY10

at the same site from which the 3' deletion was made, amylase expression doubled and

was repressed less by glucose. Both the deletion and the insertion disrupted four bases at

the 3' end of the putative amylase operator region. Site-directed mutagenesis was used to

change bases in the promoter-operator region of amyR1 to their amyR2 counterparts.

Either change alone increased amylase production twofold, but only the change at +7,

next to the linker insertion of 3' deletion site, yielded the increased amylase activity in the

presence of glucose that is characteristic of the amyR2 strain. The double mutant behaved

most like strains carrying the amyR2 allele.

H Yamazaki, and K Yamane et al., (1992) AmyR2, amyE+, and aroI+ alleles

from an alpha-amylase-hyper producing strain, Bacillus subtilis NA64, were cloned in

temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in

plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-

EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the

phage genome was also found in the 2.3-kilobase insert of pTUB4.

Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2

and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator

codon, an open reading frame was composed of a total 1,776 base pairs (592 amino

acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned

DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA.

The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110.

The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase

was slightly faster than that of the parental alpha-amylases. The NH2 termination portion

of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem.

Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extra

cellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box

(TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat

structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified.

The AT-rich inverted repeat structure seemed to correspond to the hyper

producing character. The nucleotide sequence around the region was quite different from

the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the

Escherichia coli vector systems.

M Yamasaki, G Tamura, et al. (1990) The gene coding for alpha-amylase from

Bacillus amyloliquefaciens was isolated by direct shotgun cloning using B. subtilis as a

host. The genome of B. amyloliquefaciens was partially digested with the restriction

endonuclease MboI and 2- to 5-kb fragments were isolated and joined to plasmid

pUB110. Competent B. subtilis amylase-negative cells were transformed with the hybrid

plasmids and kanamycin-resistant transformants were screened for the production of

alpha-amylase.

One of the transformants producing high amounts of alpha-amylase was

characterized further. The alpha-amylase gene was shown to be present in a 2.3-kb insert.

The alpha-amylase production of the transformed B. subtilis could be prevented by

inserting lambda DNA fragments into unique sites of EcoRI, HindIII and KpnI in the

insert. Foreign DNA inserted into a unique ClaI site failed to affect the alpha-amylase

production

The amount of alpha-amylase activity produced by this transformed B.

subtilis was about 2500-fold higher than that for the wild-type B. subtilis Marburg strain,

and about 5 times higher than the activity produced by the donor B. amyloliquefaciens

strain. Virtually all of the alpha-amylase was secreted into the culture medium. The

secreted alpha-amylase was shown to be indistinguishable from that of B.

amyloliquefaciens as based on immunological and biochemical criteria.

Nogami and Maeda et al., (1992) Bacteria strain was isolated from a crustacean

culture pond. The bacterial strain was found to improve the growth of crab (Portunus

trituberculatus) larvae and repress the growth of other pathogenic bacteria, especially

Vibrio spp., but would not kill or inhibit useful micro algae in sea water when it was

added into the culture water.

Among the bacteria population present in the culture water of the crab larvae, the

numbers of Vibrio spp. and pigment bacteria decreased or even became undetectable

when the bacteria was added into culture water. The production and survival rate of crab

larvae were greatly increased by the addition of the probiotic bacteria into the culture

water.

They also suggested that the bacterium might improve the physiological state of

the crab larvae by serving as a nutrient source during its growth. This bacterium may

have a good effect in the crab larval culture as a biocontrolling agent in the future.

Maeda and Nagami et al., (1989) Bacterial strains possessing vibrio static

activity which improved the growth of prawn and crab larvae were observed. By applying

these bacteria in aquaculture, a biological equilibrium between competing beneficial and

deleterious microorganisms was produced, and results show that the population of Vibrio

spp., which frequently causes large scale damage to the larval production, was decreased.

Survival rate of the crustacean larvae in these experiments showed much higher

than those without the addition of bacterial strains. They hope that addition of these

strains of bacteria will repress the growth of Vibrio spp., fungi and other pathogenic

microorganisms. Their data suggest that controlling the aquaculture ecosystem using

bacteria and protozoa is quite possible and if this system is adopted, it will maintain the

aquaculture environment in better condition, which will increase the production of fish

and crustaceans.

Jiravanichpaisal and Chuaychuwong et al., (1997) Lactobacillus sp. was used the

probiotic bacteria in the giant tiger shrimp (P. monodon Fabricius). They designed to

investigate an effective treatment of Lactobacillus sp. against vibriosis and white spot

diseases in P. monodon. They investigated the growth of some probiotic bacteria, and

their survival in the 20 ppt sea water for at least 7 days. Inhibiting activity of two

Lactobacillus sp. against Vibrio sp., E. coli, Staphylococcus sp. and Bacillus subtilis was

determined. Direkbusarakom and Yoshimizu et al., (1997) reported Vibrio spp. which

dominate in shrimp hatchery against some fish pathogens.

Two isolates of Vibrio spp. which are the dominant composition of the flora in

shrimp hatchery, were studied for antiviral activity against infectious haematopoietic

necrosis virus (IHNV) and Oncorhynchus masou virus (OMV). Both strains of bacteria

showed the antiviral activities against IHNV and OMV by reducing the number of

plaque. Their results demonstrate the possibility of using the Vibrio flora against the

pathogenic viruses in shrimp culture.

Maeda and Liao et al., (1992) The effect of bacterial strains obtained from soil

extracts on the growth of prawn larvae of P. monodon. was reported. Higher survival and

molt rates of prawn larvae were observed in the experiment treated with soil extract, and

the bacterial strain which promoted the growth of prawn larvae was isolated. They have

assumed that if a specific bacterium is cultured and added to the prawn ecosystem to the

level of 10 million cell/ml, other bacteria may hardly inhibit the same biotype because of

protozoan activity which shall be one of the way to biologically control the aquaculture

water biotype and ecosystem.

Maeda and Nogami et al., (1992) The utility of microbial food assemblages in

culturing a crab, Portunus trituberculatus was reported. Assemblages of microorganisms

were produced by adding several nutrients, urea, glucose and potassium phosphate, to

natural seawater with gentle aeration in which bacteria and yeast were prevailing. When

these cultured microbes were added to sea water where crab larvae of Portunus

trituberculatus were reared, bacteria numbers decreased very rapidly, followed by the

decrease in flagellated protozoa and diatoms.

Their results suggest that the crab larvae fed on these microorganisms

successively. They found some strains of bacteria promoted larval growth, although

yeasts did not support its growth. By adopting these assemblages of microorganisms a

high yield was obtained for a prawn larva P. japonicus, although the success was not

always consistent.

Douillet and Langdon et al., (1994) The use of probiotics for the culture of larvae

of the Pacific oyster was reported. They added probiotic bacteria as a food supplement to

xenic larval cultures of the oyster Crassostrea gigas which consistently enhanced growth

of larvae during different seasons of the year. Probiotic bacteria were added, at 0.1

million cells/ml, to cultures of algal-fed larvae, the proportion of larvae that are set to

produce spat, and subsequently the number of spat increased.

Manipulation of bacterial population present in bivalve larval cultures is a

potentially useful strategy for the enhancement of oyster production. They suggest that

the mechanisms of the action of probiotic bacteria are providing essential nutrients that

are not present in the algal diets or improving the oyster's digestion by supplying

digestive enzymes to the larvae or removing metabolic substances released by bivalves or

algae.

Maeda and Liao et al., (1994) Microbial processes in aquaculture environment

and their importance in increasing crustacean production was reported. They suggested

that based on the photosynthesis of micro algae mainly, it was clarified that bacteria,

protozoa and other microorganisms from microbial food assemblages use the organic

matter produced by the algae and that these assemblages play a significant role in the

aquatic food chain. The growth of the larvae and their production were markedly

promoted by the probiotic bacteria. In their paper, they also described the presence of a

bacterial clump, stained with a fluorescent dye, inside the digestive organ of the crab

Portunus trituberculatus.

Cui Jingjin et al., (1997) In China, the studies on probiotics in aquaculture were

focused on the photosynthetic bacteria. Three strains of photosynthetic bacteria were used

in prawn (P. chinensis) diet preparation and their effect. Addition of the photosynthetic

bacteria in the food or culture water was found to improve the growth of the prawn and

the quality of the water.

The application of photosynthetic bacteria in the hatchery rearing of P. chinensis.

They used a mixture of several kinds of photosynthetic bacteria (Rhodomonas sp.) as

water cleaner and auxiliary food. Their results showed that the water quality of the pond

treated with the bacteria was remarkably improved, the fouling on the shell of the larvae

was reduced, the metamorphosis time of the larvae was 1 day or even earlier, and the

production of post-larvae was more than that of the control.

Wang Xianghong et al., (1997) Recently, we have done some research work on

probiotic bacteria in shrimp aquaculture. On the basis of studies on intestinal micro flora

of wild adult shrimp P. chinensis, we have chosen some probiotic bacteria from shrimp

intestinal flora. When the two probiotic bacterial strains were added to the larval culture

water, the survival rate, the abilities of disease resistence and low salinity tolerance were

improved; average body length and weight were increased.

In addition, the probiotic bacteria, when added to the larval culture water was

found not to influence the total bacterial number and water quality of the sea water. We

also found that some probiotic bacteria can produce some digestive enzymes; these

enzymes may improve the digestion of shrimp larvae, thus enhancing the ability of stress

resistance and health of the larvae.

The mechanism of action of the probiotic bacteria has not been studied

systematically. According to some recent publications, in the aquaculture the mechanism

of action of the probiotic bacteria may have several aspects.

i) Probiotic bacteria may competitively exclude the pathogenic bacteria or

produce substances that inhibit the growth of the pathogenic bacteria.

ii) Provide essential nutrients to enhance the nutrition of the cultured animals.

iii) Provide digestive enzymes to enhance the digestion of the cultured animals. 4.

probiotic bacteria directly uptake or decompose the organic matter or toxic material in the

water improving the quality of the water.

Li Zhuojia et al., (1997) Chinese researchers have done some studies on the

probiotic bacteria to improve the shrimp culture water, and achieved remarkable results.

For example, when photosynthetic bacteria was added into the water, it could eliminate

the NH3-N, H2S and organic acids, and other harmful materials rapidly, improve the

water quality and balance the pH. The heterotrophic probiotic bacteria may have

chemical actions such as oxidation, ammoniafication, nitrification, denitrification,

sulphurication and nitrogen fixation.

When these bacteria were added into the water, they could decompose the excreta

of fish or prawns, remaining food materials, remains of the plankton and other organic

materials to CO2, nitrate and phosphate. These inorganic salts provide the nutrition for

the growth of micro algae, while the bacteria grow rapidly and become the dominant

group in the water, inhibiting the growth of the pathogenic microorganisms.

The photosynthesis of the micro algae provide dissolved oxygen for oxidation and

decomposition of the organic materials and for the respiration of the microbes and

cultured animals. This kind of cycle may improve the nutrient cycle, and it can create a

balance between bacteria and micro algae, and maintaining a good water quality

environment for the cultured animals.

CHAPTER 3

MATERIALS AND METHODS

3.1 Sample Collection Bacillus subtilis samples was collected from 3 ponds from Bheemavaram, Andhra

Pradesh (Fig. 3.1)

3.2. Isolation of Bacillus subtilis Bacillus subtilis cultures were isolated from the pond water collected from the

three ponds.

Maintenance of Bacillus Subtilis The cultures were maintained by using nutrient broth respectively.

Requirements

Conical flask Bacteriological loop Petriplates

3.3.ISOLATION OF GENOMIC DNA FROM BACILLUS SUBTILIS

Requirements

Overnight incubated cultures of Bacillus subtilis in LB broth Centrifuge tubes Eppendorff tubes Micro pipettes. Micro tips Refrigerated micro fuge Gloves

Materials Required

Solution A Solution B Solution C Phenol : Chlorofom (1:1) 70% ethanol Isopropyl alcohol

Procedure

A single bacterial colony was then transferred in to 2 ml nutrient broth medium and incubated overnight at 37 C.

1-5 ml culture was poured into an eppendorff tube and centrifuged at 5000 rpm for 10 minutes.

The supernatant was removed by aspiration, leaving the bacterial pellet as dry as possible.

Resuspended the Bacterial pellet in 100 l of ice cold solution A. The tubes were stored on ice for 30 minutes. 1 ml of freshly prepared solution II was added. The tubes were vortexed gently and stored on ice for 5 minutes. 150l of solution C was added. Equal volumes of phenol: chloroform was added to the tube. Centrifuged at 8000 rpm for 10 minutes. To the supernatant, 1ml of 70% ethanol was added. Then the tubes were centrifuged at 10000 rpm for 10 minutes at 4C in a

microfuge.

The supernatant was removed by gentle aspiration. The pellet was redissolved in 20 l of TE buffer.

The Genomic DNA was isolated using the above procedure

Fig.3.1. Pond 1

Fig.3.1. Pond 2

Fig.3.1. Pond 3

3.4 .AMPLIFIED FRAGMENT LENGTH

POLYMORPHISM

The primer sequence for the AFLP of Bacillus subtilis was found to be 5-GAA

TTC ATG ACC AGT GAT AAG CAA GGT CCC CAA GAG ACC-3 and 5-AAG

AGC TCA ATT TTT AAG ACA AAT AGA AAA GGA AGA AGA ATT-3

AFLP PROCEDURE

Step 1

DNA digestion with two different restriction enzymes

Ligation of double stranded adapters to the ends of restriction fragments optional

DNA pre amplification of ligated product directed by primers complementary to adapter

restriction sequences. DNA amplification of subsets of restriction fragments using

selective AFLP primers.

DNA digestion with two different restriction enzymes

100 250 g of DNA sample taken for digestion Alliquot DNA into 1.5ml eppendorf

Mix following reagents together in a master mix

- 20l lox AFLP Dl buffers - 20l of dd H2O - 20l ECORI enzyme and Pst I enzyme - Vortex briefly

- Mix well by pipetting up and down several times

- Place in 37C water bath for 1 hour.

Step 2

Digestion of double stranded adapters to the ends of restriction fragments

Near the end of 1 hours, 37C water bath incubation, make up the following legation,

master mix.

Ligation Receipe

T4 DNA ligase

10 x AFLP DL buffer

5 m ECORI adapters 50 m Pst I adapters 10 mm ATP

DD H2O

Alliquot 10l into each 1.5 ml eppendorf that contains digestion reactions.

- Mix well by pipetting up and down several fences

- Total volume of each tube should now be 50l - Place into 37C water bath for 3 hrs.

- Following incubation dilute digestion / legation with approximately 450l DD H2O (1:9 dilution)

- Vortex and place in - 20C proceed to next step.

Step 3

Selective DNA amplification of restriction fragment using AFLP primers and

labelling of amplified products

Aliquot 50l of AFLP reaction mix into approximately labelled 0.5l thin walled PCR rubes.

- Set up the following PCR amplification master mix.

- Addition of 20l of 10x1.5 mm MgCl2 PCR buffer 0.4l of 10 mm - 2l of 0.46 m ECORI AF labeled - 20l of 2.75 m Pst I AF primer - 0.25l UB Taq polymerase - 8.35l deionized water

Vertex briefly centrifuge and alliquot 15.0l master mix / PCR Mix well by pipetting up and down

Place in thermocycler and run

Step 1 : 94C 30 sec.

Step 2 : 65C 30 sec.

Step 3 : 56C 30 sec.

Step 4 : 72C 1 min

Step 4 72C 1 min 19 Cycles

Requirements

Adaptors Ligation buffer Digestion enzymes Water bath

Receipe for making adaptor Pst I adaptors (50m conc) 100m Pst I : 1 100m Pst I : 2 1M Tris HCl (PHH 8.0) 5M NaCl 0.5M EDTA ECORI adaptors (5m conc) 100m ECORI 1 100m ECORI 2 1M Tris HCl (PHH 8.0) 5M NaCl 0.5M EDTA diconized H2O

AFLP digestion / ligation buffer Tris base (100MM) Mg AC (100MM) K AC (500MM) DTT (50MM) pH (7.5)

Digestion Requirements ECORI Enzyme

Pst I Enzyme

10 x AFLP buffer

Deconized water

Water bath (Refer appendix for composition)

The entire procedure for AFLP is shown in (fig 3.2 )

Fig. 3.2. AFLP Procedure

CHAPTER4

RESULTS & DISCUSSIONS

Bacillus subtilis has been playing an eminent role as a probiotic for special

purposes. AFLP is used here as a tool to identify the best probiotic bacillus strain.

4.1.Isolation of Bacillus subtilis

Water samples was collected from three aquaculture ponds from Bheemavaram,

Andhra Pradesh. This water samples was used for the isolation of Bacillus subtilis.

Bacillus subtilis was isolated using nutrient agar medium. The isolated colonies are

shown in the agar plate (Fig.4.1).

4.2.Genomic DNA Isolation

Bacillus subtilis was isolated from the three water samples collected from the ponds.

After the isolation and characterization the genomic DNA was isolated from the strains.

All the B. subtilis strains including the ATCC strain 6051 were grown in Nutrient broth

and their Genomic DNA were isolated and demonstrated on Agarose Gel Electrophoresis

at approximately 4779 kbp region (Fig.4.2.).

Fig. 4.1. Isolation of Bacillus subtilis on nutrient agar

4.3.Amplified Fragment Length Polymorphism

The main aim of the project is to identify the best Bacillus strain to be used as

probiotic for special purposes. AFLP is a promising tool used in molecular biology and

genetic engineering to identify the unique banding patterns. After the genomic DNA was

isolated from the samples the AFLP was carried out.

DNA marker ranging from 564 bp to 21226 bp were received from AB gene, UK

and utilized for this study. Four strains namely B. subtilis (ATCC 6051) and 3 isolates

were subjected for this study. Two Restriction Enzymes namely Eco RI and MseI were

used along with two modulators. Totally 11 DNA bands were generated of which 9

bands were common bands sharing the regions respectively at bp regions starting from

21226 to 1032 (Fig 4.3.). Two unique bands for the strain No.1 was identified at 1368 bp

region and 983 bp region.

Fig. 4.2. Genomic DNA Isolation

Fig. 4.3. AFLP of Bacillus subtilis strains

DISCUSSIONS

The use of probiotics as farm animal feed supplements dates back to the 1970s.

They were originally incorporated into feed to increase the animals growth and improve

its health by increasing its resistance to disease. The results obtained in many countries

have indicated that some of the bacteria used in probiotics (Lactobacilli) are capable of

stimulating the immune system (Fuller, 1992). The beneficial effect of the application of

certain beneficial bacteria in human, pig, cattle and poultry nutrition has been well

documented. However, the use of such probiotics in aquaculture is a relatively new

concept. With interest in treatments with friendly bacterial candidates increasing rapidly

in aquaculture.

Kennedy et al., (1998) used probiotic bacteria in the culture of marine fish larvae.

They identified and used probionts for the culture of common snook, red drum, spotted

sea trout and striped mullet. They then observed that the application of probiotic bacteria

to larval fish tanks (from egg through transformation) increased survival, size uniformity,

and growth rate.

In another experiment that was performed by Rengpipat et al., (2003), the growth

and resistance to Vibrio in black tiger shrimp (P. monodon) fed with a Bacillus probiotic

(BS11) were studied. It was found that the growth and survival rates of shrimps fed on

the probiotic supplement were significantly greater than those of the controls.

Some strains of Gram-negative bacteria have been used as probiotics in shrimps

too. For instance, Alvandi et al., (2004) isolated Pseudomonas sp. PM11 and Vibrio

fluvialis PM17 as candidate probions from the gut of farm-reared subadult shrimp and

tested for their effect on the immunity indicators of black tiger shrimp. The results of the

study suggest that the criteria used for the selection of putative probiotic strains, such as

predominant growth on primary isolation media, ability to produce extracellular enzymes

and sideropheros, did not bring about the desired effect in vivo and improve the immune

system in shrimp.

CHAPTER 5

SUMMARY

Collection of samples

Culturing and Sub culturing of organisms

Identification of Microbes by cultural characteristics

Checking growth by spectrometer reading (540nm)

Extraction of Genomic DNA from the strain

Restriction of Genomic DNA

Amplification with PCR and performance of AFLP

Identification of the band pattern best probiotic

CHAPTER 6

CONCLUSION

Aquaculture pollution is a major concern among the entrepreneurs, farmers and

researchers. Excess discharge of phosphorus and nitrogen into the water bodies is the

principal pollutant responsible for this. Plant-based feed ingredients due to its high phytic

acid content enhances both nitrogen and phosphorus discharge thereby increasing the

pollution level. Shrimp aquaculture, as well as other industries, constantly requires new

techniques in order to increase production yield. Modern technologies and other sciences

such as biotechnology and microbiology are important tools that could lead to a higher

quality and greater quantity of products.

Feeding and new practices in farming usually play an important role in

aquaculture, and the addition of various additives to a balanced feed formula to achieve

better growth is a common practice of many fish and shrimp feed manufacturers and

farmers. Probiotics, as biofriendly agents such as lactic acid bacteria and Bacillus spp.,

can be introduced into the culture environment to control and compete with pathogenic

bacteria as well as to promote the growth of the cultured organisms. In addition,

probiotics are nonpathogenic and nontoxic microorganisms without undesirable side-

effects when administered to aquatic organisms.

APPENDIX

Table - 1. Composition of Nutrient Broth

INGREDIENTS GRAM LITRE

Peptone 5 g

Beef Extract 3 g

Yeast 2 g

Sodium Chloride 5 g

Distilled Water 1000 ml

Table 2. Composition of Nutrient Agar

INGREDIENTS GRAM LITRE

Peptone 5 g

Beef Extract 3 g

Yeast Extract 2 g

Sodium Chloride 5 g

Agar 15 g

Distilled Water 1000 ml

pH 7.4

Table 3. Composition of starch Agar Medium

INGREDIENTS GRAM / LITRE

Soluble starch 10 g

Yeast Extract 2 g

Peptone 5 g

MgSo4 0.5 g

NaCl 0.5 g

CaCl2 0.15 g

Agar 20 g

Distilled Water 1 Litre

Table - 4 Ligation Mixture

Solution A 25mM Tris Hcl 30.3 mg

Glucose 900 mg.

Lysozyme 100 mg.

Distilled Water 100 ml.

Solution B 0.2 N NaOH

SDS

Distilled Water 100 ml.

Solution C 3 M Sodium acetate 24.6 g

Distilled Water

pH 4.8

Phenol : Chlorofom (1:1) Phenol 1 g.

Chloroform 1 ml.

70% ethanol

Isopropyl alcohol

Table-5 Ligation Receipe

T4 DNA ligase 1 unit

10 x AFLP DL buffer 1.1l

5 m ECORI adapters 1.0l

50 m Pst I adapters 1.0l

10 mm ATP 1.0l

DD H2O upto 10l

Table-6 Receipe for making adaptor

Adaptors (50m conc) Pst I

100m Pst I : 1 100l

100m Pst I : 2 100l

1M Tris HCl (PHH 8.0) 2l

5M NaCl 2l

0.5M EDTA 0.4l

Adaptors (5m conc) ECORI

100m ECORI 1 10l

100m ECORI 2 10l

1M Tris HCl (PHH 8.0) 2l

5M NaCl 2l

0.5M EDTA 0.4l

Diconized H2O 175.6l

Table-6 AFLP digestion / ligation buffer

Tris base (100MM) 0.121g

Mg AC (100MM) 0.2145g

K AC (500MM) 0.4907g

DTT (50MM) 0.077g

PH (7.5)

REFERENCES

1. New, M.B. Feed and feeding of fish and shrimp. ADCP/Rep/87/26, UNDP/FAO,

Rome, 275 pp. (1987).

2. Castille, F.L. and Lawrence, A.L. (1989) The effects of deleting dietary constituents

from pelleted feed on the growth of shrimp in the presence of natural food in ponds.

J. World Aquacult. Soc. 20: 22A.

3. Fuller, R. (1989) A review: probiotics in man and animals. Journal of Applied

Bacteriology 66, 365378.

4. Tacon, A.G.J. (1990) Standard methods for the nutrition and feeding of farmed fish

and shrimp, Washington DC, Argent Laboratories Press, 454 pp.

5. Villalon, J.R. (1991) Practical manual for semi-intensive commercial production of

marine shrimp, Texas A & M Sea Grant College Program, TAMU-SG-91-501, 103

pp.

6. Veerina, S.S., Nandeesha, M.C. and Rao, K.G. (1993) Status and technology of

Indian major carp farming in Andhra Pradesh, India, Mangalore, India, Asian

Fisheries Society, Indian Branch, 52 pp.

7. Dipesh Debnath, Sahu, N. P., Pal, A. K., Kartik Baruah, Sona Yengkokpam,

Mukherjee, S. C. et al. (1994) Present scenario and future prospects of phytase in

aquafeed.

8. Mourente, G., Medina, A., Gonzalez, S. and Rodriguez, A. (1995) Variations in lipid

content and nutritional status during larval development of the marine shrimp

Penaeus kerathurus. Aquaculture, 130: 187-199.

9. W L Nicholson and G H Chambliss (1996) Isolation and characterization of a cis-

acting mutation conferring catabolite repression resistance to alpha-amylase

synthesis in Bacillus subtilis.

10. Lightner, D.V. (1996) A Handbook of Shrimp Pathology and Diagnostic Procedures

for Diseases of Cultured Penaeid Shrimp. pp. 172. Baton Rouge, LA, USA: World

Aquaculture Society.

11. Brunson, J.F., Romaire, R.P. and Reigh, R.C. (1997) Apparent digestibility of

selected ingredients in diets for white shrimp Penaeus setiferus L. Aquacult. Nutr. 3:

9-16.

12. M J Weickert and G H Chambliss (1998) Genetic analysis of the promoter region of

the Bacillus subtilis alpha-amylase gene.

13. Rengipipat, S., Phianphak, W., Piyatiratitivorakul, S. and Menasveta, P. (1998)

Effects of a probiotic bacterium on black tiger shrimp Penaeus monodon survival

and growth. Aquaculture 167, 301313.

14. Claude E. Boyd and Laurence Massaut (1999) Risks associated with the use of

chemicals in pond aquaculture, Department of Fisheries and Allied Aquacultures,

Auburn University, Auburn, AL 36849, USA.

15. Gatesoupe, F.J. (1999) The use of probiotics in aquaculture. Aquaculture 180, 147

165.

16. Hasan, M.R, R.P. Subasinghe, P. Bueno, M.J. Phillips, C. Hough, S.E. McGladdery

& J.R. Arthur (2000) Nutrition and Feeding for Sustainable Aquaculture

Development in the Third Millennium eds. Aquaculture in the Third Millennium.

Technical Proceedings of the Conference on Aquaculture in the Third Millennium,

Bangkok, Thailand, 20-25 February 2000. pp. 193-219. NACA, Bangkok and FAO,

Rome.

17. Rengipipat, S., Rukpratanporn, S., Piyatiratitivorakul, S. and Menasaveta, P. (2000)

Immunity enhancement in black tiger shrimp (Penaeus monodon) by a probiont

bacterium (Bacillus S11). Aquaculture 191, 271288.

18. H Yamazaki, K Ohmura, A Nakayama, Y Takeichi, K Otozai, M Yamasaki, G

Tamura, and K Yamane (2001) Alpha-amylase genes (amyR2 and amyE+) from an

alpha-amylase -hyperproducing Bacillus subtilis strain: molecular cloning and

nucleotide sequences.

19. B. Vaseeharan and P. Ramasamy (2002) Control of pathogenic Vibrio spp. by

Bacillus subtilis BT23, a possible probiotic treatment for black tiger shrimp Penaeus

monodon.

20. Rajesh Kumar, Subhas C Mukherjee, Kurcheti Pani Prasad, Asim K Pal (2006)

Evaluation of Bacillus subtilis as a probiotic to Indian major carp Labeo rohita

(Ham.) Aquaculture Research 37 (12), 12151221.

21. Yan-Bo Wang and Jian-Zhong (2007) The role of probiotic cell wall hydrophobicity

in bioremediation of aquaculture - Han Key Laboratory of Food Safety of Zhejiang

Province, Food Quality and Safety Department, Zhejiang Gongshang University,

Hangzhou 310035, China.

22. Jos Luis Balczar and Tyrone Rojas-Luna (2007) Laboratory of Fish Pathology,

Faculty of Veterinary Sciences, University of Zaragoza, Zaragoza, Spain, Faculty of

Aquaculture, Technical University of Machala, Machala, Ecuador.

23. Characterization of the rate-limiting step of the secretion of Bacillus subtilis alpha-

amylase overproduced during the exponential phase of growth - L Leloup, el-A

Haddaoui, R Chambert and MF Petit-Glatron

Institut Jacques Monod, CNRS, Universite Paris 7 Denis Diderot, France.

Thesis Final Nisha