Authentication of the Panax genus plants used in Traditional

Chinese Medicine (TCM) using Randomly Amplified

Polymorphic DNA (RAPD) Analysis.

by

Catherine Rinaldi

Supervisors: Dr Guan Tay

Centre for Forensic Science

The University of Western Australia

Assoc/Prof Ian Dadour

Centre for Forensic Science

The University of Western Australia

This thesis is submitted in part fulfilment for the award of Master of

Forensic Science at the University of Western Australia

2007

i

I declare that the research presented in this 36 point thesis, as part of the 96

point Masters degree in Forensic Science, University of Western Australia,

is my own work. The results of the work have not been submitted for

assessment, in full or part, within any other tertiary institute.

Catherine Rinaldi

ii

ACKNOWLEDGEMENTS

First, I would like to thank my supervisors Dr Guan Tay and Associate Professor Ian

Dadour. Guan for providing guidance, support and knowledge for the duration of this

project. Ian for providing the facilities and support for the completion of this project.

To the members of the lab who provided their friendship, support and reviews of my

written work. Angelina Lim and Yvette Hitchens who put up with me in the lab on a

daily basis and kept my time in the lab enjoyable. Dr. Michelle Harvey who helped me

on a daily basis by dispensing much of her knowledge on the day to day problem

solving relating to DNA based research. The other members of Guan’s research group

Rebecca Ford, Haifa Khoory and Steve Iaschi who provided knowledge, support and

friendship.

I would like to thank Danielle Molan and the other members of staff at the Centre for

Forensic Science who keep the Masters course running smoothly.

Finally, to my family without whose constant support, understanding and patience I

would not have made it to the end of this project.

iii

PREFACE

The main objective of the research undertaken here was to apply DNA profiling

techniques to material used in Traditional Chinese Medicine (TCM). Specifically this

study was established, to distinguish different species within the Panax plant genus

(including the common ginseng), using Randomly Amplified Polymorphic DNA

(RAPD) profiling. With specific consideration to whether DNA could be extracted and

amplified from materials that are sold commercially. This material is likely to contain

highly degraded DNA that will be difficult to analysis using DNA profiling.

It is important to accurately distinguish between different species within the Panax

genus or any material used in TCM because they treat different ailments and

adulterations with substitutes diminishs their efficacy. Furthermore, the different types

of raw material used in TCM have different commercial values depending on cultivator

and origin. Although difficult to quantify substitution is known to occur. The ability to

distinguish plant species will enable greater policing of the trade in the materials used

for TCM. Once techniques are established for one sample they can be applied to other

materials used in TCMs, including other plant material as well as animal material. The

use of animal parts is not only a barbaric act but many of the animal parts used are

derived from species that are endangered.

The results of research undertaken to fulfil these aims are presented in this thesis in

three sections. The first section is an introduction that provides background to the TCM

trade and justification for this research. The introduction begins with an outline of the

use and trade in traditional medicines, then proceeds to the reasons to authenticate

material used in TCM and the methods available. The aims and rationale of the

experimental design of this research are then outlined.

Subsequently, in the second section of this thesis, two manuscripts which have been

submitted to journals for review are presented. These manuscripts are presented as per

the requirements for submission of each journal.

iv

The first of the two manuscripts is titled “Differentiation of Ginseng species using

Randomly Amplified Polymorphic DNA (RAPD)” and was submitted to Forensic

Science, Medicine and Pathology. This manuscript contains the results of RAPD

analysis of dried roots of three different Panax species, Panax ginseng, Panax

quiquefolium and Panax notoginseng. Results are also presented of the analysis of

liquid samples, as TCM are sold in a variety of forms ranging from intact roots to

indistinguishable powders and liquids the authentication of liquid samples is necessary.

In many situations, plant materials are mixed to augment the value of the active

ingredient. Consequently, mixing experiments were performed in order to determine

whether RAPD analysis is sensitive enough to distinguish the materials within mixtures.

The second manuscript titled “Identification of Panax plant species within mixtures

using Randomly Amplified Polymorphic DNA (RAPD)” was submitted to the journal

Planta Medica and presents the results of analysis of mixture samples. Samples of three

Panax species were mixed together and analysed. P. ginseng was also mixed with a

genetically unrelated positive control (potato).

Following the two papers is a general discussion and conclusions section that brings

together the material presented in the manuscripts and outlines where the results fit

within the currently available research literature. The bibliography presented after the

concluding section contains all references used within the thesis. After the bibliography

Appendix A contains the recipes for solutions and the methodologies used in the

laboratory for this research.

All laboratory bench work completed for this thesis was performed by me. I collected

the samples and systematically labeled them to ensure no cross contamination between

species. I extracted the DNA from each sample. The primers used for analysis were

selected from my review of the relevant literature and genomic databases. I performed

all PCR experiments and electrophoresis interrogation.

I attended the 17th

Meeting of the International Association of Forensic Sciences in

2005. I collated all the data for the first manuscript and presented it at the 18th

International Symposium on the Forensic Sciences held by the Australian and New

v

Zealand Forensic Science Society (Fremantle, Australia, 2007). The manuscripts were

written by myself and revised in consultation with my supervisors.

vi

TABLE OF CONTENTS

ACKNOWLEDGEMENTS .......................................................................................... ii

PREFACE .................................................................................................................... iii

TABLE OF CONTENTS ............................................................................................ vii

ABSTRACT ............................................................................................................... viii

DEFINITIONS ............................................................................................................... x

ABBREVIATIONS AND SYMBOLS ...................................................................... xiii

SCIENTIFIC AND COMMON NAMES ................................................................ xivv

SECTION 1: GENERAL INTRODUCTION ................................................................ 1

1 Background ............................................................................................................. 2

2 Traditional Medicine ............................................................................................... 3

3 Forensic Significance .............................................................................................. 4

3.1 Reasons to Authenticate TCM composition .................................................... 4

3.1.1 Misrepresentation on labelling. ................................................................ 4

3.1.2 Substitution with alternative species. ........................................................ 4

3.1.3 Poisonous Materials ................................................................................. 5

3.1.4 Identification of endangered species. ........................................................ 6

3.2 Authentication of TCM .................................................................................... 7

3.2.1 Traditional methods .................................................................................. 7

3.2.1.1 Morphological and Histological Analysis .......................................... 7

3.2.1.2 Chemical Analysis ........................................................................... 10

3.2.1.3 Immunological Authentication......................................................... 11

3.2.2 An Alternative Technique – DNA Analysis ............................................. 13

4 DNA Profiling ....................................................................................................... 15

4.1 Background to DNA ...................................................................................... 15

4.1.1 The Structure of DNA .............................................................................. 15

4.2 Polymerase Chain Reaction ........................................................................... 17

4.2.1 Types of DNA Polymorphisms ................................................................ 19

4.3 Use of DNA profiling to authenticate TCM .................................................. 22

4.3.1 Low C0t DNA profiling ............................................................................ 22

4.3.2 Restriction Fragment Length Polymorphism .......................................... 24

vii

4.3.3 DNA Sequencing ..................................................................................... 24

3.3.4 Microsatellites ......................................................................................... 26

3.3.5 Randomly Amplified Polymorphic DNA (RAPD) ................................... 27

3.3.6 Sequence Characterised Amplified Region (SCAR) ................................ 28

4 Aims and Rationale of Experimental Design ........................................................ 30

SECTION 2.1: Differentiation of Ginseng species using Randomly Amplified

Polymorphic DNA (RAPD). ........................................................................................ 33

SECTION 2.2: Identification of Panax plant species within mixtures using a Randomly

Amplified Polymorphic DNA (RAPD) method. .......................................................... 48

SECTION 3: GENERAL DISCUSSION AND CONCLUSIONS .............................. 62

Summary of Conclusions ......................................................................................... 69

BIBILOGRAPHY ........................................................................................................ 70

APPENDIX A .............................................................................................................. 83

viii

ABSTRACT

Traditional medicines are used by millions of people throughout the world as their

primary source of medical care. A range of materials are in used traditional medicines

including plant and animal parts. Even though the traditional medicine trade is

estimated to be worth sixty billion dollars annually the trade remains largely

unregulated. Unscrupulous practices by vendors to increase their profit margins such as

substituting and adulterating expensive material with cheaper varieties go unchecked.

This can be dangerous to consumers because some substitutions involve poisonous

material. Also, animal parts from endangered species can find their way into traditional

medicines, therefore there needs to be a way to identify them in traditional medicines to

prosecute poachers.

The traditional techniques used for the identification of material used in Traditional

Chinese Medicine (TCM) include, morphological, histological, chemical and

immunological analysis. However, these techniques have their limitations. This makes

applying multiple techniques essential to provide thorough authentication of the

material. DNA profiling provides a technique well suited to analysing material used in

TCM.

DNA profiling is advantageous over other techniques used to authenticate material used

in TCM because it requires only a small sample amount, can determine the cultivator,

be used on all forms of TCM and potentially distinguish the components of mixtures.

Limited research has been done to DNA sequence the materials used in TCM, therefore

a technique not requiring any DNA sequence information needs to be employed.

Randomly Amplified Polymorphic DNA (RAPD) analysis uses a single arbitrary primer

of between 10 and 20 base pairs in length to amplify DNA. As the primer is not

designed to be specific to a sample the primer binds at a number of locations along the

DNA sequence of the sample creating a number of fragments of varying sizes. The

number and size of the fragments produced varies from one DNA sequence to the next.

ix

Therefore, profiles of different species/individual are different and species’ can be

distinguished.

Commercially sold traditional medicines are processed which is likely to degrade the

DNA of the sample making extraction and amplification difficult. Here an organic

Phenol:Chloroform extraction technique extracted DNA from commercial dried root

samples. The extracted DNA was amplifiable using RAPD primers. The RAPD

primers used here produced enough polymorphic bands to distinguish different plant

species. They were used to distinguish commercial samples that were sold as three

different species within the Panax genus, Panax ginseng, Panax quinquefolium and

Panax notoginseng and genetically unrelated plant material; Potato and

Eleutherococcus senticosus.

Liquid samples and mixtures were also profiled with the RAPD primers to determine

whether the RAPD primers provide enough distinguishing ability to analyse these forms

of TCM. DNA was extracted from the liquid samples, one a ginseng drink and the

other an ginseng extractum. However, there was no reliability in the production of PCR

products. The analysis of the mixture samples found that not enough polymorphic

bands were produced by the RAPD primers used here to identify Panax species within

mixtures of two Panax species. While when P. ginseng was mixed with a genetically

unrelated sample there was enough polymorphism to differentiate the two samples in

the mixture.

The results of this research show that RAPD analysis provides a simple and inexpensive

technique to begin analysis of materials used in TCM. Using RAPD analysis it is

possible to distinguish Panax plant species from each other. However, the RAPD

primers used here did not provide enough reproducibility or polymorphism to analyse

liquid and mixtures of Panax species plants.

x

DEFINITIONS

Antibody A large molecule produced by the body

in response to a foreign antigen that

enters the body. The antibody is

complementary to the antigen so the

antibody and antigen bind.

DNA The genetic information contained within

the nucleus each cell within an organism.

DNA Sequencing

Determining each nucleotide in a

segment of the DNA genome.

Low C0t DNA DNA with a highly repetitive sequence

that is separated from other DNA

fragments based the time it takes to

reanneal after denaturing.

Microsatellite A short sequence of bases that is repeated

a number of times in a row. As referred

to as Short Tandem Repeats (STR).

Molecular Marker Molecule A chemical compound when present in a

sample indicates that the sample is a

particular substance, for example Panax

plant species are indicated by

ginsenosides.

Nucleotide The smallest unit of DNA molecule. A

base attached to a sugar molecule.

xi

Polymerase Chain Reaction

A method used in DNA profiling that

amplifies the number of copies of a

fragment of DNA.

Polymorphisms

Differences in the sequences of samples.

These polymorphisms are deletions,

inclusions and single point switches.

Primers

Short strands of nucleotides of known

sequence, which bind to the DNA and to

which nucleotides are added to build a

new strand of DNA during PCR.

Randomly Amplified Polymorphic DNA

(RAPD)

A DNA profiling technique where short

arbitrary primers are used that are not

specific to the sample being tested.

Restriction Fragment Length

Polymorphism (RFLP)

Restriction enzymes cut the DNA at sites

along the DNA sequence and differences

in the sequence between the sites is

measured by the length of the DNA

fragments produced.

Sequence Characterised Amplified

Region (SCAR)

A DNA profiling technique that

sequences polymorphic DNA fragments

from RAPD primers and creates primers

that only amplify when testing the sample

that had the polymorphic band.

Single Nucleotide Polymorphism (SNP) DNA profiling technique that examines

differences in single nucleotides of

samples.

xii

Taq Polymerase

An enzyme used for PCR to copy a

fragment of DNA.

Traditional Chinese Medicine (TCM) Medicines using natural products which

originated in China. These medicines use

plant and animal material for the

treatment of ailments. The medicines are

available in a variety of forms from

whole plant materials through pills,

potions, powders and mixtures.

xiii

ABBREVIATIONS AND SYMBOLS

DNA Deoxyribonucleic acid

EDTA Ethylenediaminetetraacetic Acid

PCR Polymerase Chain Reaction

RAPD Randomly Amplified Polymorphic DNA

RFLP Restriction Fragment Length Polymorphism

SCAR Sequence Characterised Amplified Region

SNP Single Nucleotide Polymorphism

STR Short Tandem Repeat

TBE Tris Borate EDTA

TCM Traditional Chinese Medicine

WHO World Health Organisation

BSA Bovine Serum Albumin

ddNTP dideoxynucleotide triphosphate

dNTP deoxynucleotide triphosphate

TE Tris EDTA Buffer

MgCl2 Magnesium Chloride

µ Micro

oC Degrees Celsius

xiv

SCIENTIFIC AND COMMON NAMES

Scientific Name Common Name

Panax ginseng Chinese ginseng

Panax quinquefolium American ginseng

Panax notoginseng Sanchi ginseng

Eleutherococcus senticosus Siberian ginseng

Mirabilis jalapa Four O’clock Flower

Phytolacca acinosa Indian Poke

Radix Angelica Dang-gui

Crocus sativus Saffron crocus

Radix astragali Milk-Vetch

Pterocaulon sphacelatum Apple Bush

Stephania tetrandra Han fang ji

Aristolochia fangchi Guang fang ji

Angelica acutiloba Dong dang gui

Fritillaria cirrhosa Chuan bei mu

Coleus forskohlii Makandi

Symplocarpus foetidus Skunk cabbage

Pinellia ternata Crowdipper

Gastrodia elata Tien ma

1

SECTION 1

GENERAL INTRODUCTION

2

1 Background

Traditional and natural medicines are used throughout the world as a primary source of

medical care for millions of people especially those without access to western medicines.

Many cultures continue to practise medical treatments used by their ancestors for thousands

of years (Barnes & Prasain, 2005; Chan et al., 1993). Within western societies natural and

traditional medicines are growing in popularity with large proportions of the population

using these medicines as alternatives to conventional treatments.

The scope of traditional medicine is evidenced by the fact, that the natural medicine trade is

estimated to be worth approximately sixty billion dollars annually (World Health

Organisation, 2003; Yee et al., 2005). The World Health Organisation (WHO) also

estimates that up to 80% of the African population use traditional medicines for primary

health care (World Health Organisation, 2003). In Europe, North America and other

industrialised regions over half the population have reportedly used complementary or

alternative medicines (World Health Organisation, 2003). Traditional medicines have also

become conventional medicines; 25% of modern medicines are plant based, where the

plants were used initially in traditional treatments (World Health Organisation, 2003).

Even though the traditional medicine trade is worth an estimated sixty billion dollars

annually the industry remains largely unregulated (Yee et al., 2005). This allows

unscrupulous practises by vendors to go unnoticed. Therefore, techniques need to be

developed to authenticate the materials sold and used in traditional and natural medicines.

3

2 Traditional Medicine

The natural flora and fauna of a region people inhabit can be investigated by the inhabitants

to determine which can be used to remedy ailments. For example, Australian Aborigines

used Pterocaulon sphacelatum a perennial herb of Australia as a treatment for colds

(Semple et al., 1999). Since pre-Columbian times South American Indians have used

tobacco for medical, magical and recreational purposes (Wilbert, 1991). Within Africa

herbal remedies have been used as everything from antibacterial, anti-malaria and anti-

inflammatory agents to treatments for mental illnesses including depression and

Alzheimer’s disease (Fennell et al., 2004).

Traditional Chinese Medicines (TCM) are one of the most commonly used natural based

medicines in the world (World Health Organisation, 2003). The use of TCM was first

recorded in China over 2,000 years ago (Hon et al., 2003). TCM treats ailments by

restoring the balance between Ying and Yang, two opposing forces within the body that

when unbalanced cause illnesses. The restoration of Ying and Yang returns the

physiological conditions within the body to a balance (Guili & Chengbo, 1997). Materials

used in TCM include; plant and animal parts and they come in a variety of forms from pills

and powders to liquids and extracts.

A commonly used material in TCM is the roots of the Panax genus plants (Coleman et al.,

2003). There are a number of different species within this genus each used for the

treatment of different conditions (Guili & Chengbo, 1997). Species within this genus are

commonly referred to as ginseng with different species identified by their country of origin,

for example there are Chinese, Korean, American and Siberian ginsengs available.

However, each country does not indicate a different plant species, Chinese and Korean

ginsengs are both the Panax ginseng species. American ginseng is Panax quinquefolium

while Siberian ginseng is not a member of the Panax genus but Eleutherococcus

senticosus. There are a number of factors that determine the price of Panax roots, these

4

include country of origin, whether it is wild grown or farm grown and whether it is fresh or

dried.

3 Forensic Significance

As TCM is such a profitable industry world-wide the introduction of fraudulent items and

the lowering of expensive materials concentrations by vendors has become an unfortunate

reality. These practises break laws in different countries and in order to prosecute

perpetrators police require evidence. Therefore, it is important to develop forensic

techniques robust enough to allow illegal practises to be identified.

3.1 Reasons to Authenticate TCM composition

3.1.1 Misrepresentation on labelling.

The diminishing sources of raw material coupled with soaring prices, have lead to a

temptation for vendors to use lower concentrations of raw material than indicated on

packaging. This practise is easily accomplished when TCM are mixtures or pill, potion and

extract forms. Cui et al. (1994) found that six of fifty samples they tested contained no

detectable traces of ginsenosides, the chemical marker for Panax plant species, although

they claimed to contain P. ginseng. More recently, using Randomly Amplified

Polymorphic DNA (RAPD) and DNA sequencing, Mihalov et al. (2000) found that two out

of ten samples claiming to contain P. ginseng did not contain detectable traces of the plant.

3.1.2 Substitution with alternative species.

Counterfeiting is also common practice in the trade of TCM. This is when cheaper material

is exchanged for more expensive material when the two look-alike or in other forms of

TCM. The study by Mihalov et al. (2000) found two samples claiming to contain P.

ginseng that were identified by DNA analysis as containing soybean. Chan et al. (2000)

found that of twelve commercial ginseng products a quarter contained substitutions for an

5

item described on their label. But (1994) described cases of people falling ill after taking

TCM, the cause of the illness was traced to them having received poisonous material

substituted for other material. In these cases, the material was substituted by both the

pharmacist and the distributor, indicating a number of people in the supply chain benefit

from substitution of alternative species.

A famous case of the substitution of one material for another was the case where between

1990 and 1992, some 100 patients at a Belgium weight loss clinic became critically ill

(Schaneberg & Khan, 2004). The patients became ill with kidney failure and some required

dialysis or transplants. The case was attributed to the substitution of Stephania tetrandra

with Aristolochia fangchi, which is poisonous. Chan et al. (2005) also reported

substitutions of Stephania tetrandra with Aristolochia fangchi resulting in illness.

3.1.3 Poisonous Materials

The sale or importation of poisonous material is an illegal and dangerous practice. While

some poisonous materials are used in TCM after some processing or in a mixture with a

neutralising agent (Dickens et al., 1994). It is when they are sold as adulterations or

substitutes to unsuspecting consumers that they pose a serious threat to consumer’s health.

Examples of the substitution of indicated material for poisonous alternatives are described

throughout the research literature. For example, two common adulterants of P. ginseng are

Mirabilis jalapa (the Four O’Clock Flower) and Phytolacca acinosa (Indian Poke) are

poisonous (Ngan et al., 1999). These substitutions may not be harmful in most cases unless

someone self medicates and increases the amount of material they are consuming, then

problems occur. Another example is the case of the Belgium weight loss clinic described

above.

Not only can TCM contain poisonous plant and animal materials but toxic metals have also

been found in samples. Espinoza et al. (1996) analysed twelve commercial herbal balls and

found that eight contained Arsenic and/or Mercury; only two samples contained neither.

6

The authors outlined how by taking the recommended daily dose of the herb balls (2 per

day) people consumed up to 73mg of Arsenic and 1,200g of Mercury a day. Those levels

are above the previously reported levels of consumption that caused chronic poisoning of

12mg and 262mg per day for Arsenic and Mercury respectively (Kew et al., 1993; Tay &

Seah, 1975).

3.1.4 Identification of endangered species.

TCM are not exclusively plant material, parts of animals many of which are endangered are

common ingredients (Still, 2003). Poaching occurs illegally throughout the world and a

common end point for the resulting animal material is as part of traditional medicines.

DNA profiling of endangered animals so they can be identified when sold has been

undertaken on a number of animals to try and stop poaching (Lorenzini, 2005; Manel et al.,

2002; Palsboll et al., 2005)

An example of endangered animal material used in TCM is that of the tiger (Panthera

tigris). Bones of tigers are used in combination with other animal and plant extracts in pills

and plasters for the treatment of rheumatism and other ailments (Still, 2003; Wetton et al.,

2002). Since it is illegal to trade in endangered species, it is important to develop methods

to authenticate the presence of animal material in TCM, in order to enforce legislation

against the poaching of animals.

Wetton et al. (2002) described a highly sensitive tiger-specific real-time PCR assay using

primers specific to the mitochondrial cytochrome b gene of tigers. DNA was successfully

amplified from blood, hair, bone and TCM spiked with bone from the tiger. Other DNA

research has been done to identify tigers using microsatellites (Singh et al., 2004; Xu et al.,

2005). DNA profiling research has been used to identify snake (Yau et al., 2002), elephant

ivory (Comstock et al., 2005), seahorse (Zhang et al., 2003) and turtles (Lo et al., 2006).

Similar strategies can be developed for other endangered animal species including

rhinoceros, bears, and primates.

7

Cruel and inhumane treatment of wildlife by people continues to occur for the collection of

material to use in traditional medicine. An example is keeping live bears in cages with

catheters in their Gall Bladders to milk their bile (Espinoza et al., 1993; Espley, 2006).

When keeping the bears alive is too much trouble, countless numbers are slaughtered across

Asia each year and their Gall Bladders removed. The Gall Bladder of bears is thought by

many to provide relief from fever, detoxify the liver and reduce pain and swelling

(Espinoza et al., 1993; Espley, 2006).

3.2 Authentication of TCM

3.2.1 Traditional methods

Methods traditionally used to authenticate material used in Traditional Chinese Medicine

(TCM) include, morphological, histological, chemical and immunological analysis. These

methods are able to provide authentication of materials used in TCM with varying levels of

success. Each technique has advantages and disadvantages; as such it is best to use a

combination of techniques to provide more reliable conclusions. A comparison of the

techniques available to authenticate material used in TCM is given in Table 1.

3.2.1.1 Morphological and Histological Analysis

Morphological identification of materials used in TCM has been practiced for as long as

TCM has been used. Morphological analysis provides fast and accurate identification that

anyone can use, based on their experiences with the material. This is especially true for

material commonly encountered such as Panax plant species. Morphological identification

relies on a person’s experience to identify material based on its appearance.

For many plants their appearance is enough to accurately distinguish them from other

plants, as they look considerably different to others. For example, when dried, P.

notoginseng is a black root that is easily distinguishable from P. ginseng and P.

quinquefolium. However, P. ginseng and P. quinquefolium are not easily distinguished

8

from each other, as they both are light brown/yellow in colour after drying and have similar

shapes, see Figure 1.

Advantages of using morphological analysis to identify material used in TCM include ease

and accuracy. Experts with years of knowledge on which to rely can simply examine the

material and identify it. However, these advantages rely on what is a major limitation of

the technique, that an expert is required which means it is not a quantitative technique.

This is a considerable problem when no expert is available and it is time consuming and

expensive for a person to gain enough experience to be considered an expert. Also, the

identification remains the expert’s subjective opinion if samples are not compared to an

exemplar.

There are a number of other serious limitations when using morphological analysis to

identify material used in TCM. Firstly, two plant species may have very similar

morphologies making it difficult to distinguish between them. Another limitation is that

morphological analysis cannot be used on all forms of TCM. For instance, plants are sold

in many different forms ranging from slices to processed powders or liquids which cannot

be authenticated using morphological analysis, see Figure 1 for examples of the variety of

material sold as TCM. Finally, TCM are commonly mixtures, the components of which are

very difficult to distinguish using morphological analysis.

Histological analysis is when the cells of the sample are examined under a microscope.

Morphology and other characteristics of the cells are used as indicators of the material the

cells are from. Hence the sample can be identified.

Limitations of histological analysis are similar to those of morphological analysis,

including, that it cannot be applied to TCM of all forms. For example, it is unlikely that

whole cells will be found in liquid TCM. Also, drying and processing samples prior to

their sale may affect the structure of the cells differently depending on the procedures used,

complicating their identification.

9

Figure 1. Examples of the different forms of TCM. A. The different ginseng

products shown in this picture include liquid samples, both an extractum and

a liquid drink, whole dried root material, slices and dried root pieces.

B. Samples of Panax species, clockwise from top left whole P. ginseng

root, P. quinquefolium pieces, P. notoginseng pieces and P. ginseng pieces.

A

B

10

3.2.1.2 Chemical Analysis

Chemical analysis involves the determination of the chemical composition of material in

order to identify it. There are a large variety of techniques available to do this. Chemical

analysis is advantageous over the morphological techniques outlined above, as it can be

applied to any form of TCM.

A commonly used chemical analysis type for material used in TCM is to use specific

marker molecules. This method is routinely used for the authentication of materials used in

TCM (Chan et al., 2000; Cui et al., 1994; Dou et al., 1996; Feng & Li, 2002; Liu et al.,

2001; Tawab et al., 2003; van Breemen et al., 1995; Zhang et al., 2002; Zhao et al., 2003).

It involves the detection of molecules identified as being specific to a certain species or

genus. For example, the presence of ginsenosides, a group of saponins, indicates a sample

is of the Panax genus (Assinewe et al., 2003; Chan et al., 2000; Dou et al., 1996; Du et al.,

2003; Fuzzati, 2004; Mallol et al., 2001; Zhang et al., 2002). While the presence of ferulic

acid with Z-ligustilide indicates a sample is Radix Angelica (Lao et al., 2004; Zhao et al.,

2003).

Chemical analysis provides the advantage over other techniques of being able to be used to

determine the pharmacologically active components of traditional medicines. For example,

many of the specific indicator molecules that are used to identify materials used in TCM

are the active components of the material. This is not possible with other techniques such as

DNA profiling.

Reliance on specific indicator molecules to identify a single plant genus is not possible.

Ginsenosides that are considered to be specific to one of the Panax species can be found in

the Panax other species (Popovich & Kitts, 2004). Also, ginsenosides have been extracted

from plants not in that genus (Tanaka et al., 2005). Tanaka et al (2005) were able to extract

ginsenoside Rb1 from Kalopanax pictus in higher concentrations then found in P. ginseng.

This means that the presence of specific marker molecules cannot be relied upon

exclusively, to identify genus or species of plants (Dong et al., 2003; Lao et al., 2004).

11

One problem with TCM analysis is trying to determine cultivators and where the sample is

grown. One possible way to distinguish cultivators is by comparing the abundances of the

chemical within the sample because the abundances vary depending on where the sample is

grown (Dong et al., 2003; Lao et al., 2004). So, the abundance of athe particular molecular

marker in a plant can be related back to other plants from its region of growth.

Other limitations of chemical analysis include that it requires a substantial amount of

material to be tested, which is not always available when analysing TCMs. Distinguishing

the components of a mixture is difficult using chemical analysis because the analysis only

provides a chemical profile of the whole sample and identification of ingredients may not

be possible. When trying to identify the components of a mixture, testing for the presence

of ginsenosides does not identify which species is in a mixture if it contains multiple Panax

species.

3.2.1.3 Immunological Authentication

Antibodies have also been used for the identification of material used in TCM (Fukuda et

al., 1999; Fukuda et al., 2000a; Fukuda et al., 2000b; Fukuda et al., 2001; Kitagawa et al.,

1997; Putalun et al., 2002; Putalun et al., 2004; Shoyama et al., 1999). Antibodies are large

immunoglobulins produced by the body’s immune system in response to a foreign

pathogen, called an antigen (Roitt, 1991). Antibodies produced in response to an antigen

have a complementary structure to that antigen so when they are later encountered they

bind together. When bound in required concentrations the antibody-antigen complex

precipitates, this property of the antibody-antigen complex allows for the identification of

material using a variety of immunological techniques. These techniques range from simple

Ouchterlony methods where antibodies and possible antigens are mixed and precipitation is

checked for, to ELISA where multiple antibody-antigen bindings occur with fluorescent

labelling and light detection.

Antibodies tend to be produced against the chemical components within a sample, for

example, antibodies were made against an activating pectin found in the roots of Angelica

12

acutiloba (Wang et al., 1999), forskolin from the plant Coleus forskohlii (Yanagihara et al.,

1996) and tetrahydrocannabinolic acid from Cannabis sativa (Tanaka & Shoyama, 1999).

Antibodies have been produced against a number of the ginsenoside compounds contained

within samples of Panax genus plants (Fukuda et al., 1999; Fukuda et al., 2000a; Fukuda et

al., 2000b; Fukuda et al., 2001; Jung et al., 2002; Nah et al., 2000; Putalun et al., 2002;

Putalun et al., 2004; Saita et al., 1993; Tanaka et al., 1999; Tanaka et al., 2006; Yoon et al.,

1998).

Fukuda et al. (2000) produced antibodies against ginsenoside Rg1, one form of the

ginsenoside compound found in Panax species. They showed that the different Panax

species could be distinguished from each other using competitive ELISA to measure the

antigen content within the sample. Tanaka et al. (1999) found that they could produce

antibodies against ginsenoside Rb1 and could discriminate Panax species using the same

method as Fukuda et al. (2000). Antibodies have also been produced against ginsenosides

Rf and Rg2 (Yoon et al., 1998). Tanaka et al. (2006) used monoclonal antibodies against

ginsenoside Rb1 to identify Panax ginseng, Panax notoginseng, Panax quinquefolius and

Panax japonicus. Their protocol used ELISA and western blotting.

An advantage of using antibodies is that field tests can be developed which maybe

marketed or added to forensic police kits as a presumptive test. These tests could be based

on already available designs such as pregnancy tests where the binding of the antibody and

the antigen causes a colour change on the testing stick. Alternatively a small Ouchterlony

based assay could be developed.

A limitation of antibody research is that the cultivators of the material are difficult to

determine based only on the antigens present in the sample because the presence of

ginsenosides in a sample, as detected using antibodies, will not vary from one cultivator to

the next. Also it will be difficult to distinguish the components of a mixture, for example, a

mix of more than one species of Panax genus.

13

3.2.2 An Alternative Technique – DNA Analysis

An alternative to the techniques described above is to analysis TCM ingredients using DNA

profiling techniques. DNA analysis of material used in TCM requires the application of

DNA protocols generally used for profiling human, animal and plant to TCM. DNA

analysis has been applied to a number of different materials used in TCM using a number

of different techniques (Boehm et al. 1999; Chung et al. 2002; Cui et al. 2003b; Ha et al.

2001; Hon et al. 2003; Tanaka et al. 2006).

Advantages of using DNA profiling over more traditional techniques described above

include, the requirement of only a small sample amount, TCM in any form including slices,

pills, powders, potions or extracts can be analysed and most importantly DNA techniques

can potentially distinguish the components of a mixture, which is not possible using

traditional techniques.

14

Table 1: Comparison of Advantages and Disadvantages of different identification techniques for material used in

TCM.

Morphology Chemistry Immunology DNA

Basis of

identification

Comparison of

morphology

Determination of the

chemical composition

Detection of antigens

within material by

antibody binding

Comparison of DNA

polymorphisms

between materials

Advantage of

method

Simple Can distinguish

cultivators

Can be used on all

sample types

Can be developed as a

field test

Uses small amounts

Can be used on any

form of TCM

Can distinguish

species and

cultivator

Can be developed

for a field test

Disadvantage of

method

Cannot be used on all

TCM forms

Samples may not be

distinguishable from

others based on

morphology

Requires a large

sample size

Difficult to use on

mixtures

Cannot determine

cultivator

Difficult to use on

mixtures

Expensive to

establish some of

the techniques

15

4 DNA Profiling

4.1 Background to DNA

Profiling of DNA samples is routinely used in forensic laboratories for the identification of

people involved in or related to crimes (Tamaki and Jeffreys, 2005). It is also used for

uncovering fraud in the livestock trade, especially in the multi-billion dollar thoroughbred

industry (Lee & Cho, 2006). DNA profiling also has civil applications, for example in

assigning paternity to children (Schneider, 2007; Sobrino et al., 2005; Coney, 1999). DNA

was first applied in a forensic context in 1985 when Alec Jeffreys applied RFLP to a

criminal case (Gill et al., 1985; Tamaki & Jeffreys, 2005). Since, then the reliance on DNA

analysis to provide evidence in criminal cases has increased dramatically.

DNA profiling is a commonly used technique for the identification and authentication of

biological material. For example, it has been used for the authentication of meat products

where the material being sold is mixed with a different species or sold under a different

label (Calvo et al., 2002; Saez et al., 2004). DNA techniques have also been used to

differentiate genetically modified plants from un-modified food (Leimanis et al., 2006; Lee

et al., 2006)

4.1.1 The Structure of DNA

DNA is made up of subunits called nucleotides; each is the combination of a base and a

sugar molecule (Sherwood, 1997). There are four different bases in DNA molecules,

adenosine, thymine, cytosine and guanine. Each nucleotide is connected to the phosphate

backbone that joins all nucleotides in the DNA molecule together. In this way a long

strand of nucleotides is created. Bases are complementary to each other and bind together

through hydrogen bonds in pairs; guanine with cytosine and adenosine with thymine and

the DNA molecule is double helix shaped, shown in Figure 2.

16

Figure 2. The Structure of DNA (reproduce from Sherwood, 1997). The DNA

molecule is made up of nucleotide bases attached to a Sugar-Phosphate

backbone and forms a double helix structure. There are four nucleotide

bases, which bind together in pairs, cytosine with guanine and adenine with

thymine.

Phosphate- Sugar

Backbone

Adenine

Guanine

Cytosine

Thymine

17

Plant DNA has the same structure as all other types of DNA, therefore methods used to

analyse other DNA samples can be applied to the DNA of plants. The difference between

human and plant DNA, besides the sequence of bases, is that plant cells may contain more

than 48 chromosomes normally found in each human cell (Blair, 1975; Yi et al., 2004). In

plants there can be up to double or triple that many chromosomes in each cell, for example

Symplocarpus foetidus contains 60 chromosomes (Blair, 1975). This does not affect the

protocols involved in DNA profiling or any results obtained from DNA analysis.

DNA can be used to distinguish different plant species because all plants within a plant

species have the same DNA sequence and each different species has a different DNA

sequence. DNA analysis has previously been used to profile many plant spceies including,

celery (Dovicovicova et al., 2004), cannabis (Hsieh et al., 2005; Linacre & Thorpe, 1998),

Echinacea species (Kapteyn et al., 2002), grasses (Ward et al., 2005) and plants used in

TCM, for example Radix astragali (Ma et al., 2000), Fritillaria cirrhosa (Li et al., 2003)

and Crocus sativus (Ma et al., 2001).

4.2 Polymerase Chain Reaction

DNA based techniques used to identify material, whether it be human, plant or animal, use

a technique called Polymerase Chain Reaction (PCR). PCR, is molecular photocopying,

where the number of copies of a fragment of DNA is increased as new copies of DNA are

produced. The steps involved in PCR is shown schematically in Figure 3.

18

Figure 3. The Polymerase Chain Reaction occurs in three steps. First, the DNA in

denatured by heating. Then the temperature is lowered and the primers

anneal. Finally, nucleotides are added to the primer to create a new

complementary strand of DNA.

3’ 5’

5’ 5’

TACGACCCATCCGTATGG

ATGCTGGGTAGGCATACC

3’

ATGCTGGGTAGGCATACC

TACGACCCATCCGTATGG 3’ 5’

5’

Denature

Bases are

added

during

extension

ATGCTGGGTAGGCATACC

TACGACCCATCCGTATGG

3’

3’ 5’

5’ ATGCTGGGTAGGCATACC

TACGACCCATCCGTATGG

3’

3’ 5’

5’

ATGCTGGGTAGGCATACC

TACGACCCATCCGTATGG

3’

3’

5’

5’

Primers

Anneal

Complementary

strands completed

cycle begins again

3’

3’

3’ TACG

TACC 5’

19

PCR involves three steps, denaturing, annealing and extension (see Figure 3). First the

DNA is denatured, which involves raising the temperature of the sample to near boiling

point. At these temperatures the bonds holding the two strands of DNA together are broken

and the DNA separates into two singles strands. During the annealing step the temperature

is decreased and primers, short strands of nucleotides, bind to the DNA strands where

complementary sequences of nucleotides occur. Finally, during extension a Taq

Polymerase molecule attaches nucleotides, to build a complementary strand of DNA to the

original sample. After this step two sets of double stranded DNA are present for every

DNA double helix started with. Usually PCR protocols require approximately 30 cycles to

be performed after which there are millions of copies of DNA that can be analysed.

4.2.1 Types of DNA Polymorphisms

Different DNA profiling techniques measure different DNA polymorphisms within the

DNA sequence. There are a wide range of polymorphisms that can be measured by various

techniques. Polymorphisms are insertions and deletions of nucleotides within the sequence

or changes in to bases in the sequence. Primers are designed for use in the different DNA

profiling techniques so that fragments containing the polymorphism are amplified.

There are a wide variety of DNA profiling techniques that detection different

polymorphisms. Single Nucleotide Polymorphisms (SNPs) measures differences between

DNA sequences caused by single deletions or insertions, that is changes to single

nucleotides (Rafalski, 2002). Restriction Fragment Length Polymorphism (RFLP) detects

insertions between the sites where a restriction enzyme acts.

Randomly Amplified Polymorphic DNA (RAPD) uses a small arbitrary primer of between

10 to 20 base pairs in length as both the forward and reverse primer (Roberts & Crawford,

2000; Yu & Pauls, 1992). These primers are not designed to be specific to the sample.

This results in the production of a number of different fragments of varying sizes and

number depending on the sample sequence, illustrated in Figure 4. The RAPD analysis

measures a variety of insertions and deletions to create different profiles for different

20

samples. For example, a deletion at the primer binding site will result in no band being

produced. In contrast an insertion between two primer binding sites will result in a larger

sized fragment.

Short Tandem Repeats (STR) analysis uses primers that have been designed to bind to areas

around where a tandemly repeating segment occurs. The result of using this type of primer

is a single fragment of DNA for each primer set. The length of the fragment indicates the

number of tandem repeats. The number of repeats is the variable indicator used to identify

the material with each individual having a different number of repeats.

21

Figure 4. A schematic representation of Randomly Amplified Polymorphic DNA

(RAPD) analysis. A. The short arbitrary primers used for RAPD analysis

binds to multiple places on the DNA sequence of the sample during PCR

resulting in the production of a number of different sized bands. B. A

representation of the electrophoresis gel produced with the fragments

generated from the two samples in A. The fragments are separated based on

the size of the resulting bands. In this example, Samples 1 and 2 have two

bands in common and Sample 2 has an extra smaller band.

B

1 2

A

5’

Sample 1 Extension

DNA

Primer

5’

3’

3’

Sample 2

5’

5’

3’

3’

22

4.3 Use of DNA profiling to authenticate TCM

To analyse TCM using DNA based techniques, primers need to be designed and protocols

optimised for use with materials used in TCM. A range of DNA profiling techniques have

been used to authenticate material used in TCM. Outlined below are different techniques

that have been used. Table 2 shows a summary of the different techniques and the material

they analysed.

4.3.1 Low C0t DNA profiling

Low C0t DNA fingerprinting was applied to TCM by Leung (1999). Low C0t DNA

fragments are highly repetitive; this property allows these DNA fragments to be separated

from other DNA fragments under certain conditions. Low C0t DNA is analysed by

denaturing DNA then re-annealing it, highly repetitive areas will reassociate faster then

single copies of a DNA sequence. These rapidly associating fragments are the low C0t

DNA. These fragments are separated from the other fragments and probed for host-specific

DNA to identify the material. This technique has been used to successfully differentiate

between P. ginseng and P. quinquefolium (Ho & Leung, 2001; Leung, 1999).

The use of low C0t DNA fingerprinting has been surpassed by newer technology and

techniques. It lacks the sensitivity of other techniques and is not practical for large scale

and high throughput testing. Reproducibility of the method is also low as it is highly

dependant on the quality of DNA and other technical factors, such as blotting and

hybridisation conditions. The demand for large amounts of high quality non-degraded

DNA from TCM samples is unrealistic. Since most genomic DNA sourced from TCM

samples is exposed to processing which degrades the DNA.

23

Table 2. DNA profiling techniques previously used to authenticate material used

in TCM.

Species Method DNA marker Reference

Panax species STR analysis Microsatellite (Hon et al., 2003)

Fritillaria cirrhosa DNA sequencing 5S-rRNA spacer

region (Li et al., 2003)

Panax species RAPD Analysis 5S-rRNA spacer

domains (Cui et al., 2003)

Dendrobium

species DNA sequencing rDNA ITS region (Ding et al., 2002)

Panax ginseng AFLP & DAMD minisatellite Pg2 (Ha et al., 2002)

Pinellia ternata RAPD & PCR-

RFLP

20-mer random

primers

(Chung et al.,

2002)

Atractylodes plants RAPD 20-mer random

primers (Chen et al., 2001)

Panax species RAPD & PCR-

RFLP 18S rRNA gene

(Fushimi et al.,

1997)

Ginseng and

Amaranthus

Low C0t DNA

fingerprinting C0t-1 DNA (Leung, 1999)

Panax species RAPD Unspecified (Shaw & But,

1995)

24

4.3.2 Restriction Fragment Length Polymorphism

Restriction Fragment Length Polymorphism (RFLP) uses restriction enzymes to cut the

DNA sequence at certain locations along the DNA sequence. Samples can be distinguished

because the DNA fragments created vary in size, as the distance between the restriction

sites varies from one sample to another. This enables samples to be distinguished based on

the sizes of the fragments produced.

RFLP analysis has been used on a number of plant and animal species used in TCM

(Fushimi et al., 1997; Um et al., 2001; Watanabe et al., 1998; Yue et al., 2002). Chung et

al (2002) found that by using RFLP they could distinguish Pinellia ternata roots grown in

China from those grown in Korea. Also, Um et al. (2001) investigated the profiles of P.

ginseng grown at different locations using RFLP. They found that where some of the

samples were grown could be could be differentiated from the others.

This assay is more reproducible than Low C0t DNA fingerprinting and RAPD techniques.

However, RFLP analysis is also limited because it requires large amounts of high quality

DNA which may not be present in samples of TCM. Materials used in TCM are dried and

processed before they are sold, this processing and drying degrades the DNA found in the

sample. Also, the degree of polymorphism detectable by this type of technology limits the

techniques ability to distinguish closely related cultivators. In addition, this technique is

not applicable for a high-throughput laboratory environment.

4.3.3 DNA Sequencing

DNA sequencing is the gold standard of DNA profiling techniques. It involves the

determination of every base in the DNA sequence of a certain segment of the DNA. To do

this after PCR amplification a sequencing reaction is performed, which works on the same

principles as PCR, only modified nucleotides (ddNTPs), referred to as stop nucleotides, are

added to the reaction mixture along with nucleotides (dNTPs). When a stop nucleotide is

incorporated into the sequence extension is terminated. This creates DNA fragments of

varying lengths. The fragments are separated by electrophoresis and as each stop

25

nucleotide is tagged a different colour, the colour present at each location indicates which

of the stop nucleotides was incorporated into the fragment and hence the sequence of the

sample is determined.

Minimal DNA sequencing has been done on material used in TCM (Dong et al,. 2003; Kim

& Lee, 2004; Kim et al., 1991; Lee & Wen, 2004; Mihalov et al., 2000; Sun et al., 2004).

Kim et al (1991) DNA sequenced a region of the mitochondrial DNA of the P. ginseng

herb. This analysis provided only information on one species Korean ginseng (P. ginseng).

Also, the segment of DNA was only small compared to the total genome available for

analysis. Dong et al. (2003) sequenced three regions of the genome (5S rRNA spacer,

Internal Transcribed Spacer (ITS) and 18S regions) of Astragalus genus plant species to

determine their phylogeny. Much of the DNA sequencing of plant material is done on the

ITS, 18S and 5S rRNA regions because they are highly variable regions of DNA from one

plant species to the next (Chen et al., 2002; Komatsu et al., 2001; Linder et al., 2000;

Mizukami, 1995; Wen et al., 1998; Wen & Zimmer, 1996; Zhao et al., 2002; Zhao et al.,

2001).

Miholav et al. (2000) performed DNA sequencing on American and Korean ginseng dried

root material along with commercial products. Miholav et al. (2000) sequenced an area of

the ribosomal ITS region and were able to distinguish the American and Korean ginseng

based on differences in four bases.

Ding et al. (2002) DNA sequenced the ITS region (an area of ribosomal DNA (rDNA)) in a

number of Dendrobium species. They found they could distinguish these species by

comparing differences in single nucleotides of the sequences. Detection of Single

Nucleotide Polymorphisms (SNPs) could potentially be used to distinguish cultivators of

plant material.

However, DNA sequencing techniques are fairly labour intensive and are relatively

expensive. The availability of DNA sequences provides opportunities to produce

simplified assays by designing primers based on the sequence information acquired. These

26

primers can be developed to detect Single Nucleotide Polymorphisms (SNPs) and other

forms of polymorphisms recognised from the sequence information (Wen & Zimmer,

1996). The determination of SNPs will also allow DNA “lab-on-a-chip” to be developed

for use in the field (Carles et al., 2001; Lee & Rasmussen, 2000). An example, is the

Silicon based microarrays developed by Carles et al. (2001) for the detection of DNA

polymorphism to identify toxic plant material used in TCM.

3.3.4 Microsatellites

Microsatellite analysis is regularly used in the forensic community for the identification of

people using Short Tandem Repeats (STR) markers (Tamaki & Jeffreys 2005).

Microsatellite analysis involves the amplification of areas where STRs occur. STRs are

areas where a sequence of approximately 4 to 6 base pairs (eg, GATAGATAGATA) is

repeated a number of times in a row. The number of repeats of the short sequence varies

from one individual to another. The different number of repeats can be measured because

the length of the fragment varies with the number of repeats, that is fragments increase in

size with more repeats.

Hon et al. (2003) tested 150 American ginseng samples and 40 Oriental ginseng samples

with 16 microsatellites and found that nine of the microsatellites could unambiguously

distinguish the two samples. However, their paper provides no details of the primers or

methods that they used, to allow for the reproduction of their work. Hong et al. (2004)

identified 103 microsatellite markers during their DNA sequencing of the Korean ginseng

genome which have yet to be tested. Xu et al. (2006) used microsatellites to identify

different populations of the plant Gastrodia elata.

This method is relatively robust and assays can be fully automated for high throughput

analysis. When coupled with the multi-colour instruments available from manufactures

such as Applied Biosystems, automation and high volume data handling is possible.

27

Also, Qin et al. (2005) were able to authenticate P. ginseng using microarray

electrophoresis after they performed PCR analysis using two STR markers. They did this

by first performing a PCR on the sample then running the electrophoresis on a chip and

found that they could distinguish American and Oriental ginseng but were unable to

determine whether the samples were wild versus cultivated.

The major disadvantage of using microsatellite markers is designing primers specific to

areas where STR occur. This requires DNA sequence information which is time

consuming and costly to gather. Information on the variability of the repeats found in the

population also needs to be collected, which is once again costly and time consuming.

3.3.5 Randomly Amplified Polymorphic DNA (RAPD)

Randomly Amplified Polymorphic DNA (RAPD) has been used repeatedly for the

authentication of material used in TCM (Boehm et al., 1999; Lee & Rasmussen, 2000;

Mihalov et al., 2000; Nebauer et al., 1999; Nebauer et al., 2000; Schluter & Punja, 2002;

Shaw & But, 1995; Tanaka et al., 2006; Xu et al., 2002). RAPD involves the use of a

single arbitrary primer of between 10 and 20 base pairs in length, which acts in both the

forward and reverse directions. The primer binds to different sites along the DNA

sequence for different material, resulting in the production of a number of different sized

DNA fragments. The number and size of the fragments produce a distinctive profile for

different species/individuals. Therefore, without any prior knowledge of a sample’s DNA

sequence, it is possible to distinguish one species from another. This is essential when

working with material used in TCM because little DNA sequence information is available.

This technique has been used successfully to differentiate P. ginseng and P. quinquefolium

(Boehm et al., 1999; Cui et al., 2003; Mathur et al., 2003; Mihalov et al., 2000; Shaw &

But, 1995). However, the two species share similar profiles as it was determined they share

97% of the analysed DNA in common (Cui et al., 2003). This indicates the limit of

resolution of this technique; that is closely related cultivars cannot be distinguished. RAPD

is also limited by a lack of reproducibility and relatively low resolution.

28

Minimal analysis has been performed on material purchased commercially; most analysis

has been performed on material from known cultivators where the species can be verified.

Miholav et al. (2000) used commercial samples and RAPD to identify the components of

different forms of TCM, they found whether a profile was produced using RAPD analysis

when testing pills or powders was variable. Little research has been done on the use of

RAPD primers to distinguish the components of a mixture.

3.3.6 Sequence Characterised Amplified Region (SCAR)

Sequence Characterised Amplified Region (SCAR) DNA profiling is an extension of the

RAPD profiling technique (Wang et al., 2001; Yau et al., 2002; Zhang et al., 2003). SCAR

involves taking polymorphic bands identified during RAPD analysis and sequencing these

fragments. The RAPD primers are then extended by 10 bases according to the sequence of

the polymorphic band. These new longer primers when used to test the samples produce a

single band for the specific species where the polymorphism was present. SCAR primers

developed in this manner are more specific and reliable then the RAPD primers they are

based on.

SCAR analysis has been used to identify material used in TCM, including Panax species

(Wang et al., 2001). Along with their use on plant material SCAR primers have also been

used on animal material such as seahorses (Zhang et al., 2003) and snakes (Yau et al.,

2002).

29

Table 3. Advantages and disadvantages of DNA profiling techniques. The specific attributes of each method are

described in the text proper.

Technique Low C0t RFLP DNA

sequencing

Microsatellite RAPD SCAR

Description Isolate highly

repetitive DNA

sequences.

Restriction

Enzyme cuts

DNA to produce

fragments of

differing sizes.

Every base in

the DNA

sequence is

determined.

Measures the

number of short

tandem repeats

at a location.

Use small

arbitrary primers

to produce

multiple DNA

fragments.

Extend RAPD

primers based

on polymorphic

fragment

sequences.

Advantage None. Higher

reproducibility

than RAPDs.

Gold Standard

technique.

Can design

primers from

results.

Number of

tandem repeats

is highly

polymorphic.

No prior

knowledge of

DNA sequence

information

required.

Higher

reproducibility

than RAPDs.

Disadvantage Surpassed by

newer

techniques.

High quality

DNA needed.

Cannot

determine

closely related

cultivators.

Expensive and

time consuming

to establish.

Expensive and

time consuming

to establish.

Low

reproducibility.

Cannot

determine

closely related

cultivators.

Limited work

using them.

30

4 Aims and Rationale of Experimental Design

The trade in TCM remains largely unregulated; this leaves consumers vulnerable to the

unscrupulous practices of vendors. DNA profile technology provides the best technique for

the authentication of material used in Traditional Chinese Medicine (TCM). However, the

currently available techniques require further development to meet the increasing need to

be able to identify the material used in TCM.

Little research has been done using commercially retailed plant material. This material is

involved in a range of processing before it is sold and used by the consumer which is likely

to cause DNA degradation and make the extraction of DNA from these samples difficult.

Therefore, whether DNA can be extracted from dried root material sold as TCM needs to

be determined.

With the degradation of DNA in these samples whether the DNA can be amplified using

PCR needs to be determined. As there is little DNA sequence information available for

Panax genus plant material Randomly Amplified Polymorphic DNA (RAPD) analysis

provides a technique that does not require previous knowledge of the samples DNA

sequence in order to profile it.

Panax genus plant species retail for different prices and are used for the treatment of

different ailments. Practices among some TCM vendors include substituting or

adulterating the materials used in TCM. This means it is important to authenticate the

different species independently.

TCM are available in a wide variety of forms for example pills, potions, powders and

liquids. These different forms are difficult to analyse using traditional analytical techniques

but they can be analysed with DNA. Therefore, DNA profiling needs to be performed on

these TCM forms which are likely to have very low levels of DNA.

31

A large amount of the TCMs sold are mixtures, whether they are sold labelled as mixtures

or whether they are substitutions and adulterations of materials. Therefore, DNA primers

need to be developed so different components of a mixture can be determined.

Taking these things into consideration the aims of this research were to:

i. Extract DNA from commercially sold dried plant root material. The

commercially sold as TCM are available in many forms that include whole root

material through to slices, powders, pills, potions, liquids and extractions. The

different forms of TCM are likely to have DNA that is more degraded than that

of the dried whole root material because they have gone through further

processing. Therefore, it is important to ensure that intact DNA can be readily

recovered from these sources so as to be a viable authentication method.

ii. Determine whether DNA extracted from the plant root material can be amplified

using RAPD profiling. The DNA that is extracted from materials used in TCM

is likely to be highly degraded due to the processing that occurs prior to its sale.

The degradation will most likely mean that only small fragments of DNA are

extracted which will be difficult to amplify using PCR.

iii. Further develop the RAPD technology for the authentication of TCM by

applying RAPD primers for the differentiation of Panax species. The value and

use of species within the Panax genus varies from one to another making it

important to be able to distinguish one species from another. Here

commercially sold Panax plant species were DNA profiled yo determine

whether RAPD primers would detect enough polymorphism to distinguish

different plant species.

iv. Apply the primers developed to other forms of TCM. The materials that are

commercially sold as TCM are available in a number of forms that are sold at

varying prices depending on what they claim to contain. TCMs sold as different

32

forms are therefore easier to substitute and adulterate material in. Therefore, the

components within different forms of TCM need to be authenticated.

v. Attempt to distinguish Panax plant species from mixtures. Many TCMs are

sold as mixtures whether this is because the mixture is required for treatment of

an ailment or a vendor maybe adulterating the materials within a sample for

cheaper varieties. Therefore, the ability to distinguish the different components

of a mixture needs to be developed.

33

SECTION 2.1

Differentiation of Ginseng species using Randomly Amplified Polymorphic

DNA (RAPD).

Catherine A. Rinaldi, Guan K. Tay and Ian R. Dadour

This section was submitted to Forensic Science, Medicine and Pathology and is presented

in the form required by the journal. Part of this work was presented orally at the 18th

International Symposium on the Forensic Sciences held by the Australian and New Zealand

Forensic Science Society (Fremantle, Australia, 2007).

34

Abstract

Although the traditional medicine trade is a billion dollar industry, the trade is largely

unregulated with unscrupulous practices among vendors which include adulterating or

omitting ingredients and the use of parts from endangered animals. These practices can be

harmful to the consumers and are illegal. Traditional Chinese Medicines (TCM) have been

used for thousands of years and continue to be widely used, without procedures to monitor

the quality of the materials used. The practices of TCM vendors mean it is important to be

able to authenticate the material used. Traditional methods used to authenticate these

materials include morphological, histological and chemical analysis. However these

techniques are limited by various factors. Research is moving towards the use of DNA

profiling and antibody detection for the authentication of TCM ingredients. One of the

most commonly used herb species are the ginseng varieties which range in quality and price

making them targets of adulteration and omission. Consequently reliable methods must be

developed to distinguish different ginseng varieties. Randomly Amplified Polymorphic

DNA (RAPD) uses small random primers which bind to multiple places on the sample’s

DNA sequence and produce different patterns of DNA fragments for different individuals.

RAPD was selected for use because it requires no knowledge of the samples DNA

sequence. Using a set of RAPD primers, we were able to reproducibly distinguish between

the dried, preserved roots of three different ginseng plant species; Panax ginseng, P.

quinquefolium, P. notoginseng.

35

Introduction

Natural and Traditional medicines are used throughout the world, in China Traditional

Chinese Medicine (TCM) was first recorded in the Chinese Materia Medica 2000 years

ago. Today, the traditional medicine trade is estimated to be worth sixty billion dollars

annually (1). However, the traditional medicine industry is largely unregulated, so

authentication and quality control of herbal materials being traded is lacking. Without

regulation, consumers are vulnerable to unscrupulous practices by vendors; these practices

include the adulteration and substitution of cheap ingredients for more expensive varieties,

the sale of poisonous material and trading in parts from endangered animals. Therefore,

reliable methods need to be developed for the authentication of materials used in TCM.

A variety of techniques have been used to authenticate the ingredients used in TCMs, the

most common techniques are morphological, histological and chemical analysis. However,

each technique has its own limitations and ideally results would be gathered using multiple

techniques and compiled to strengthen the authentication. A limitation of morphological

and histological analysis is that some plant species look similar making differentiation

difficult. TCM materials are not always sold as whole roots; they may be sold in a variety

of forms including slices, pieces, mixtures, powders, potions and pills or tablets these forms

of TCM can not be verified using morphological and histological analysis. Chemical

analysis is limited because the abundance of chemicals in plant roots varies within a species

depending on where it is grown and it is difficult to differentiate between mixtures (2).

DNA profiling has been used to authenticate a variety of herbs used in TCM (3-6). DNA

profiling has become the preferred technique because it requires less sample amount, all

forms of TCM can be tested and DNA profiles are independent of where the herbs are

grown (5).

A variety of DNA profiling techniques have been used to authenticate material used in

TCM; include restriction fragment length polymorphism (RFLP) (7, 8), randomly amplified

36

polymorphic DNA (RAPD) (5, 6, 9, 10), sequence characterized amplified region (SCAR)

(11), DNA sequencing (10, 12) and microsatellites profiling (3). The research literature

needs to be expanded to include different species and forms of TCM. Currently, limited

DNA sequence information is available for TCM ingredients. Therefore, a method of DNA

analysis that does not require DNA sequence information is required.

Randomly Amplified Polymorphic DNA (DNA) has the potential to provide differentiation

of plant species without prior knowledge of the samples DNA sequence (3). RAPD uses a

single small arbitrary primer, which acts as both the forward and reserve primer. The

primer binds at different places along the DNA sequence of different species, creating

profiles that are unique to a particular species. RAPD has been used previously on material

used in TCM (5, 6, 9, 13).

Little research has applied the protocols of RAPD analysis to commercial samples.

Mihalov et al. (2000) (10) tested commercial pill and powder samples with DNA

sequencing and RAPDs. They found that DNA could be profiled from the pills and

powder. However, RAPD analysis produced variable results and more consistent results

were obtained using DNA sequencing for analysis of these forms of TCM.

The species of the Panax plant genus are important ingredients used in TCM. The common

species within the genius are Panax ginseng, P. quinquefolium, and P. notoginseng. Each

species varies in its price and its use. As the roots of P. ginseng and P. quinquefolium have

similar morphology it is easy to substitute and adulterate one species for another. There are

also a number of different herb species, which are substituted for the Panax roots including

Eleutherococcus senticosus, commonly known as Siberian ginseng.

37

Materials and Methods

Acquisition of ginseng root

Labeled dried herb roots were purchased from a number of different stores around Australia

and Singapore, shown in Figure 1. Along with dried root material two liquid samples that

were labeled as containing ginseng were purchased for stores in Perth Western Australia,

see Table 1 for descriptions of the samples.

Figure 1. A sample of the variety of ginseng products that are commercially available.

Preparation of Samples

Before DNA extraction was preformed some sample preparation was required. All dried

samples were washed with sterile water to remove contaminates, and then they were dried

before the peel of the sample was removed and ground into a fine powder. The peel was

used because in plants the inner cortex is low in DNA containing cells and full of

polysaccharides, which are PCR inhibitors (14). Extractions were preformed on 1mL

aliquots of the liquid samples.

38

DNA Extraction

Phenol Chloroform extraction of the material was performed as follows, 25mg of material

was placed into 500µl of cell lysis buffer (500mM NaCl, 100mM Tris-HCl and 50mM

EDTA) with 50µl 20% SDS and 10µl of Proteinase K and then incubated at 65oC for an

hour. The sample was then extracted twice with an equal volume of

Phenol:Chloroform:Isoamyl alcohol. The supernatant was collected and 500µl of

Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The supernatant was

collected and double volume of 100% ethanol was added and incubated at -20 o

C for 30

minutes. Samples were centrifuged at 13,200rpm for 10 minutes and the supernatant was

removed and the pellet was washed with 70% ethanol. Then the pellet was resuspended in

100µl of TE.

After extraction the concentration of DNA and purity of the samples was determined using

a Nanodrop® ND-1000 spectrophotometer measuring the light absorbance at 230nm.

Primers

The primers that were used had previously been used to differentiate different herb species.

Primer3, 5’-GTGTGCGATCAGTTGCTGGG-3’ (Geneworks, Australia), had been used to

distinguish Pinallia ternate species (15). DALP1.7F3, 5’-

GCGTCCCACTGACCCTTTTGTACA-3’ (Geneworks, Australia), was used to

differentiate P. ginseng and P. quinquefolium (16).

PCR

The PCR was set up to a total volume of 20µl, with 100ng of sample DNA, 1 Unit of Taq

(Fisher Biotec, Australia), 2µl of 10XPCR buffer (Fisher Biotec, Australia), 1µl of 5%

BSA, 2µl of 200 picomole primer and 200µM dNTP. For each primer the MgCl2

concentration was different; 3.2µl for Primer3 and 3.6µl for DALP1.7F3.

39

Table 1. Descriptions of the commercial samples from different sources tested by RAPD-

PCR

Sample Number Description Species

1 Dried root purchased in Perth Panax ginseng (Chinese)

2 Dried root purchased in Singapore Panax ginsneg (Chinese)

3 Dried root purchased in Singapore Panax quinquefolium

(American)

4 Dried root purchased in Perth Panax notoginseng

5 Dried root purchased in Perth Panax ginseng (Korean)

6 Dried root purchased in Brisbane Eleutherococcus

senticosus (Siberian)

7 Liquid extractum purchased in Perth Panax ginseng

8 Liquid drink, containing a whole

ginseng root purchased in Perth

Panax ginseng (Korean)

40

The PCR protocol was 15 minutes at 95 o

C, 35 cycles of 30s at 95 o

C, 60s at 45 o

C and 90s

at 72 o

C with a final extension at 72 o

C for an hour. The results of the PCR were run on 2%

agarose gel containing Ethidium Bromide at 120 volts for an hour. Then the gels were

visualized on an Ultraviolet light box.

41

Results

Extraction of DNA

Plant material used in TCM is dried then stored for extended periods of time after

harvesting and before use by the consumer. These conditions are not ideal for the

preservation of DNA. DNA was extracted from all samples, including liquid samples,

using the Phenol:Chloroform extraction protocol. However, the DNA was degraded as

shown in Figure 2, which shows extracted DNA run on an agarose gel and is highly

smeared.

Figure 2. An agarose gel of the DNA extracted from samples. Lane 1) Marker: 100bp

DNA ladder (Geneworks, Australia), 2) Panax ginseng,

3) P. quinquefolium , 5) P. notoginseng, 6) Eleutherococcus senticosus.

1 2 3 4 5 6

100bp

200bp

400bp

500bp

1000bp

42

PCR of Samples

Obtaining DNA during extraction does not ensure PCR amplification as there maybe co-

extraction of inhibitors or the sample DNA may be too degraded. The DNA extracted from

the sample while degraded was still amplifiable. Figure 3 shows the profiles of three

different Panax species using two different RAPD primers.

1000bp

1 2 3 4 5 6 7

1 2 3 4 5 6 7

A

100bp

200bp

300bp

400bp

500bp

1000bp

610bp

300bp

210bp

400bp

230bp

43

Figure 3. Representative gels of the profiles obtained using the different primers.

A) Primer3 and B) Primer DALP1.7F3. Lane 1) Marker: 100bp DNA ladder

(Geneworks, Australia), 2) Positive control, 3) P. ginseng,

4) P. ginseng, 5) P. quinquefolium, 6) P. Notoginseng and 7) Negative Control.

Black arrows indicate fragments shared between the different samples and

white arrows indicate polymorphic bands.

1 2 3 4 5 6 7

B

100bp

200bp

300bp

400bp 500bp

1000bp

600bp

370bp

290bp

190bp

150bp

44

Two P. ginseng samples were acquired from different countries produced the same DNA

profile demonstrating that the primers are consistent for each species. The gels show that

the three different Panax species can be distinguished based on a number of different

polymorphic bands present in one species but not the others.

Profiles of the liquid samples are shown in Figure 4. The gel shows that DNA could be

extracted and amplified using the RAPD primer from liquid samples containing ginseng.

However, the profiles were different to the control profile and whether the DNA was

amplified was variable.

Profiles of P. ginseng (Korean) and Eleutherococcus senticosus are included in Figure 4.

This RAPD primer cannot distinguish where the samples were grown, as the Chinese P.

ginseng and Korean P. ginseng produced the same profiles. The Eleutherococcus

senticosus had a different profile to the plants from the Panax genus.

45

Figure 4. Profiles obtained from aliquots of liquid and dried root samples after

amplification using primer DALP1.7F3. Lane 1) Marker: 100bp DNA ladder

(Geneworks, Australia), 2) Negative control, 3) P. ginseng (Chinese),

4) P. ginseng (Korean), 5) Eleutherococcus senticosus, 6) Liquid ginseng drink,

7) P. ginseng extractum. Black arrows indicate fragments shared between the

different samples and white arrows indicate polymorphic bands.

1 2 3 4 5 6 7

100bp

200bp

300bp

400bp

500bp

1000bp

600bp

290bp

190bp

240bp

46

Discussion

DNA can be extracted from samples of dried plant root material used in TCM, even though

the samples have undergone drying and have been stored for an unknown length of time

before analysis. DNA was also extracted from liquid samples advertised as containing

ginseng.

RAPD profiling provides a valuable tool for the differentiation of different plant species

used in TCM (17). Specifically, RAPD can be used to distinguish Panax species from each

other and to distinguish their adulterates. However, the resolution of RAPD analysis is

limited and cannot distinguish where plants are grown. Demonstrated by Chinese P.

ginseng and Korean P. ginseng, which are both of the P. ginseng species, but grown in

different countries having the same profiles. The ability to distinguish the cultivator or

where a sample is grown is an important step in the authentication of material used in TCM

because Korean P. ginseng retails for significantly more than Chinese P. ginseng. So, it is

important to be able to distinguish where the plant is grown, which is not possible using

these primers.

DNA profiling can be applied to any form of TCM including commercial liquid samples.

Mahlov et al (2000) (11) profiled commercial pill and powder TCMs and showed that DNA

can be successfully obtained from these materials. However, they found that the RAPD

proved unreliable with the production of profiles for the pills and powders. The same was

found here where the profiles of the liquid samples were different to the samples of ginseng

and whether amplification of the liquid occurred was variable.

While this research is important in showing that RAPD profiling can be applied to

commercial samples of TCM, the primers need to be applied to vouchered species samples.

This would allow for the production of a library of profiles of Panax plant species to aid in

the authentication of these materials that are used in TCM.

Randomly Amplified Polymorhpic DNA (RAPD) analysis provides a starting point for the

authentication of materials used in TCM. Although other methods with greater resolution

47

of plant origin need to be developed and tested with more herb species and applied to other

materials that are used in TCM.

Acknowledgements

We thank Angelina Lim for the supply of samples from Singapore and comments on the

manuscript. Also thanks to Dr. Michelle Harvey for PCR technical troubleshooting.

Funding for the research was provided by the Centre for Forensic Science, University of

Western Australia.

References

1. World Health Organisation http://www.who.int/mediacentre/factsheets/fs134/en/.

2. Chan, T.W.D., et al. (2000), Anal Chem 72(6), 1281-1287.

3. Hon, C.C., et al. (2003), Acta. Pharmacol. Sin. 24(9), 841-846.

4. Mathur, A., et al. (2003), Genetic Resources & Crop Evolution 50(3), 245-252.

5. Shaw, P.C. and But, P.P. (1995), Planta Med 61(5), 466-469.

6. Tanaka, H., Fukuda, N. and Shoyama, Y. (2006), Phytochem. Anal. 17(1), 46-55.

7. Fushimi, H., et al. (1997), Biol. Pharm. Bull. 20(7), 765-769.

8. Ngan, F., et al. (1999), Phytochemistry 50(5), 787-791.

9. Boehm, C.L., et al. (1999), J. Amer. Soc. Hort. Sci. 124(3), 252-256.

10. Mihalov, J.J., Marderosian, A.D. and Pierce, J.C. (2000), J Agric Food Chem 48(8),

3744-3752.

11. Wang, J., et al. (2001), Planta Med 67(8), 781-783.

12. Kim, K.S., et al. (1991), Plant Physiol. 97(4), 1602-1603.

13. Cui, X.M., et al. (2003), Planta Med. 69(6), 584-586.

14. Chiou, F.S., et al. (2001), J. For. Sci. 46(5), 1174-1179.

15. Chung, H.S., et al. (2002), Hereditas 136(2), 126-129.

16. Ha, W.Y., et al. (2001), Planta Med. 67(6), 587-589.

17. Nebauer, S.G., del Castillo-Agudo, L. and Segura, J. (2000), Theor. & Appl. Gene.

100(8), 1209-1216.

48

SECTION 2.2

Identification of Panax plant species within mixtures using a Randomly

Amplified Polymorphic DNA (RAPD) method.

Catherine Rinaldi, Ian Dadour and Guan Tay

This section was submitted to Planta Medica and is presented in the form required by the

journal.

49

Abstract

The Traditional Chinese Medicine (TCM) trade is a global industry that remains largely

unregulated in part due to the lack of available methods for the identification of material

used in TCM. Much of the material commercially available as TCM is sold as mixtures

whether the treatment of an ailment requires a cocktail of material or the vendor is

substituting or adulterating material they are selling with cheaper varieties. Randomly

Amplified Polymorphic DNA (RAPD) analysis is a DNA-based method that requires no

previous knowledge of the DNA sequence of the material being analysed. Here results are

presented for the use of RAPD primers to identify whether DNA profiles created could be

used to identify the components of a mixture. The RAPD primers used could not

distinguish closely related Panax genus plant material within a mixture.

50

Introduction

Traditional Chinese Medicines (TCMs) are widely used throughout the world. A large

range of the products sold as TCMs are mixtures of multiple components including parts of

plants and animals. Mixtures are used because combinations of materials are more

effective for treatment and provide better results for the consumer (1). Mixtures are also

used in TCMs because when ingredients are mixed together some property of one

component can be negated by the other. For example, poisonous material maybe required

to treat an ailment, but consuming poisonous material on its own is toxic. So it maybe

mixed with other material, which neutralises the poison.

The ability to identify the components of mixtures is required because practices among

TCM vendors include substituting or adulterating expensive TCM materials for cheaper

varieties. This means that material claimed to be composed of a single species may in fact

be a mixture of multiple different species. Therefore, it is essential that techniques are

developed to dissect out the components of a mixture.

DNA profiling has been used to authenticate a variety of herbs used in TCM (2-5). DNA

profiling has become the preferred technique for authenticating material because it requires

less sample amount. Further unlike chemical based methods, all forms of TCM can be

tested and DNA profiles are independent of where the herbs are grown (4). Unlike

chemical profiling, which is dependant on the location a particular crop is grown (6, 7).

Since DNA methods are species specific, it is the ideal technique to develop for

distinguishing materials found in mixtures.

A variety of DNA profiling techniques have been used to authenticate material used in

TCM; including restriction fragment length polymorphism (RFLP) (8, 9), randomly

amplified polymorphic DNA (RAPD) (4, 5, 10, 11), sequence characterised amplified

region (SCAR) (12), DNA sequencing (11, 13) and microsatellite profiling (2). Continued

research needs to expand to include different species and forms of TCM including testing

methods to distinguish material in mixtures. With the thousands of different materials used

51

in TCM the sheer number mean there is limited DNA sequence information available for

TCM ingredients, which makes it difficult to design primers for a number of the DNA

profiling techniques named above. Therefore, methods of DNA analysis not requiring

DNA sequence information need to be investigated.

Randomly Amplified Polymorphic DNA (DNA) has the potential to provide differentiation

of plant species without prior knowledge of the samples DNA sequence (2). RAPD

analysis uses a single small arbitrary primer, which acts as both the forward and reserve

primer. The primer binds at different places along the DNA sequence of different species,

creating profiles unique to a particular species. RAPD has been used previously to

distinguish a range of other plants used in TCM including Panax species (4, 5, 10, 14),

Radix Astragali (Milk-vetch) (15), Radix Angelica (Dang-gui) (16) and Crocus sativus

(Saffron Crocus) (17).

Limited studies have been performed using DNA profiling to authenticate materials found

in mixtures of more than one Panax plant species or mixtures of any kind used in TCM.

Wetton et al. (2002) (18) successfully used DNA profiling to determine whether tiger DNA

could be identified from samples of TCMs spiked with tiger bone, however this is the

extent of studies found to date.

In this study, we set out to determine whether Randomly Amplified Polymorphic DNA

(RAPD) techniques could be used to distinguish the components of mixtures. Our studies

concentrated on the differentiation of more than one Panax species plant material from

each other and unrelated plant species.

52

Materials and Methods

Acquisition of Panax roots

Labeled dried herb roots were purchased from a number of different retailers around

Australia and Singapore. The samples that were purchased were dried root material of

Panax ginseng, Panax quinquefolium and Panax nototginseng.

The mixtures analysed here were produced artificially, that is they were produced by

mixing the extracted DNA of the two samples during PCR set up. Mixtures were made of

diifferent Panax species and P. ginseng mixed with a positive control. When the mixing of

the samples occurred prior to DNA extraction, 25mg of each ground sample was mixed

together before adding the cell lysis buffer.

Preparation of Samples

Prior to DNA extraction, some sample preparation was required. All dried samples were

washed with sterile water to remove contaminants then dried on a heat block before being

peeled. The peel was then ground into a fine powder. The peel was used because in plants

the inner cortex is low in DNA containing cells and full of polysaccharides, which are PCR

inhibitors (19).

DNA Extraction

Phenol Chloroform extraction of the material was performed as follows. Ground material

was placed into 500µl of cell lysis buffer (500mM NaCl, 100mM Tris-HCl and 50mM

EDTA) with 50µl 20% SDS and 10µl of Proteinase K and then incubated at 65oC for an

hour. The sample was then extracted twice with an equal volume of

Phenol:Chloroform:Isoamyl (25:24:1) alcohol. The supernatant was collected and 500µl of

Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The supernatant was

collected and a double volume of 100% ethanol was added and incubated at -20oC for 30

minutes. Samples were centrifuged at 13,200rpm for 10 minutes and the supernatant was

53

removed and the pellet washed with 70% ethanol. The pellet was then resuspended in

100µl of TE, pH .

After extraction the concentration of DNA and purity of the samples was determined using

a Nanodrop® ND-1000 spectrophotometer measuring (Biolab, Australia) the light

absorbance at 230nm.

Primers

The primers used here were selected from the research literature because they had

previously been used to authenticate different plant materials used in TCM. When using

RAPD analysis the selection of the primers is not an issue as the short nature of the primers

mean that they should amplify any sample. CHUN3, 5’-GTGTGCGATCAGTTGCTGGG-

3’ (Geneworks, Australia), had been used to distinguish Pinellia ternate species (20).

DALP1.7F3, 5’-GCGTCCCACTGACCCTTTTGTACA-3’ (Geneworks, Australia), was

used to differentiate P. ginseng and P. quinquefolium (21).

PCR Analysis

The PCR was set up to a total volume of 20µl with 1 unit of Taq (Fisher Biotec, Australia),

2µl of 10XPCR buffer (Fisher Biotec, Australia), 1µl of 5% BSA, 2µl of 200 picomole

primer and 200µM dNTP. For each primer, the MgCl2 concentration was different; 4mM

for CHUN3 and 4.5mM for DALP1.7F3. When mixing the samples after extraction, equal

amounts of extracted DNA (100ng) were added to a single PCR tube.

The PCR protocol was 15 minutes at 95 o

C followed by 35 cycles of 30s at 95 o

C, 60s at 45

oC and 90s at 72

oC with a final extension at 72

oC for an hour. PCR was performed in a

GeneAmp® PCR System 2700 (Applied Biosystems, Australia). The results of the PCR

were run on 2% agarose gel containing Ethidium Bromide at 120 volts for an hour. Gels

were visualized on an Ultraviolet light box and photographed.

54

Results

Mixtures of Panax ginseng and Potato

Panax ginseng was mixed with the positive control potato samples to determine whether

RAPD analysis using these primers could differentiate P. ginseng and an unrelated DNA

sample. Figure 1 shows the results of mixing potato and P. ginseng.

Figure 1 shows that when the DNA extracts of potato and Panax ginseng were mixed the

resulting profile created by the RAPD primers was a combination of the profiles of potato

and P. ginseng. The profiles provide enough polymorphic bands so that the P. ginseng

could be distinguished. When the amount of DNA of one of the components of the mixture

was greater than that of the other the profile of the mixture was the material present in the

greatest amount only.

55

Figure 1. A representative profile of mixtures of potato and Panax ginseng

using the primer CHUN3. Lane 1) 100 base pair DNA ladder.

2) Potato. 3) Potato and P. ginseng. 4) P. ginseng. 5) Negative Control.

The black arrows indicate bands that are present in the P. ginseng and

mixture sample and the white arrows indicate bands that are in the

potato and mixture samples.

100bp

200bp

300bp

400bp

500bp

1000bp

1 2 3 4 5

600bp

450bp

2400bp

260bp

670bp

490bp

56

Mixtures of Panax species

Mixtures of Panax genus plant species were made by mixing extracted DNA prior to PCR.

Mixtures were made of the P. ginseng with P. quinquefolium, P. ginseng with P.

notoginseng and P. quinquefolium with P. notoginseng. The results of the mixing of the

extracted DNA together at the time of PCR are shown in Figure 2.

Figure 2 shows that the primers are not able to distinguish the different Panax species in

each of the mixtures. For example, while using primer DALP1.7P3 P. notoginseng and P.

quinquefolium can be distinguished from each other individually however, when mixed the

profile that results is that of the P. quinquefolium (Figure 2B, lane 7).

A

1 2 3 4 5 6 7 8

100bp

200bp

300bp

400bp

500bp

1000bp

610bp

400bp

110bp

290bp

210bp

300bp

57

Figure 2. RAPD profiles produced when mixing different Panax plant species

together after DNA had been extracted individually. A. CHUN3.

B. Primer DALP1.7F3. Lane 1) 100 base pair ladder. 2) P. ginseng.

3) P. quinquefolium. 4) P. notoginseng. 5) P. ginseng and

P. quinquefolium. 6) P. ginseng and P. notoginseng. 7) P. notoginseng

and P. quinquefolium. 8) Negative Control. The arrows on the right side

of the gel indicate the sizes of the fragments.

B

100bp

200bp

300bp

400bp

500bp

1000bp

1 2 3 4 5 6 7 8

600bp

380bp

250bp

220bp

170bp

150bp

100bp

58

Discussion

The ability to identify the components that make up mixtures is critical when analyzing

material used in TCM for a number of reasons. Firstly, many of the products sold as TCM

are mixtures. Secondly, a practice among TCM vendors is to substitute or adulterate the

material they are selling with cheaper materials.

The RAPD primers used here could be used to distinguish Panax ginseng when mixed with

a genetically unrelated potato sample. This ability to distinguish the P. ginseng from the

potato is based on the polymorphic bands which can be used to distinguish the two samples

all being present in the profile of the mixture of the two samples. However, using these

primers the P. ginseng could not be identified in a mixture of potato and P. ginseng when

the potato was present in a greater than one to one ratio, then only the potato profile was

present.

The RAPD primers used here also do not provide enough discriminatory ability to identify

the individual Panax species in a mixture of multiple Panax species. That means that while

the different Panax species can be distinguished from each other individually the profiles

produced when the samples were mixed resulted in the amplification of only one of the

samples. This is because the primers do not produce many discriminating bands, which

while they discriminate species from each other when in a mixture one of the profiles

dominates.

RAPD primers provide a starting point for DNA analysis of material that is used in TCM

because the small arbitrary primers require no previous information of the DNA sequence

be known before DNA profiling begins. The results found here show that the

discriminatory power of the primers tested was not high enough to be able to distinguish

components of a mixture of closely related plant species used in TCM. There needs to be

the development of other techniques that measure smaller DNA polymorphisms such as

59

DNA sequencing to identify Single Nucleotide Polymorphisms (SNPs) which maybe able

to distinguish the components of a mixture based on differences in only a few nucleotides.

Acknowledgements

Funding for this project was supplied by the Centre for Forensic Science at the University

of Western Australia. We would also like to thank Rebecca Ford and Yvette Hitchens for

their review and comments on this paper.

References

1. Guili, Z. and Chengbo, Z., Concise Chinese Materia Medica, Shandong Science and

Technology Press, Jinan, China, 1997.

2. Hon CC, Chow YC, Zeng FY, Leung FC. Genetic authentication of ginseng and

other traditional Chinese medicine. Acta. Pharmacol. Sin. 2003;24(9):841-846.

3. Mathur A, Mathur AK, Sangwan RS, Gangwar A, Uniyal GC. Differential

morphogenetic responses, ginsenoside metabolism and RAPD patterns of three

Panax species. Genetic Resources & Crop Evolution 2003;50(3):245-252.

4. Shaw PC, But PP. Authentication of Panax species and their adulterants by random-

primed polymerase chain reaction. Planta Med 1995;61(5):466-469.

5. Tanaka H, Fukuda N, Shoyama Y. Identification and differentiation of panox

species using ELISA, RAPD and eastern blotting. Phytochem. Anal. 2006;17(1):46-

55.

6. Dong TTX, Ma XQ, Clarke C, Song ZH, Ji ZN, Lo CK, et al. Phylogeny of

Astragalus in China: Molecular evidence from the DNA sequences of 5S rRNA

spacer, ITS, and 18S rRNA. Journal of Agricultural & Food Chemistry

2003;51(23):6709-6714.

7. Lao SC, Li SP, Kan KKW, Li P, Wan JB, Wang YT, et al. Identification and

quantification of 13 components in Angelica sinensis (Danggui) by gas

chromatography–mass spectrometry coupled with

pressurized liquid extraction. Analytica Chimica Acta 2004;526:131-137.

60

8. Fushimi H, Komatsu K, Isobe M, Namba T. Application of PCR-RFLP and MASA

analyses on 18S ribosomal RNA gene sequence for the identification of three

Ginseng drugs. Biol. Pharm. Bull. 1997;20(7):765-769.

9. Ngan F, Shaw P, But P, Wang J. Molecular authentication of Panax species.

Phytochemistry 1999;50(5):787-791.

10. Boehm CL, Harrison HC, Jung G, Nienhuis J. Organization of American and Asian

ginseng germplasm using randomly amplified polymorphic DNA (RAPD) markers.

J. Amer. Soc. Hort. Sci. 1999;124(3):252-256.

11. Mihalov JJ, Marderosian AD, Pierce JC. DNA identification of commercial ginseng

samples. J Agric Food Chem 2000;48(8):3744-3752.

12. Wang J, Ha WY, Ngan FN, But PP, Shaw PC. Application of sequence

characterized amplified region (SCAR) analysis to authenticate Panax species and

their adulterants. Planta Med 2001;67(8):781-783.

13. Kim KS, Schuster W, Brennicke A, Choi KT. Korean ginseng mitochondrial DNA

encodes an intact rps12 gene downstream of the nad3 gene. Plant Physiol.

1991;97(4):1602-1603.

14. Cui XM, Lo CK, Yip KL, Dong TTX, Tsim KWK. Authentication of Panax

notoginseng by 5S-rRNA spacer domain and random amplified polymorphic DNA

(RAPD) analysis. Planta Med. 2003;69(6):584-586.

15. Ma XQ, Duan JA, Zhu DY, Dong TT, Tsim KW. Species identification of Radix

Astragali (Huangqi) by DNA sequence of its 5S-rRNA spacer domain.

Phytochemistry 2000;54(4):363-8.

16. Zhao KJ, Dong TT, Tu PF, Song ZH, Lo CK, Tsim KW. Molecular genetic and

chemical assessment of radix Angelica (Danggui) in China. J Agric Food Chem

2003;51(9):2576-83.

17. Ma XQ, Zhu DY, Li SP, Dong TTX, Tsim KWK. Authentic identification of

Stigma Croci (stigma of Crocus sativus) from its adulterants by molecular genetic

analysis. Planta Medica 2001;67(2):183-186.

18. Wetton JH, Tsang CSF, Roney CA, Spriggs AC. An extremely sensitive species-

specific ARMS PCR test for the presence of tiger bone DNA. Forensic Science

International 2002;126(2):137-144.

61

19. Chiou FS, Pai CY, Hsu YPP, Tsai CW, Yang CH. Extraction of human DNA for

PCR from chewed residues of betel quid using a novel "PVP/CTAB" method. J.

For. Sci. 2001;46(5):1174-1179.

20. Chung HS, Um JY, Kim MS, Hong SH, Kim SM, Kim HK, et al. Determination of

the site of origin of Pinellia ternata roots based on RAPD analysis and PCR-RFLP.

Hereditas 2002;136(2):126-129.

21. Ha WY, Yau FC, But PP, Wang J, Shaw PC. Direct amplification of length

polymorphism analysis differentiates Panax ginseng from P. quinquefolius. Planta

Med. 2001;67(6):587-589.

62

SECTION 3

GENERAL DISCUSSION AND CONCLUSIONS

A

63

Traditional and natural medicines have been used by many cultures throughout the world

for thousands of years. Plant and animal materials are widely used as stand alone remedies

or as mixtures of agents with synergistic properties. In China Traditional Chinese Medicine

(TCM) was first recorded 2,000 years ago (Hon et al., 2003).

The trade in traditional medicines is estimates by the World Health Organisation to be

worth over US$60 billion dollars annually (World Health Organisation, 2003). Although

this trade attracts billions of dollars annually, it is not well regulated, leaving consumers

open to unscrupulous practices of some vendors. These practices include substitution and

adulterant of expensive material with cheaper varieties, sale of poisonous material and

trading in endangered animal parts. Therefore, techniques need to be developed to identify

the materials used in traditional and natural medicines.

Currently available techniques used to identify materials used in TCMs have several

disadvantages (for a review of the advantages and disadvantages of each method see Table

1 of the Introduction section to this thesis). Traditionally, plant material has been identified

by morphological, histological, chemical and immunological methods. More recently, with

the development of the Polymerase Chain Reaction (PCR), DNA profiling has become a

valuable tool for the identification of biological material. Applying DNA profiling

techniques to differentiating plant and animal material is a common practice. PCR-based

DNA profiling has been used to differentiate genetically modified crops from un-modified

material (Leimanis et al., 2006; Lee et al., 2006). Plant varieties have also been

differentiated by these technologies. DNA technology has been used to profile meats,

small-goods as well as canned meat to validate the labels and source of meats (Calvo et al.,

2002; Saez et al., 2004).

Hence, DNA-based techniques can be readily used on TCM. DNA profiling is

advantageous over traditional techniques because it requires a small sample amount, it can

be used on all forms of TCM and could potentially distinguish the components of mixtures.

Even with the development of new techniques it is still best practice to apply multiple

techniques to the sample for a thorough authentication of the material.

64

There are a range of DNA based techniques, many of which require some knowledge of the

DNA sequence of the sample material. Due to the variety of plant species used in the TCM

trade and the fact that sequences are not readily available for much of the plant material

used, techniques not requiring sequence information need to be used. The DNA profiling

technique Randomly Amplified Polymorphic DNA (RAPD) analysis requires no previous

knowledge of a samples DNA sequence. Therefore, it provides a fast and inexpensive

DNA based technique that can easily be applied to material used in TCM where limited

DNA sequence information is available. With that in mind, whether using RAPD primers

to distinguish Panax genus plant species is reliable was investigated.

Commercially sold TCM samples undergo processing before being sold; processing

techniques include drying, grinding, boiling and extracting into liquid form. Therefore,

DNA in these samples is likely to be highly degraded and very fragmented, which may

make it difficult to amplify extracted DNA. Here DNA was extracted from dried root

samples using an organic Phenol:Chlororform protocol, which extracted high levels of high

quality DNA. This DNA was of high enough quality that it could be amplified using

RAPD analysis.

The first manuscript presented in this thesis showed that the RAPD primers used here could

amplify the DNA extracted from dried root material. The primers were selected from the

research literature for their previous use on plant material. The profiles produced by these

primers were different for three Panax species and one sample commonly referred to as a

ginseng, Eleutherococcus senticosus. The profiles showed a number of polymorphic bands

which could be used to distinguish each different species.

These primers could distinguish the samples labeled as P. ginseng (Chinese ginseng), P.

quiquefolium (American ginseng), P. notoginseng and Eleutherococcus senticosus

(Siberian ginseng). This is consistent with other research where RAPD analysis was used

to distinguish different plant species (Shaw & But, 1995; Tanaka et al., 2006; Boehm, et al.,

1999; Mihalov et al., 2000). It is also consistent with RAPD primers having been used

65

specifically to distinguish Panax genus plants (Shaw & But, 1995; Cui et al, 2003; Boehm,

et al., 1999).

Three samples of P. ginseng purchased from two different countries were analysed. Two

samples were sold as Chinese ginseng, the other was sold as Korean ginseng. Each of the

P. ginseng samples was found to produce the same DNA profile. While this demonstrates

that the RAPD primers produce reliable profiles for a species it means that either the

primers did not produce enough polymorphism to distinguish the origin of the sample or

the sample was being sold as Korean ginseng but was in fact Chinese ginseng. It is most

likely that the RAPD primers being used here do not provide enough polymorphism to

distinguish cultivators so they are not an option for use when the cultivator of the samples

needs to be determined.

Korean ginseng (P. ginseng) is grown in Korea and retails at a higher market value than

both American (P. quiquefolium) and Chinese ginseng (P. ginseng); therefore it is

important to be able to distinguish the location where a plant is grown. The same is true of

trying to distinguish wild and cultivated plants. As the profiles of the Korean and Chinese

ginseng were the same with these primers, these primers do not produce enough

polymorphism for the determination of cultivators.

It maybe possible to use different primers that are more sensitive to small differences in the

DNA sequences of the samples. This may mean the use of Short Tandem Repeats (STRs)

where the number of tandem repeats varies depending on where the sample is grown. Hon

et al. (2003) found allelic differences between American ginsengs grown on different farms

using STRs. A likely technique to determine closely related cultivators is using Single

Nucleotide Polymorphisms (SNPs), where differences in single nucleotides are examined.

Materials sold as TCMs are available in a variety of forms, from whole roots through to

slices, powders, pills, tablets, extracts and liquids. These materials are likely to contain

little, if any, DNA of high enough quality that can be amplified by PCR. Analysis of two

different liquid samples, one a ginseng drink and the other an extractum, showed variable

66

amplification of the extracted DNA. That is, there was no reproducible and reliable

amplification of DNA extracted from these liquid samples.

The reason for the lack of reproducibility is likely to be the degraded nature of the DNA in

the sample. Degradation most probably occurred due to processing of the samples into a

liquid form and results in low amounts of DNA present in the sample. It is also possible

that more PCR inhibitors were co-extracted from the liquid samples than the dried root

material; this is indicated because the extractions were brown coloured. Dark coloured

extractions indicate the co-extraction of contaminants (Fu et al., 1998). The lack of

reproducibility when analysing liquids is a similar result to that found by Mihalov et al.

(2000). Mihalov et al. (2000) found that DNA sequencing provide better results for

analysing samples of liquids than RAPD analysis, which was unreliable.

The second manuscript presents results of mixing samples together and amplifying them

with the RAPD primers. First, DNA from P. ginseng was mixed with potato positive

control DNA to determine whether there was enough polymorphism between the profiles to

distinguish both samples in the mixture and whether there was any preferential

amplification of one sample over another. The results of this analysis were that both

profiles could be distinguished in the mixture profile. The unique bands that differentiated

each of the two samples were all present in the profile of the mixture when the samples

were mixed in equal concentrations. When the samples were not mixed in equal

concentrations there was only the profile of the sample present in higher amounts.

The profiles of mixtures of more than one Panax species plant were also generated. The

profiles resulting from mixtures were the same as one of the samples. This is because the

RAPD primers used did not provide enough polymorphic bands to distinguish the different

species. For example, in a mixture of P. notoginseng and P. quinquefolium when using

these primers only the profile of P. quiquefolium was visible. This means that these RAPD

primers cannot be used to differentiate the different Panax species when mixed together.

67

As with profiling of liquids it would probably be best if DNA profiling of the mixture

samples was done with other techniques. For example, Wetton et al. (2003) DNA

sequenced bone, hair and TCM samples spiked with tiger bone and found that they could

detect the tiger DNA profile in the mixtures. So, the development of techniques that

identify smaller polymorphisms is important.

A limitation of the research performed here is that the samples used were not verified

specimens but commercial products. While limited research has been done using

commercial samples, using exemplar specimens, which are known to be a certain species,

enables libraries to be created of the profiles of different material used in traditional

medicines. These libraries can then be used as databases for the comparison of profiles of

unknown samples. This would be a similar idea to currently available forensic DNA

database such as CODIS in the United States of American or CrimTrac in Australia.

Further research is also needed to extend the range of samples investigated that can be

included in libraries of DNA profiles.

Another limitation is that an untested plant or other material may give the same profile as

the plant species tested here using these primers. That is, P. ginseng may have the same

profile as a species not examined here. For example, P. ginseng may have the same profile

as tiger because the fragments are only measured based on size not internal sequence. So, a

sample with a different sequence could conceivably produce the same sized bands when

analysed using RAPD primers. While it is most likely that it will be a related species that

produces the same profile and the three tested here did not it is possible that one of the

other Panax species may. The reason for this is that the RAPD analytical technique is

designed so that, any sample could work with any primer so continued testing of different

samples using these primers needs to be carried out.

There is a large amount of future research that evolves from the results of this research.

Further research needs to be performed that will increase the discriminatory power for the

DNA analysis performed on materials used in TCMs. One possible method is to extend the

RAPD primers used here to create new Sequence Characterised Amplified Region (SCAR)

68

primers. To produce SCAR primers polymorphic bands created by the RAPD analysis are

sequenced and the RAPD primers are extended by a number of bases based on the

sequencing analysis results (Wang et al., 2001; Zhang et al., 2003; Yau et al., 2002).

SCAR primers are more reliable and discriminatory than RAPD primers because the

primers only amplify the single polymorphic band in the sample it was present in.

A possibility for further research is to investigate the use of antibodies to authenticate

materials used in TCMs. Antibodies could target antigens on the plant cell surface and not

chemical compounds produced by the cells. Targeting the plant cells will make the

procedure more reliable when trying to distinguish closely related plant species. Using

chemical composition of plants is problematic because the chemical composition varies

depending on several environmental factors (Dong et al., 2003; Lao et al., 2004).

Antibodies provide the possibility of creating field tests, such as a test based on the

principle of a pregnancy test where the combination of the antibody and antigen produce a

visible band on the testing medium.

DNA profiling could as be used to create “lab-on-a-chip” microarrays so that samples can

be analysed in the field. As per the “lab-on-a-chip” DNA microarrays used to differentiate

Panax genus plants (Carles et al., 2001). These microarrays it could be used by the police

as a presumptive field test. Any field test could also potentially be marketed to consumers

so that when they are about to buy some material they can test it and to ensure they are

getting what they paid for.

In conclusion, RAPD analysis provides a quick and inexpensive DNA based technique that

can be used to differentiate different plant species. The primers tested here were able to

distinguish Panax genus plants and two unrelated components in a mixture. It is therefore

important that further DNA techniques be developed either by extending on RAPD primers

such as those used here or by DNA sequencing to identify different polymorphisms.

69

Summary of Conclusions

The results of this research show that Randomly Amplified Polymorphic DNA (RAPD)

analysis provides a quick, cost effective and easy to use method for differentiating material

used in TCM without prior knowledge of the samples DNA sequence. The specific

conclusions that can be drawn from the results are:

i. DNA can be extracted from a variety of different commercially sold TCM,

including dried root material, drink and liquid extractums.

ii. The DNA extracted from this material can be amplified using RAPD primers.

iii. The RAPD primers used here can distinguish a number of different Panax genus

plant species from each other and genetically unrelated plant material.

iv. Amplifying DNA extracted from liquid samples using these RAPD primers is

unreliable and results are variable.

v. The RAPD primers used here do not provide enough polymorphic bands to be able

to distinguish the make up of mixtures containing two Panax species plants.

70

BIBILOGRAPHY

Assinewe, V. A., Baum, B. R., Gagnon, D. & Arnason, J. T. (2003), 'Phytochemistry of

Wild Populations of Panax quinquefolius L. (North American Ginseng)', Journal of

Agricultural & Food Chemistry, 51, pp. 4549-4553.

Barnes, S. & Prasain, J. (2005), 'Current progress in the use of traditional medicines and

nutraceuticals', Current Opinion in Plant Biology, 8, pp. 1-5.

Benecke, M. (1998), 'Random amplified polymorphic DNA (RAPD) typing of

necrophageous insects (diptera, coleoptera) in criminal forensic studies: validation

and use in practice', Forensic Science International, 98, pp. 157-168.

Binladen, J., Wiuf, C., Gilbert, M. T. P., Bunce, M., Barnett, R., Larson, G., Greenwood, A.

D., Haile, J., Ho, S. Y. W., Hansen, A. J. & Willerslev, E. (2006), 'Assessing the

Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes', Genetics,

172, pp. 733-741.

Blair, A. (19750, 'Karyotypes of Five Plant Species with Disjunct Distributions in Virginia

and the Carolinas', American Journal of Botany, 62 (8), pp. 833-837.

Boehm, C. L., Harrison, H. C., Jung, G. & Nienhuis, J. (1999), 'Organization of American

and Asian ginseng germplasm using randomly amplified polymorphic DNA

(RAPD) markers', Journal of the American Society for Horticultural Science, 124

(3), pp. 252-256.

But, P. (1994), 'Herbal poisoning caused by adulterants or erroneous substitutes.' Journal of

Tropical Medicine and Hygenie, 97 (3), pp. 371-374.

Calvo, J. H., Rodellar, C., Zaragoza, P. & Osta, R. (2002), 'Beef- and bovine-derived

material identification in processed and unprocessed food and feed by PCR

amplification', Journal of Agricultural & Food Chemistry, 50 (19), pp. 5262-5264.

Carles, M., Lee, T., Moganti, S., Lenigk, R., Tsim, K., Ip, N., Hsing, I. & Sucher, N.

(2001), 'Chips and Qi: microcomponent-based analysis in traditional Chinese

medicine', Fresenius Journal of Analytical Chemistry, 371 (2), pp. 190-194.

71

Chan, T. W. D., But, P. P. H., Cheng, S. W., Kwok, I. M. Y., Lau, F. W. & Xu, H. X.

(2000), 'Differentiation and Authentication of Panax ginseng, Panax quinquefolius,

and Ginseng Products by Using HPLC/MS', Analytical Chemistry, 72, pp. 1281-

1287.

Chan, T. Y. K., Chan, J. C. N., Tomlinson, B. & Critchley, J. A. J. H. (1993), 'Chinese

herbal medicines revisited: a Hong Kong perspective', The Lancet, 342 (8886-

8887), pp. 1532-1534.

Chan, T. Y. K., Tam, H. P., Lai, C. K. & Chan, A. Y. W. 2005, 'A multidisciplinary

approach to the toxicologic problems associated with the use of herbal medicines',

Therapeutic Drug Monitoring, 27 (1), pp. 53-57.

Chen, K. T., Su, Y. C., Lin, J. G., Hsin, L. H., Su, Y. P., Su, C. H., Li, S. Y., Cheng, J. H. &

Mao, S. J. (2001), 'Identification of Atractylodes plants in Chinese herbs and

formulations by random amplified polymorphic DNA', Acta Pharmacol Sin, 22 (6),

pp. 493-497.

Chen, Y.-Q., Wang, N., Zhou, H. & Qu, L.-H. 2002, 'Differentiation of medicinal

Cordyceps species by rDNA ITS sequence analysis', Planta Medica, 68 (7), pp.

635-639.

Chiou, F. S., Pai, C. Y., Hsu, Y. P. P., Tsai, C. W. & Yang, C. H. (2001), 'Extraction of

human DNA for PCR from chewed residues of betel quid using a novel

"PVP/CTAB" method', Journal Forensic Science, 46 (5), pp. 1174-1179.

Chung, H. S., Um, J. Y., Kim, M. S., Hong, S. H., Kim, S. M., Kim, H. K., Park, S. J., Kim,

S. C., Hwang, W. J. & Kim, H. M. (2002), 'Determination of the site of origin of

Pinellia ternata roots based on RAPD analysis and PCR-RFLP', Hereditas, 136 (2),

pp. 126-129.

Coleman, C. I., Hebert, J. H. & Reddy, P. (2003), 'The effects of Panax ginseng on quality

of life', Journal of Clinical Pharmacy & Therapeutics, 28 (1), pp. 5-15.

Comstock, K. E., Ostrander, E. A. & Wasser, S. K. (2005), 'Amplifying Nuclear and

Mitochondrial DNA from African Elephant Ivory: A Tool for Monitoring the Ivory

Trad', Conservation Biology, 17 (6), pp. 1840-1843.

Coney, S. (1999), 'New Zealand court allows national blood samples to be used in civil

trial', Lancet, 354 (9180), pp. 753.

72

Cui, J., Garle, M., Eneroth, P. & Bjorkhelm, I. (1994), 'What do commercial ginseng

preparations contain?', Lancet, 344 (8915), pp. 134.

Cui, X. M., Lo, C. K., Yip, K. L., Dong, T. T. X. & Tsim, K. W. K. (2003), 'Authentication

of Panax notoginseng by 5S-rRNA spacer domain and random amplified

polymorphic DNA (RAPD) analysis', Planta Medica, 69 (6), pp. 584-586.

Dickens, P., Tai, Y. T., But, P. P. H., Tomlinson, B., Ng, H. K. & Yan, K. W. (1994), 'Fatal

accidental aconitine poisoning following ingestion of Chinese herbal medicine: A

report of two cases', Forensic Science International, 67, pp. 55-58.

Ding, X., Xu, L., Wang, Z., Zhou, K., Xu, H. & Wang, Y. (2002), 'Authentication of stems

of Dendrobium officinale by rDNA ITS region sequences', Planta Medica, 68 (2),

pp. 191-192.

Dong, T. T. X., Ma, X. Q., Clarke, C., Song, Z. H., Ji, Z. N., Lo, C. K. & Tsim, K. W. K.

(2003), 'Phylogeny of Astragalus in China: Molecular evidence from the DNA

sequences of 5S rRNA spacer, ITS, and 18S rRNA', Journal of Agricultural & Food

Chemistry, 51 (23), pp. 6709-6714.

Dou, D., Wen, Y., Pei, Y., Yao, X., Chen, Y., Kawai, H. & Fukushima, H. (1996),

'Ginsenoside-I(a): a novel minor saponin from the leaves of Panax ginseng', Planta

Medica, 62 (2), pp. 179-181.

Dovicovicova, L., Olexova, L., Pangallo, D., Siekel, P. & Kuchta, T. (2004), 'Polymerase

chain reaction (PCR) for the detection of celery (Apium graveolens) in food',

European Food Research Technology, 218, pp. 493-495.

Du, Q., Jerz, G., Waibel, R. & Winterhalter, P. (2003), 'Isolation of dammarane saponins

from Panax notoginseng by high-speed counter-current chromatography', Journal of

Chromatography. A, 1008, (2), pp. 173-180.

Espinoza, E. O., Mann, M.-J., Bleasdell, B., DeKorte, S. & Cox, M. (1996), 'Toxic Metals

in Selected Traditional Chinese Medicinals', Journal of Forensic Science, 41 (3),

pp. 453-456.

Espinoza, E. O., Shafer, J. A. & Hagey, L. R. (1993), 'International Trade in Bear Gall

Bladders: Forensic Source Inference', Journal of Forensic Sciences, 38 (6), pp.

1363-1371.

73

Espley, M. H. (2006), 'Bears need not suffer for our health', The Pharmaceutical Journal,

276, p. 107.

Feng, H.-T. & Li, S. F. Y. (2002), 'Determination of five toxic alkaloids in two common

herbal medicines with capillary electrophoresis', Journal of Chromatography A, 973

(1-2), pp. 243-247.

Fennell, C. W., Lindsey, K. L., McGawb, L. J., Sparg, S. G., Stafford, G. I., Elgorashi, E.

E., Grace, O. M. & van Staden, J. (2004), 'Assessing African medicinal plants for

efficacy and safety: pharmacological screening and toxicology', Journal of

Ethnopharmacology, 94, pp. 205-217.

Fu, R.-Z., Wang, J., Sun, Y.-R. & Shaw, P.-C. (1998), 'Extraction of genomic DNA

suitable for PCR analysis from dried plant rhizomes/roots', Biotechniques, 25 (5),

pp. 796-801.

Fukuda, N., Tanaka, H. & Shoyama, Y. (1999), 'Western blotting for ginseng saponins,

ginsenosides using anti-ginsenoside Rb1 monoclonal antibody', Biological &

Pharmaceutical Bulletin, 22 (2), pp. 219-220.

Fukuda, N., Tanaka, H. & Shoyama, Y. (2000a), 'Formation of monoclonal antibody

against a major ginseng component, ginsenoside Rg1 and its characterization:

Monoclonal antibody for a ginseng saponin', Cytotechnology, 34 (3), pp. 197-204.

Fukuda, N., Tanaka, H. & Shoyama, Y. (2000b), 'Isolation of the pharmacologically active

saponin ginsenoside Rb1 from ginseng by immunoaffinity column chromatography',

Journal of Natural Products, 63 (2), pp. 283-285.

Fukuda, N., Tanaka, H. & Shoyama, Y. (2001), 'Double staining of ginsenosides by

Western blotting using anti-ginsenoside Rb1 and Rg1 monoclonal antibodies',

Biological & Pharmaceutical Bulletin, 24 (10), pp. 1157-1160.

Fushimi, H., Komatsu, K., Isobe, M. & Namba, T. (1997), 'Application of PCR-RFLP and

MASA analyses on 18S ribosomal RNA gene sequence for the identification of

three Ginseng drugs', Biological & Pharmaceutical Bulletin, 20 (7), pp. 765-769.

Fuzzati, N. (2004), 'Analysis methods of ginsenosides', Journal of Chromatography B,

812, pp. 119-133.

Gill, P., Jeffreys, A. J. & Werrett, D. J. (1985), 'Forensic application of DNA 'fingerprints'',

Nature, 318 (6046), pp. 577-579.

74

Guili, Z. & Chengbo, Z. (1997), Concise Chinese Materia Medica, Shandong Science and

Technology Press, Jiana, China.

Ha, W. Y., Shaw, P. C., Liu, J., Yau, F. C. & Wang, J. (2002), 'Authentication of Panax

ginseng and Panax quinquefolius using amplified fragment length polymorphism

(AFLP) and directed amplification of minisatellite region DNA (DAMD)', Journal

of agricultural and food chemistry, 50 (7), pp. 1871-1875.

Ha, W. Y., Yau, F. C., But, P. P., Wang, J. & Shaw, P. C. (2001), 'Direct amplification of

length polymorphism analysis differentiates Panax ginseng from P. quinquefolius',

Planta Medica, 67 (6), pp. 587-589.

Ho, I. S. H. & Leung, F. C. (2001), 'Isolation and characterization of repetitive DNA

sequences from Panax ginseng', Molecular Genetics & Genomics: MGG, 266 (6),

pp. 951-961.

Hon, C. C., Chow, Y. C., Zeng, F. Y. & Leung, F. C. (2003), 'Genetic authentication of

ginseng and other traditional Chinese medicine', Acta Pharmacol Sin, 24 (9),

pp. 841-846.

Hong, C. P., Lee, S. J., Park, J. Y., Plaha, P., Park, Y. S., Lee, Y. K., Choi, J. E., Kim, K.

Y., Lee, J. H. & Lee, J. (2004), 'Construction of a BAC library of Korean ginseng

and initial analysis of BAC-end sequences', Molecular Genetics & Genomics, 271

(6), pp. 709-716.

Hsieh, H.-M., Liu, C.-L., Tsai, L.-C., Hou, R.-J., Liu, K.-L., Linacre, A. & Lee, J. C.-L.

(2005), 'Characterization of the polymorphic repeat sequence within the rDNA IGS

of Cannabis sativa', Forensic Science International, 152, pp. 23-28.

Jung, D.-W., Lee, J. M. & Sung, C. K. (2002), 'Enzyme-linked immunosorbent assay for

the determination of 20(S)-protopanaxatriol', Analytica Chimica Acta, 462 (2),

pp. 157-163.

Kapteyn, J., Goldsbrough, P. B. & Simon, J. E. (2002), 'Genetic relationships and diversity

of commercially relevant Echinacea species', Theoretical Applied Genetics, 105, pp.

365-376.

Kew, J., Morris, C., Aihie, A., Fysh, R., Jones, S. & Brooks, D. (1993), 'Arsenic and

mercury intoxication due to Indian ethnic remedies.' British Medical Journal, 306,

pp. 506-507.

75

Kim, K. & Lee, H. (2004), 'Complete chloroplast genome sequences from Korean ginseng

(Panax schinseng Nees) and comparative analysis of sequence evolution among 17

vascular plants', DNA Research, 11 (4), pp. 247-261.

Kim, K. S., Schuster, W., Brennicke, A. & Choi, K. T. (1991), 'Korean ginseng

mitochondrial DNA encodes an intact rps12 gene downstream of the nad3 gene',

Plant Physiology, 97 (4), pp. 1602-1603.

Kitagawa, T., Yang, Z., Bai, G., Fujiwara, K., Akahori, A., Sonoi, S. & Kondo, S. (1997),

'A general Enzyme Immunoassay for the Licorice Root Component contained in

Traditional Chinese Medicine', Biological & Pharmaceutical Bulletin, 20 (3),

pp. 211-216.

Komatsu, K., Zhu, S., Fushimi, H., Qui, T. K., Cai, S. & Kadota, S. (2001), 'Phylogenetic

analysis based on 18S rRNA gene and matK gene sequences of Panax vietnamensis

and five related species', Planta Medica., 67 (5), pp. 461-465.

Lao, S. C., Li, S. P., Kan, K. K. W., Li, P., Wan, J. B., Wang, Y. T., Dong, T. T. X. &

Tsim, K. W. K. (2004), 'Identification and quantification of 13 components in

Angelica sinensis (Danggui) by gas chromatography–mass spectrometry coupled

with pressurized liquid extraction', Analytica Chimica Acta, 526, pp. 131-137.

Lee, C. & Wen, J. (2004), 'Phylogeny of Panax using chloroplast trnC-trnD intergenic

region and the utility of trnC-trnD in interspecific studies of plants', Molecular

Phylogenetics & Evolution, 31 (3), pp. 894-903.

Lee, S.-B. & Rasmussen, S. K. (2000), 'Molecular markers in some medicinal plants of the

Apiaceace family', Euphytica, 114, pp 87-91.

Lee, S.-Y. & Cho, G.-J. (2006), 'Parentage testing of Thoroughbred horse in Korea using

microsatellite DNA typing', Journal of Vetinary Science, 7 (1), pp. 63-67.

Lee, S. H., Min, D. M. & Kim, J. K. (2006), 'Qualitative and quantitative polymerase chain

reaction analysis for genetically modified maize MON863', Journal of agricultural

and food chemistry, 54 (4), pp. 1124-1129.

Leimanis, S., Hernandez, M., Fernandez, S., Boyer, F., Burns, M., Bruderer, S., Glouden,

T., Harris, N., Kaeppeli, O. & Philipp, P. (2006), 'A Microarray-based Detection

System for Genetically Modified (GM) Food Ingredients', Plant molecular biology,

61 (1-2), pp. 123-139.

76

Leung, F. C. (1999), 'New applications of low-C0t DNA as a DNA fingerprint probe',

Electrophoresis, 20 (8), pp. 1762-1767.

Li, Y. F., Li, Y. X., Lin, J., Xu, Y., Yan, F., Tang, L. & Chen, F. (2003), 'Identification of

bulb from Fritillaria cirrhosa by PCR with specific primers', Planta Medica, 69 (2),

pp. 186-188.

Linacre, A. & Thorpe, J. (1998), 'Detection and identifcation of cannabis by DNA',

Forensic Science International, 91, pp. 71-76.

Linder, C. R., Moore, L. A. & Jackson, R. B. (2000), 'A universal molecular method for

identifying underground plant parts to species', Molecular Ecology, 9, pp. 1549-

1559.

Liu, S.-Y., Woo, S.-O. & Koh, H.-L. (2001), 'HPLC and GC–MS screening of Chinese

proprietary medicine for undeclared therapeutic substances', Journal of

Pharmaceutical and Biomedical Analysis, 24, pp. 983-992.

Lo, C.-F., Lin, Y.-R., Chang, H.-C. & Lin, J.-H. (2006), 'Identification of Turtle Shell and

Its Preparations by PCR-DNA Sequencing Method', Journal of Food and Drug

Analysis, 14 (2), pp. 153-158.

Lorenzini, R. (2005), 'DNA forensics and the poaching of wildlife in Italy: A case study',

Forensic Science International, 153, pp. 218-221.

Ma, X. Q., Duan, J. A., Zhu, D. Y., Dong, T. T. & Tsim, K. W. (2000), 'Species

identification of Radix Astragali (Huangqi) by DNA sequence of its 5S-rRNA

spacer domain', Phytochemistry, 54 (4), pp. 363-8.

Ma, X. Q., Zhu, D. Y., Li, S. P., Dong, T. T. X. & Tsim, K. W. K. (2001), 'Authentic

identification of Stigma Croci (stigma of Crocus sativus) from its adulterants by

molecular genetic analysis', Planta Medica, 67 (2), pp. 183-186.

Mallol, A., Cusido, R. M., Palazon, J., Bonfill, M., Morales, C. & Pinol, M. T. (2001),

'Ginsenoside production in different phenotypes of Panax ginseng transformed

roots', Phytochemistry, 57 (3), pp. 365-371.

Manel, S., Berthier, P. & Luikart, G. (2002), 'Detecting Wildlife Poaching: Identifying the

Origin of Individuals with Bayesian Assignment Tests and Multilocus Genotypes',

Conservation Biology, 16 (3), pp. 650-659.

77

Mathur, A., Sangwan, R. S., Gangwar, A. & Uniyal, G. C. (2003), 'Differential

morphogenetic responses, ginsenoside metabolism and RAPD patterns of three

Panax species', Genetic Resources & Crop Evolution, 50 (3), pp. 245-252.

Mihalov, J. J., Marderosian, A. D. & Pierce, J. C. (2000), 'DNA identification of

commercial ginseng samples', Journal of Agricultural & Food Chemistry, 48 (8),

pp. 3744-3752.

Mizukami, H. (1995), 'Amplification and sequence of a 5S-rRNA gene spacer region from

the crude drug "Angelica root"', Biological & Pharmaceutical Bulletin, 18 (9), pp.

1299-1301.

Nah, J., Song, J., Choi, S., Kim, S., Rhim, H., Oh, T., Lee, S. & Nah, S. (2000),

'Preparation of monoclonal antibody against ginsenoside Rf and its enzyme

immunoassay', Biological & Pharmaceutical Bulletin, 23 (5), pp. 523-526.

Nebauer, S. G., Castillo-Agudo, L. d. & Segura, J. (1999), 'RAPD variation within and

among natural populations of outcrossing willow-leaved foxglove (Digitalis obscura

L.)', Theoretical & Applied Genetics, 98 (6/7), pp. 985-994.

Nebauer, S. G., Castillo-Agudo, L. d. & Segura, J. (2000), 'An assessment of genetic

relationships within the genus Digitalis based on PCR-generated RAPD markers',

Theoretical & Applied Genetics, 100 (8), pp. 1209-1216.

Ngan, F., Shaw, P., But, P. & Wang, J. 1999, 'Molecular authentication of Panax species',

Phytochemistry, vol. 50, no. 5, pp. 787-791.

Palsboll, P. J., Berube, M., Skaug, H. J. & Raymakers, C. (2005), 'DNA Registers of

Legally Obtained Wildlife and Derived Products as Means to Identify Illegal Takes',

Conservation Biology, 20 (4), pp. 1284-1293.

Popovich, D. G. & Kitts, D. D. (2004), 'Generation of ginsenosides Rg3 and Rh2 from

North American ginseng', Phytochemistry, 65 (3), pp. 337-344.

Putalun, W., Fukuda, N., Tanaka, H. & Shoyama, Y. (2002), 'Immunoaffinity column for

isolation of bioactive compounds using monoclonal antibodies', Journal of Liquid

Chromatography & Related Technologies, 25 (13-15), pp. 2387-2398.

Putalun, W., Fukuda , N., Tanaka, H. & Shoyama, Y. (2004), 'A one-step

immunochromatographic assay for detecting ginsenosides Rb1 and Rg1', Analytical

& Bioanalytical Chemistry, 378 (5), pp. 1338-1341.

78

Qin, J., Leung, F. C., Fung, Y., Zhu, D. & Lin, B. (2005), 'Rapid authentication of ginseng

species using microchip electrophoresis with laser-induced fluorescence detection',

Analytical & Bioanalytical Chemistry, 381 (4), pp. 812-819.

Rafalski, J. A. (2002), 'Novel genetic mapping tools in plants: SNPs and LD-based

approaches', Plant Science, 162, pp. 329-333.

Roberts, M. A. & Crawford, D. L. (2000), 'Use of Randomly Amplified Polymorphic DNA

as a Means of Developing Genus- and Strain-Specific Streptomyces DNA Probes',

Apllied and Environmental Microbiology, 66 (6), pp. 2555-2564.

Roitt, I. M. 1991, Essential Immunology, 7th edn, Blackwell Scientific, Oxford.

Saez, R., Sanz, Y. & Toldra, F. (2004), 'PCR-based fingerprinting techniques for rapid

detection of animal species in meat products', Meat Science, 66, pp. 659-665.

Saita, T., Katano, M., Matsunaga, H., Yamamoto, H., Fujito, H. & Mori, M. (1993), 'The

first specific antibody against cytotoxic polyacetylenic alcohol, panaxynol',

Chemical & Pharmaceutical Bulletin, 41 (3), pp. 549-552.

Schaneberg, B. T. & Khan, I. A. (2004), 'Analysis of products suspected of containing

Aristolochia or Asarum species', Journal of Ethnopharmacology, 94, pp. 245-249.

Schluter, C. & Punja, Z. K. (2002), 'Genetic diversity among natural and cultivated field

populations and seed lots of American ginseng (Panax quinquefolius L.) in Canada',

International Journal of Plant Sciences, 163 (3), pp. 427-439.

Schneider, P. M. (2007), 'Scientific standards for studies in forensic genetics', Forensic

Science International, 165 (2-3), pp. 234-243.

Semple, S. J., Nobbs, S. F., Pyke, S. M., Reynolds, G. D. & Flower, R. L. P. (1999),

'Antiviral flavonoid from Pterocaulon sphacelatum, an Australian Aboriginal

medicine', Journal of Ethnopharmacology, 68, pp. 283-288.

Shaw, P. C. & But, P. P. (1995), 'Authentication of Panax species and their adulterants by

random-primed polymerase chain reaction', Planta Medica, 61 (5), pp. 466-9.

Sherwood, M. L. (1997), Human Physioloy: From cells to Systems, 3rd edn, Wadsworth

Publishing Company, Belmont, California. Figure from , pg B-3.

Shoyama, Y., Tanaka, H. & Fukuda, N. (1999), 'Monoclonal antibodies against naturally

occurring bioactive compounds', Cytotechnology, 31 (1-2), pp. 9-27.

79

Singh, A., Gaur, A., Shailaja, K., Bala, B. S. & Singh, L. (2004), 'A novel microsatellite

(STR) marker for forensic identification of big cats in India', Forensic Science

International, 141, pp. 143-147.

Sobrino, B., Brion, M. & Carracedo, A. (2005), 'SNPs in forensic genetics: a review on

SNP typing methodologies.' Forensic Science International, 154 (2-3), pp. 181-194.

Still, J. (2003), 'Use of animal products in traditional Chinese medicine: environmental

impact and health hazards', Complementary Therapies in Medicine, 11, pp. 118-

122.

Sun, F.-J., Downie, S. R. & Hartman, R. L. (2004), 'An ITS-Based phylogenetic analysis of

the perennial, endemic Apiaceae subfamily apioideae of western North America',

Systematic Botany, 29 (2), pp. 419-431.

Tamaki, K. & Jeffreys, A. J. (2005), 'Human tandem repeat sequences in forensic DNA

typing', Legal Medicine, 7 (4), pp. 244-250.

Tanaka, H., Fukuda, N. & Shoyama, Y. (1999), 'Formation of monoclonal antibody against

a major ginseng component, ginsenoside Rb1 and its characterization',

Cytotechnology, 29 (2), pp. 115-120.

Tanaka, H., Fukuda, N. & Shoyama, Y. (2006), 'Identification and Differentiation of Panax

species using ELISA, RAPD and Eastern Blotting', Phytochemical Analysis, 17, pp.

46-55.

Tanaka, H., Fukuda, N., Yahara, S., Isoda, S., Yuan, C. & Shoyama, Y. (2005), 'Isolation of

Ginsenoside Rb1 from Kalopanax pictus by Eastern Blotting Using Antiginsenoside

Rb1 Monoclonal Antibody', Phytotherapy Research, 19, pp. 255-258.

Tanaka, H. & Shoyama, Y. (1999), 'Monoclonal antibody against tetrahydrocannabinolic

acid distinguishes Cannabis sativa samples from different plant species', Forensic

Science International, 106, pp. 135-146.

Tawab, M. A., Bahr, U., Karas, M., Wurglics, M. & Schubert-Zsilavecz, M. (2003),

'Dedragation of Ginsenosidesin Humans after Oral Administration', Drug

Metabolism and Disposition, 31 (8), pp. 1065-1071.

Tay, C. & Seah, C. (1975), 'Arsenic poisoning from anti-asthmatic herbal preparations',

Medical Journal of Australia, 2, pp. 424-428.

80

Um, J.-Y., Chung, H.-S., Kim, M.-S., Na, H.-J., Kwon, H.-J., Kim, J.-J., Lee, K.-M., Lee,

S. J., Lim, J. P., Do, K.-R., Hwang, W.-J., Lyu, Y.-S., An, N.-H. & Kim, H.-M.

(2001), 'Molecular authentication of Panax ginseng species by RAPD analysis and

PCR-RFLP', Biological & Pharmaceutical Bulletin, 24 (8), pp. 872-875.

van Breemen, R. B., Huang, C.-R., Lu, Z.-Z., Rimando, A., Fong, H. H. S. & Fitzioff, J. F.

(1995), 'Electrospray Liquid Chromatography/Mas Spectrometry of Ginsenosides',

Analytical Chemistry, 67, pp. 3985-3989.

Wang, J., Ha, W. Y., Ngan, F. N., But, P. P. & Shaw, P. C. (2001), 'Application of

sequence characterized amplified region (SCAR) analysis to authenticate Panax

species and their adulterants', Planta Medica, 67 (8), pp. 781-783.

Wang, N., Kiyohara, H., Sakurai, M. & Yamada, H. (1999), 'Antigenic epitope for

polyclonal antibody against a complement activating pectin from the roots of

Angelica acutiloba Kitagawa', Carbohydrate Polymers, 39 (3), pp. 257-264.

Ward, J., Peakall, R., Gilmore, S. R. & Robertson, J. (2005), 'A molecular identification

system for grasses:a novel technology for forensic botany', Forensic Science

International, 152, pp. 121-131.

Watanabe, A., Araki, S., Kobari, S., Sudo, H., Tsuchida, T., Uno, T., Kosaka, N.,

Shimomura, K., Yamazaki, M. & Saito, K. (1998), 'In vitro propagation, restriction

fragment length polymorphism, and random amplified polymorphic DNA analysis

of Angelica plants', Plant Cell Reports, 18 (3-4), pp. 187-192.

Wen, J., Shi, S., Jansen, R. K. & Zimmer, E. A. (1998), 'Phylogeny and Biogeorgraophy of

Aralia sect. Aralia (Araliaceae)', American Journal of Botany, 85 (6), pp. 866-875.

Wen, J. & Zimmer, E. A. (1996), 'Phylogeny and biogeography of Panax L. (the ginseng

genus, araliaceae): inferences from ITS sequences of nuclear ribosomal DNA',

Molecular Phylogenetic Evolution, 6 (2), pp. 167-77.

Wetton, J. H., Tsang, C. S. F., Roney, C. A. & Spriggs, A. C. (2002), 'An extremely

sensitive species-specific ARMS PCR test for the presence of tiger bone DNA',

Forensic Science International, 126 (2), pp. 137-144.

Wilbert, J. (1991), 'Does pharmacology corroborate the nicotine therapy and practices of

South American shamanism?' Journal of Ethnopharmacology, 32, pp. 179-182.

81

Wilson, I. G. (1997), 'Inhibition and Facilitation of Nucleic Acid Amplification', Applied

and Environmental Microbiology, 63 (10), pp. 3741–3751.

World Health Organisation, (2003). Traditional medicine Fact sheet N°134

www.who.int/mediacentre/factsheets/fs134/en/.

Xu, H., Fabricant, D. S., Piersen, C. E., Bolton, J. L., Pezzuto, J. M., Fong, H., Totura, S.,

Farnsworth, N. R. & Constantinou, A. I. (2002), 'A preliminary RAPD-PCR

analysis of Cimicifuga species and other botanicals used for women's health',

Phytomedicine, 9 (8), pp. 757-762.

Xu, Y. C., Li, B., Li, W. S., Bai, S. Y., Jin, Y., Li, X. P., Gu, M. B., Jing, S. Y. & Zhang,

W. (2005), 'Individualization of tiger by using microsatellites', Forensic Science

International, 151, pp. 45-51.

Xu, Y., Wang, Y., Li, Z., Bao, Z., Zhou, J. & Huang, H. (2006), 'Characterization of

polymorphic microsatellite loci in a traditional Chinese medicinal plant, Gastrodia

elata', Molecular Ecology Notes, 6 (2), pp. 316-318.

Yanagihara, H., Sakata, R., Minamia, H., Tanaka, H., Shoyama, Y. & Murakamib, H.

(1996), 'Immunoaffinity column chromatography against forskolin using an anti-

forskolin monoclonal antibody and its application', Analytica Chimica Acta, 335,

pp. 63-70.

Yau, F. C. F., Wong, K. L., Shaw, P. C., But, P. P. H. & Wang, J. (2002), 'Authentication

of snakes used in Chinese medicine by sequence characterized amplified region

(SCAR)', Biodiversity and Conservation, 11, pp. 1653-1662.

Yee, S.-K., Chu, S.-S., Xu, Y.-M. & Choo, P.-L. (2005), 'Regulatory control of Chinese

Proprietary Medicines in Singapore', Health Policy, 71, pp. 133-149.

Yi, T., Lowry, P. P., II, Plunkett, G. M. & Wen, J. (2004), 'Chromosomal evolution in

Araliaceae and close relatives', Taxon, 53 (4), 987-1005.

Yoon, S.-R., Nah, J.-J., Kim, S.-K., Kim, S.-C., Nam, K.-Y., Jung, D.-W. & Nah, S.-Y.

(1998), 'Determination of ginsenoside Rf and Rg2 from Panax ginseng using

enzyme immunoassay', Chemical & Pharmaceutical Bulletin, 46 (7), pp. 1144-

1147.

Yu, K. & Pauls, K. P. (1992), 'Optimization of the PCR program for RAPD analysis',

Nucleic Acids Research, 20 (10), p. 2606.

82

Yue, G., Li, Y., Chen, F., Cho, S., Lim, L. C. & Orban, L. (2002), 'Comparison of three

DNA marker systems for assessing genetic diversity in Asian arowana (Scleropages

formosus)', Electrophoresis, 23 (7-8), pp. 1025-32.

Zhang, H., Lu, Z., Tan, G. T., Qiu, S., Farnsworth, N. R., Pezzuto, J. M. & Fong, H. H. S.

(2002), 'Polyacetyleneginsenoside-Ro, a novel triterpene saponin from Panax

ginseng', Tetrahedron Letters, 43, pp. 973-977.

Zhang, N., Xu, B., Mou, C., Yang, W., Wei, J., Lu, L., Zhu, J., Du, J., Wu, X., Ye, L., Fu,

Z., Lu, Y., Lin, J., Sun, Z., Su, J., Dong, M. & Xu, A. (2003), 'Molecular profile of

the unique species of traditional Chinese medicine, Chinese seahorse (Hippocampus

kuda Bleeker)', FEBS Letters, 550 (1-3), pp. 124-34.

Zhao, K. J., Dong, T. T., Tu, P. F., Song, Z. H., Lo, C. K. & Tsim, K. W. (2003),

'Molecular genetic and chemical assessment of radix Angelica (Danggui) in China',

Journal of agricultural and food chemistry, 51 (9), pp. 2576-2583.

Zhao, Z. L., Wang, Z. T., Xu, L. S. & Zhou, K. Y. (2002), 'Studies on the molecular

markers of rhizomes of some Alpinia species', Planta Medica, 68 (6), pp. 574-6.

Zhao, Z. L., Zhou, K. Y., Dong, H. & Xu, L. S. (2001), 'Characters of nrDNA ITS region

sequences of fruits of Alpinia galanga and their adulterants', Planta Medica, 67 (4),

pp. 381-383.

83

APPENDIX A

84

Detailed in this appendix are the methods used during this research.

Solutions

Cell Lysis Buffer - 500mM Sodium Chloride

100mM Tris-HCl

50mM EDTA

TE buffer pH 8.0 - 100mM Tris-HCl

10mM Ethylenediaminetetraacetic Acid (EDTA)

2% Agarose Gel - 4g Agarose powder

200ml of 0.5 X TBE

10µl Ethidium Bromide

0.5 X TBE - 108g of Tris-HCl

8g of EDTA

56g of Boric Acid

20 litres of distilled water

Sample Acquisition

Dried plant root samples were purchased from a number of different retailers in Western

Australia, Singapore and Brisbane. Each of the purchased samples where labelled as Panax

ginseng, Panax quinquefolium or Panax notoginseng. Along with dried root material two

liquid samples labelled as containing ginseng were purchased from stores in Perth Western

Australia, see Table 1 below for descriptions of the samples.

Extraction Protocol

Before DNA extraction was preformed some sample preparation was required. All dried

samples were washed with sterile water to remove contaminants then dried on a heat block

before they were peeled and the peel ground into a fine powder. The peel was used because

85

the inner cortex of plants is low in DNA containing cells and full of polysaccharides, which

are PCR inhibitors (Chiou et al. 2001; Wilson 1997). Liquid samples were extracted using

1mL aliquots of the samples.

Phenol:Chloroform extraction of the material was performed as follows, 25mg of material

was placed into 500µl of cell lysis buffer with 50µl of 20% SDS and 10µl of Proteinase K

then incubated at 65oC for an hour. The sample was then extracted twice with an equal

volume of Phenol:Chloroform:Isoamyl alcohol (25:24:1). The supernatant was collected

and 500µl of Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The

supernatant was collected again and double volume of 100% ethanol was added and

incubated at -20 o

C for 30 minutes. Samples were centrifuged at 13,200rpm for 10 minutes

and the supernatant was removed and the pellet was washed with 70% ethanol. The pellet

was air dried and re-suspended in 100µl of TE.

After extraction the concentration and purity of the DNA was determined using a

Nanodrop® ND-1000 (NanoDrop Technologies) spectrophotometer measuring light

absorbance at 230nm.

86

Table 1. The samples that were DNA profiled to evaluate the use of these RAPD primers to differentiate TCM material.

Sample

Number

Sample Description Label Common Name Purchased From

CR003 Dried root material in thin pieces Panax ginseng Chinese ginseng Perth, Western Australia

CR010 Dried whole roots Panax quinquefolium American ginseng Singapore, Singapore

CR009 Dried root material in thick pieces Panax ginseng Chinese ginseng Singapore, Singapore

CR013 Slices of Black root material Panax notoginseng

Sanchi ginseng Perth, Western Australia

CR025 Whole Red dried root material Panax ginseng Korean ginseng Perth, Western Australia

CR026 Black liquid extractum Panax ginseng Chinese ginseng Perth, Western Australia

CR027 Liquid drink containing a whole root Panax ginseng Korean ginseng Perth, Western Australia

CR030 Dried root material Eleutherococcus

senticosus

Siberian ginseng Brisbane, Queensland

87

PCR Protocol

PCR Solution

The PCR solution contained the following material to a total volume of 20µl,

100ng of DNA

1 Unit of Taq

2µl of 10X PCR buffer

2µl of 200 picomole primer

200µM dNTP

1µl of 5% BSA

MgCl2 concentrations were optimized for each primer

Sterile double-distilled water

Taq Polymerase

A range of Taqs were tested during a short trial, these included AmpliTaq (Applied

Biosystems), AmpliTaq Gold (Applied Biosystems), iTaq DNA polymerase (Bio-Rad),

HotStarTaq Plus (Qiagen), GoTaq Green (Promega) and Fisher Biotec Taq. The Taq found

to amplify the samples the most consistently was used for all further profiling. While each

Taq produced results to varying degrees the Fisher Biotech (Australia) Taq produced the

most consistent amplification of multiple bands and was used for all subsequent work

presented here.

Additives

Initially, there were problems getting reproducible production of PCR products. To try and

determine what was causing the lack of reproducibility positive control DNA was mixed

with the extracted DNA and a PCR as performed. It was found that the positive control and

sample DNA mix where inhibited. To reduce the action of the PCR inhibitor a variety of

additives were tested and BSA was found to product more reliable PCR amplification when

88

added to the PCR solution. BSA is used regularly in many other DNA profiling situations

such as with ancient DNA to reduce inhibitors affects (Binladen et al., 2006).

Magnesium Chloride concentration

As with all PCR protocols the MgCl2 needed to be optimised for each of the primers used.

Here the MgCl2 were 4mM for Primer3 and 4.5mM for primer DALP1.7F3.

Primers

Randomly Amplified Polymorphic DNA (RAPD) techniques use a single small arbitrary

primer of between 10 and 20 base pairs in length in each PCR. The single primer acts as

what in different DNA profiling techniques would be separately designed forward and

reverse primers. When testing material using RAPD techniques different primers are tested

until a set is found which produce reliable and reproducible results that can distinguish

multiple species from each other.

Primers were selected from previous research articles where they had been used on a

number of different samples types, including TCMs (Chung et al., 2002; Cui et al., 2003;

Ha et al., 2001), cannabis (Linacre & Thorpe, 1998) and flies (Benecke, 1998). Table 2

describes the primers that were tested, detailing their sequence and the sample they had

previously been used with. Each primer produced results to varying degrees; the most

reliable primers that differentiated the different Panax species were used to further

authenticate the material used in TCM.

Primers REP1R and primer 808, which had previously been used on flies, produced only

single bands when amplifying the materials of interest here. This meant they were of no

use for distinguishing Panax plant species and hence, were not used again.

The three primers (Z8, Z10 and primer C) were found to produce very variable results and

would not consistently amplify even after considerable attempts to optimize the PCR.

89

When they did amplify multiple bands were produced, their unreliability and lack of

reproducibility meant they are of little research value.

The primers primer 3 (referred to as CHUN3 in Section 2.2) and DALP1.7F3 produced

reliable results that could be reproduced repeatedly. These primers also produced profiles

that distinguished the plant species of interest. The profiles produced by the primers are

presented in detail in the manuscript titled “Differentiation of Ginseng species using

Randomly Amplified Polymorphic DNA (RAPD)” in Section 2.1.

90

Table 2. Primers tested to determine whether they could distinguish Panax plant species.

Name Sequence 5’-3’ Reference Previous use

Primer 3 (referred

to as CHUN3 in

Section 2.2)

GTGTGCGATCAGTTCTGGG Chung et al. (2002) Pinellia ternata root

DALP1.7F3 GCGTCCCACTGACCCTTTTGTACA Ha et al. (2001) P. ginseng and P. quinquefolium

Z8 GGGTGGGTA Cui et al. (2003) P. notoginseng

Z10 CCGACAAACC Cui et al. (2003) P. notoginseng

Primer C CGAAATCGGTAGACGCTACG Linacre and Thorpe

(1998) Cannabis sativa

REP1R ACGTCGICATCAGGC

Benecke (1998) Calliphora erythrocephala

Primer 808 AGA GAG AGA GAG AGA GC

In House Calliphora erythrocephala

91

PCR Cycle

The PCR protocol used was selected as it provided conditions that would amplify any DNA

present in the PCR. The cycle was as follows:

Initial Denature 15 minutes at 95 oC

35 cycles Denature 30s at 95 o

C

Anneal 60s at 45 o

C

Extension 90s at 72 o

C

Final Extension 72 oC for an hour.

Visualisation

The PCR products were run on 2% agarose gel containing Ethidium Bromide at 120 volts

for an hour. Then the gels were visualized on an Ultraviolet light box.