AUSTRALIAN POULTRY CRC

FINAL REPORT

Program 2

Project No: Poultry CRC 07-15

PROJECT LEADERS: Dr Robert Moore

DATE OF COMPLETION: 31 December 2009

Project 07-15 A new virulence factor in Clostridium perfringens causing Necrotic Enteritis in chickens – a route to vaccine development

© 2010 Australian Poultry CRC Pty Ltd All rights reserved. A new virulence factor in Clostridium perfringens causing Necrotic Enteritis in chickens – a route to vaccine development Project No. …07-15 The information contained in this publication is intended for general use to assist public knowledge and discussion and to help improve the development of sustainable industries. The information should not be relied upon for the purpose of a particular matter. Specialist and/or appropriate legal advice should be obtained before any action or decision is taken on the basis of any material in this document. The Australian Poultry CRC, the authors or contributors do not assume liability of any kind whatsoever resulting from any person’s use or reliance upon the content of this document. This publication is copyright. However, Australian Poultry CRC encourages wide dissemination of its research, providing the Centre is clearly acknowledged. For any other enquiries concerning reproduction, contact the Communications Officer on phone 02 6773 3767. Researcher Contact Details Dr Robert Moore CSIRO – Livestock Industries Australian Animal Health Laboratory Private Bag 24 GEELONG VIC 3220 Life Sciences Phone: 03 5227 5760 Fax: 03 5227 5555 Email: rob.moore@csiro.au In submitting this report, the researcher has agreed to the Australian Poultry CRC publishing this material in its edited form. Australian Poultry CRC Contact Details PO Box U242 University of New England ARMIDALE NSW 2351 Phone: 02 6773 3767 Fax: 02 6773 3050 Email: infor@poultrycrc.com.au Website: http://www.poultrycrc.com.au Published in March 2010

iv

Executive Summary

The Poultry CRC and the poultry production industries have recognised that it would be desirable to

have alternative treatment strategies for necrotic enteritis beyond the currently used in-feed antibiotics.

It has been claimed that globally necrotic enteritis may cause losses of up to $2 billion annually. We

have identified a new virulence factor, NetB, which appears to be important in the pathogenesis of

disease. This project aimed to confirm that NetB was of general importance in all necrotic enteritis

causing strains of Clostridium perfringens and then go on to develop and test prototype vaccines.

Our methodological approach to assessing the general importance of NetB was to survey a diverse

collection of C. perfringens isolates from clinical cases of NE for the presence and expression of the

netB gene. Gene carriage was assessed using a gene specific PCR test and expression was

characterised by immunological analysis via Western blotting using a NetB specific antibody and by a

cultured cell cytotoxicity assay. To further investigate the importance of NetB mutant strains in which

the netB gene was knocked out were constructed and tested in a disease induction model.

The vaccine work in this project focused on testing the efficacy of NetB delivered as a subunit

vaccine. To do this it was necessary to make substantial quantities of recombinant NetB as only small

amounts of the protein are produced by native C. perfringens strains. The vaccination studies required

changes to the disease induction model that we had established in our laboratory. In order to generate

an appropriate immune response to antigens we have had to vaccinate first at 7-11 days of age and

then re-vaccinate at 18-20 days of age with challenge at least a week later than the optimal time for

disease induction. This late challenge reduced the reliability of the challenge procedure and restricted

the number of successful vaccine test trials. We eventually overcame this problem by using a very

heavy in-feed challenge.

The research has been successfully completed. The central role of NetB in the pathogenesis of necrotic

enteritis has been proven. We have shown that most C. perfringens isolates from clinical disease cases

carry the netB gene and in all cases gene carriage coincides with expression of the protein in culture

supernatant. In the oral challenge model there is an absolute correlation between carriage of netB and

disease induction; no netB-negative isolates cause disease and all netB-positive isolates do cause

disease, although the severity of disease is variable, indicating that other factors can also influence

virulence. The netB gene is highly conserved, in the strains that we surveyed there was only a single

variant type in which an amino acid was changed. This variant retained full biological activity and was

recognised by anti-sera raised to the originally defined NetB.

v

The difficulties with the model have somewhat limited our progress in testing all the vaccine formats

that we had intended but we have been able to demonstrate that recombinant NetB gives a reasonable

level of protection, and possibly very good protection when used at higher doses. The most reliable

trial results showed that recombinant NetB added to a killed, whole cell bacterin gave the best levels of

protection.

This project has established the value of NetB in the design of vaccines against necrotic enteritis.

Work is now needed to optimise the vaccine efficacy and move towards a commercially viable

vaccine.

vi

Table of Contents Executive Summary ............................................................................................................................... iv Table of Contents ................................................................................................................................... vi Introduction ............................................................................................................................................. 1

Background .......................................................................................................................................... 1

Necrotic enteritis .................................................................................................................................. 1

Necrotic enteritis vaccines .................................................................................................................... 2

Necrotic enteritis toxin B (NetB) ......................................................................................................... 3

Objectives ................................................................................................................................................ 4 Methodology ........................................................................................................................................... 4 Chapter 1 - Characterisation of NetB ...................................................................................................... 6

Introduction .......................................................................................................................................... 6

Materials and Methods ......................................................................................................................... 6

Strain survey of netB ........................................................................................................................ 6

Western blot analysis of C. perfringens isolates .............................................................................. 6

Construction of defined netB mutants of EHE-NE18 ...................................................................... 7

Oral challenge model ....................................................................................................................... 9

Purification of recombinant NetB and generation of rabbit anti-rNetB serum ................................ 9

Cell lines and cytotoxicity assay .................................................................................................... 10

Results and Discussion ....................................................................................................................... 10

Prevalence of netB in C. perfringens isolates from chickens ......................................................... 10

The netB sequence is highly conserved .......................................................................................... 13

NetB (A168T) retains cytotoxic activity ........................................................................................ 13

The netB mutants do not produce NE in a chicken disease model ................................................. 14

C. perfringens isolates lacking netB do not cause disease ............................................................. 17

Chapter 2 - Necrotic enteritis vaccine development .............................................................................. 20 Introduction ........................................................................................................................................ 20

Materials and Methods ....................................................................................................................... 20

In-feed challenge model ................................................................................................................. 20

NetB subunit vaccine ..................................................................................................................... 21

Bacterin vaccine ............................................................................................................................. 21

NetB ELISA ................................................................................................................................... 21

Results and Discussion ....................................................................................................................... 21

Recombinant NetB sub-unit vaccination ........................................................................................ 21

Bacterin vaccine studies ..................................................................................................................... 24

Immunogenicity of attenuated strains ................................................................................................ 26

Discussion of Results ............................................................................................................................ 27

vii

Implications ........................................................................................................................................... 28 Recommendations ................................................................................................................................. 28 Publications arising from project .......................................................................................................... 29

Patent .................................................................................................................................................. 29

Peer reviewed publications ................................................................................................................. 29

International conference presentations ............................................................................................... 29

National conference presentations ...................................................................................................... 29

Acknowledgements ............................................................................................................................... 30 References ............................................................................................................................................. 31

Plain English Compendium Summary ............................................................................................... 34

1

Introduction

Background

Necrotic enteritis, caused by C. perfringens, is currently generally well controlled in the Australian

poultry production industries by the use of in-feed antibiotics. In other countries the disease is more

prevalent. Local producers are concerned that the disease could present major problems if in-feed

antibiotic usage was reduced or the causative organism became resistant to the current control

measures. The industry would like to have alternative means of controlling the disease. This report

describes experimental work carried out to study how the organism causes disease and work towards

development of vaccine strategies for controlling the disease.

Necrotic enteritis

Avian necrotic enteritis (NE) was first described by Parish (1961a); he categorized the disease into an

acute clinical form and a subclinical form. He isolated C. perfringens from the small intestine of birds

suffering from NE (Parish, 1961b). The disease has been reported to occur in all poultry producing

countries (Bains, 1968; Ficken and Wages, 1997; Long, 1973; Nairn and Bamford, 1967). NE is an

enteric disease that has, historically, been reported to be caused predominantly by C. perfringens type

A and to a lesser extent type C strains (Songer, 1996), but there have been no type C disease strains

reported in the last decade.

The clinical signs of acute NE can be seen from about two weeks of age. The symptoms of disease

include marked depression, dehydration, reluctance to move, pronounced apathy, diarrhoea, ruffled

feathers, and decreased feed consumption (Al-Sheikhly and Al-Saieg, 1980; Al-Sheikhly and Truscott,

1977b; Gazdzinski and Julian, 1992; Helmboldt and Bryant, 1971). Birds showing clinical signs

normally die within hours, with mortality rates reaching up to 1% per day (Helmboldt and Bryant,

1971).

The diagnosis of subclinical NE is based on the detection of visible, focal necrotic lesions in the small

intestinal mucosa and a decrease in the feed conversion ratio (FCR) (Kaldhusdal and Hofshagen,

1992). Macroscopic lesions can be seen in the small intestine, but lesions can sometimes be found in

other organs, such as the liver, kidney and caeca (Van Immerseel et al., 2004). In an affected bird, the

small intestine can become enlarged due to gas accumulation and the wall of the intestine can become

2

thin and delicate (Broussard et al., 1986). Subclinical NE is observed at varying ages of birds, but

more often it is first detected in birds around 21 to 23 days old (Van der Sluis, 2000b). The subclinical

form of the disease is not only of significance to the animal’s welfare, but also to the producer through

lost productivity and added cost of disease intervention. It is estimated that this disease costs around

$US2 billion each year to agricultural industries based on the average damage of $US0.05 per bird

(Lovland and Kaldhusdal, 2001; Van der Sluis, 2000a, b).

Early studies on NE suggested that the main virulence factor involved in the disease was secreted by

the bacteria (Al-Sheikhly and Truscott, 1977c), which led to the proposal that alpha-toxin was the

major toxin involved in pathogenesis. This hypothesis was based on the observations that alpha-toxin

is a major secreted protein and that cell-containing and cell-free cultures were able to cause necrotic

lesions typical of NE in the gastrointestinal tract of chickens (Al-Sheikhly and Truscott, 1977a, b, c).

Work done in our laboratories investigated the role of alpha-toxin in necrotic enteritis (Keyburn et al.,

2006). A survey of local strains was completed, and demonstrated that the levels of alpha-toxin

produced in vitro by virulent isolates was low. In order to definitively determine the role of alpha-

toxin in disease we constructed an alpha-toxin (plc) null mutant of a virulent necrotic enteritis isolate,

EHE-NE18, and showed that it can still caused disease in chickens. This study represented the first

definitive evidence that alpha-toxin was not an essential virulence factor in the pathogenesis of

necrotic enteritis in chickens.

Necrotic enteritis vaccines

Vaccines against C. perfringens or its toxins have successfully prevented necrotic enteritis in other

mammalian species including humans (Lawrence et al., 1990; Springer and Selbitz, 1999; Uzal and

Kelly, 1998). It is known that chicken flocks with naturally high levels of maternal antibodies against

alpha-toxin had lower mortality levels than flocks with lower titres (Heier et al., 2001). Toxoid

vaccines based on C. perfringens type A and type C toxoids have been experimentally tested (Lovland

et al., 2004). Layer hens were vaccinated with these toxoids, which resulted in high levels of antitoxin

in their progeny compared to unvaccinated hens. Both toxoid vaccines showed levels of protection

against subclinical NE, with the type C toxoid vaccine giving higher levels of protection than the type

A toxoid. Recently, a commercial vaccine (NETVAX®, Schering-Plough) has been developed based

on a C. perfringens type A toxoid.

Analysis of serum from challenged birds identified immunogenic secreted proteins produced by

virulent C. perfringens isolates (Kulkarni et al., 2006). These proteins included alpha-toxin,

glyceraldehyde-3-phosphate dehydrogenase, pyruvate:ferredoxin oxidoreductase, fructose 1,6-

3

biphosphate aldolase, and a hypothetical protein. All proteins significantly protected broiler chickens

against a relatively mild challenge, with alpha-toxin, pyruvate:ferredoxin oxidoreductase and the

hypothetical protein offering protection against a more severe challenge (Kulkarni et al., 2007). This

study offers the first evidence that a subunit vaccine could be useful in controlling NE in chickens. In

addition, a recent study has demonstrated that birds vaccinated with alpha-toxin have limited

protection (~ 40%) against NE (Cooper et al., 2009).

Another study investigated if spontaneous alpha-toxin null mutants of a virulent C. perfringens isolate

(CP4) could be used as a live-attenuated vaccine (Thompson et al., 2006). Both the wildtype (CP4)

and spontaneous alpha-toxin null mutants (CP-1-4) were used in infection-immunization studies and it

was found that the wild-type and two of the spontaneous alpha-toxin mutants were able to immunize

against challenge. This was the first time that infection with virulent strains or oral immunizations with

live alpha-toxin deficient isolates of C. perfringens had been shown to offer protection against

infection. Not only do there appear to be factors other than alpha-toxin that are capable of eliciting

protective immunity but this study may provide the basis to develop a live-attenuated C. perfringens

vaccine to prevent NE in chickens.

In addition to live-attenuated vaccines, live delivery of antigens using Salmonella has been

investigated (Kulkarni et al., 2009). The delivery of alpha-toxin and hypothetical protein using

Salmonella vaccine vehicle gave partial protection against NE.

Necrotic enteritis toxin B (NetB)

The work showing that alpha-toxin is not an essential virulence factor in disease (Keyburn et al., 2006)

provided the impetus to study other virulence factors involved in NE. There was strong evidence to

suggest that secreted products from C. perfringens were able to cause lesions typical of NE in chickens

(Al-Sheikhly and Truscott, 1977c). With this in mind the culture supernatant of the alpha-toxin mutant

was screened against various cell lines derived from chickens and other animals to identify a novel

cytotoxic factor. One cell line, LMH (chicken hepatoma cell line), was sensitive to a component of the

C. perfringens alpha-toxin mutant supernatant. The cell line toxicity was used as an assay to follow the

location of the toxic moity during biochemical purification. A candidate protein responsible for the

cytotoxicity was isolated and its N-terminal sequence was used to search the whole genome sequence

of C. perfringens EHE-NE18 and identify a putative toxin designated NetB. The toxin has sequence

similarity to other bacterial pore-forming toxins including the beta-toxin from C. perfringens (Keyburn

et al., 2008).

4

This project aimed to develop our knowledge of the novel toxin, NetB, to investigate its role in disease

and its potential use to produce an effective vaccine against NE.

Objectives

The overall objectives of the project were to investigate NetB toxin’s role in disease and to determine

whether NetB could form the basis of an effective vaccine against necrotic enteritis. The outcome of

the project would generate a product to control necrotic enteritis in broiler chickens, which addresses

the industry’s need for alternative pathogen control strategies in the face of the anticipated reduction in

the in-feed use of conventional antibiotics.

Deliverables of the proposed research include a patent on NetB for its use as vaccine antigen and

prototype vaccines suitable for product development and introduction to the industry. Potential

prototype vaccines include subunit vaccines, conventional bacterin vaccines as well as live attenuated

vaccines.

Methodology

Previous work had identified NetB and shown that it played a role in the virulence of one particular

strain of C. perfringens. To continue this promising line of research our approach was to first gather

evidence that NetB was of general significance in NE causing strains of C. perfringens and, if that was

achieved, to commence the development of vaccines using our knowledge of NetB biology.

Our methodological approach to assessing the general importance of NetB was to survey a diverse

collection of C. perfringens isolates from clinical cases of NE for the presence and expression of the

netB gene. Gene carriage was assessed using a gene specific PCR test and expression was

characterised by immunological analysis via Western blotting using a NetB specific antibody and by a

cultured cell cytotoxicity assay.

To further investigate the importance of NetB mutant strains in which the netB gene was knocked out

were constructed and tested in a disease induction model. This experiment represented a critical

GO/NO GO point in the project; if the knockout mutant was no longer virulent this would indicate the

5

critical importance of NetB and would justify further work to assess the potential for developing

vaccines designed around the newly emerging knowledge regarding NetB.

There are potentially many different forms of vaccine that could be developed, ranging from single

subunit vaccines, through killed whole cell vaccines and attenuated strains, to sophisticated live

vaccines delivering immunologically active but enzymatically inactive versions of the NetB protein.

The vaccine work in this project focused on testing the efficacy of NetB delivered as a subunit

vaccine. To do this it was necessary to make substantial quantities of recombinant NetB as only small

amounts of the protein are produced by native C. perfringens strains. The vaccination studies required

changes to the disease induction model that we had established in our laboratory. Conventional

vaccination is generally not effective in newly hatched chicks as their immune system is not fully

developed. It is advisable to first vaccinate at least a week after hatch. Subsequent booster vaccinations

should ideally occur two weeks later. These timing limitations meant that the normal NE induction

protocol could not be used and we would have to investigate extending the protocol to accommodate a

reasonable vaccination schedule.

6

Chapter 1 - Characterisation of NetB

Introduction

Previous work in our laboratory had demonstrated that alpha-toxin was not essential for the virulence

of C. perfringens in NE, overturning 30 years of thinking in the field. We subsequently identified a

new toxin, NetB, which had cytotoxic activity against a cultured chicken cell line and seemed to be

associated with C. perfringens strains isolated from clinical cases of NE. The work reported in this

chapter was aimed at establishing whether NetB was a key virulence factor in a wide variety of NE

causing C. perfringens strains.

Materials and Methods Strain survey of netB

The presence of the netB gene in C. perfringens strains was investigated by PCR. Clostridial genomic

DNA was isolated as previously reported (O'Connor et al., 2006). PCR amplification of the genomic

DNA used Taq DNA polymerase (Roche) and 0.5 µM concentration of each primer. Denaturation

(94°C for 30 sec), annealing (55°C for 30 sec), and extension (72°C for 1 min) steps were performed

for 35 cycles. Internal primer pairs AKP78 (5’ GCTGGTGCTGGAATAAATGC 3’) and AKP79 (5’

TCGCCATTGAGTAGTTTCCC 3’) were used to screen the C. perfringens strains for the presence of

netB (Table 1-1). For sequencing of netB, the PCR and sequencing primers were JRP3943 (5’

TTTTCTTTTAGACATGTCCATAGGC 3’), which binds 268bp upstream of the netB open reading

frame (ORF), and JRP3944 (5’CCATCCCTTATTTCATCAGCATTTA 3’), which binds 348 bp

downstream of the netB ORF. The primers CPNE3416F (5’

CACCATGAGTGAATTAAATGACATAAAC 3’) and CPNE3416R (5’

CAGATAATATTCTATTTTATGATCTTG 3’) were also used to sequence the amplified PCR

products. PCR products were purified using the QIAquick PCR purification kit before sequencing on

an Applied Biosystems 3730S capillary sequencer.

Western blot analysis of C. perfringens isolates

Detection of NetB protein was performed as previously described (Keyburn et al., 2008). Briefly, C.

perfringens strains were grown in TPG broth to a turbidity at 600nm of 0.6. Culture supernatants were

7

obtained by centrifugation at 18,000 g for 10 min and separated by SDS-PAGE (NuPAGE ® Novex 4-

12% Bis-Tris gel, Invitrogen) in MES SDS running buffer (NuPAGE ®MES SDS Running Buffer,

Invitrogen). Proteins were transferred onto PDVF (PALL) membranes and probed with rabbit

polyclonal anti-recombinant NetB (rNetB) antiserum. Blots were developed with an ECL Western

Blotting kit (Amersham Biosciences) and the results recorded on autoradiographic film.

Construction of defined netB mutants of EHE-NE18

DNA manipulations were carried out according to standard techniques (Sambrook et al., 1989).

Oligonucleotides used in the construction of the suicide plasmid are described in Table 1-1 and the

plasmids used in this study are described in Table 1-2. All amplified products were cloned into the

pGEM®-T Easy vector system (Promega) and subsequently sub-cloned as required. The marked,

partial deletion, suicide plasmid, pALK16, was constructed by cloning fragments of the netB gene and

surrounding regions on either side of the catP cassette in pALK1(Keyburn et al., 2006), which

resulted in an 541 bp internal deletion within the netB gene. First, a 1490 bp MfeI-SpeI fragment

amplified using oligonucleotides AKP60 and AKP61 was directionally cloned into the EcoRI-SpeI

sites of pALK1, followed by cloning of a 1937 bp BamHI-NheI fragment amplified using

oligonucleotides AKP58 and AKP59 into the BamHI-NheI sites of the resultant plasmid. Finally, the

ermB gene and the oriT region were amplified from pJIR1457 and blunt-end cloned into the SmaI site.

The final suicide plasmid pALK16 was introduced into C. perfringens strain EHE-NE18 as described

previously(Sheedy et al., 2004). After growth at 37oC on TSC supplemented with thiamphenicol,

colonies were patched onto TSC supplemented with erythromycin to confirm that a double crossover

event had occurred. The colonies that were thiamphenicol resistant and erythromycin sensitive were

selected for further analysis. Genomic DNA was prepared and PCR and Southern blot analysis was

used to confirm that the mutants were derived from double crossover events within the netB gene

region. The PCR primers used are described in Table 1-1, and Southern blot was probed with netB and

catP. The complementation plasmid, pALK20, was constructed by cloning the wild-type netB gene

into the C. perfringens shuttle vector pJIR1457. The complementation plasmid pALK20 and the vector

pJIR1457 were introduced into confirmed mutants by electroporation (Scott and Rood, 1989) and

erythromycin resistant transformants selected.

Construct netB gene knockout mutants in C. perfringens. (As far as we know we are the only group in

the world that is able to do this in a chicken isolate of C. perfringens). Specific gene knockout or gene

replacement is achieved by constructing suicide plasmid vectors containing the mutated gene flanked

by long regions of DNA homologous to the genomic region into which the mutated gene is targeted.

By selecting very particular C. perfringens strains that are relatively highly transformable and

8

competent for homologous recombination it is possible to pick rare transformants of the desired

genotype. We have already made such mutants in one strain of C. perfringens.

Table 1-1. Plasmids used in this project

Plasmids

pJIR1457 EmR oriCP oriEC oriT (Lyras and Rood, 1998)

pJIR750 CmR oriCP oriEC (Bannam and Rood, 1993)

pALK1 pSM20 Ω(BamHI-SpeI:pJIR750, 0.9 kb)Δgfp (CmR KnR) (Keyburn et al., 2006)

pALK15

pALK1 Ω(1.9 kb upstream netB fragment,catP,1.4 kb

downstream netB fragment) (CmR KnR) This study

pALK16 pALK15 Ω(erm(B) oriT:pJIR1457, 1.7 kb) (CmRKnREmR) This study

pALK20 pJIR1457 ΩEcoRI:netB+, 1.7 kb) (EmR) This study

pDEST41BA

E. coli expression vector. Expresses recombinant fusion

proteins with an N-terminal NusA and 6x-His tag

This study

a CmR, chloramphenicol and thiamphenicol resistant; KnR, kanamycin resistant; NalR, nalidixic acid resistant;

RifR, rifampicin resistant.

Table 1-2. Primer sequences used for netB mutant study

* Fragment sizes of positive ΔnetB mutants only.

Underlining indicates restriction sites introduced into the primer

Target/Use Primer Sequence Fragment Sizes (bp)

netB AKP78 GCTGGTGCTGGAATAAATGC

AKP79 TCGCCATTGAGTAGTTTCCC 383

netB suicide construction AKP60 GCAATTGGCAAGATCATAAAATAGAA

AKP61 CCCTAGGTATTTTCTTATCGCTACTTG 1490

AKP58 GGGATCCAATTGTAAACATTCCTGATA

AKP59 AGCTAGCTATTATTATTTACATCAGCACTTT 1937

ΔnetB PCR analysis AKP53 AAGTGCTGCAGTCCAATTATG

AKP8 TGATTCCTATTTTTACTATGG 2765*

AKP48 TTGCTCTAGCAAGCCCATTC

AKP7 CTTTTCCTTTATTTGTGTGAT 3067*

AKP47 CCGCTTCACATAAAGGTTGG

AKP49 CTGTTCCATTCCCTTGAGGA 1700* (1268 bp for

WT)

9

Oral challenge model

The NE disease induction model was performed as previously described (Keyburn et al., 2006). Days

of challenge differ by 7 days depending on whether the trial was used for virulence studies or vaccine

studies. Briefly, commercial 1-day-old Ross 308 broiler chickens were fed an antibiotic-free chicken

starter diet containing 20% protein for 13 days. On day 14 feed was changed to a wheat-based feed

containing 50% fishmeal. On day 20, feed was withdrawn and each bird was orally challenged with

1.5 ml of C. perfringens culture (109 to 1010 CFU). On day 21 birds were again orally challenged and

feed contaminated with C. perfringens was administered on reintroduction of feed. C. perfringens

strains were grown in FTG broth with the addition of 1.5% soluble starch and 2% thiopeptone and

incubated at 37°C for 14 h. Groups of 10 chickens were kept in adjacent separate pens in an animal

PC2 isolation facility. Chickens were euthanased with inhaled carbon dioxide gas and their small

intestines (duodenum to ileum) examined for gross necrotic lesions. Intestinal lesions in the small

intestine (duodenum to ileum) were scored as follows: 0 = no gross lesions; 1 = thin or friable walls;

2 = focal necrosis or ulceration (1-5 foci); 3 = focal necrosis or ulceration (6-15 foci); 4 = focal

necrosis or ulceration (16 or more foci); 5 = patches of necrosis 2-3 cm long; 6 = diffuse necrosis

typical of field cases (Figure 1-1). C. perfringens was recovered from the intestines of killed chickens

by culturing on TSC agar.

Figure 1-1. Scoring scheme used for scoring NE lesions.

Purification of recombinant NetB and generation of rabbit anti-rNetB serum

10

The netB gene was amplified by PCR ,cloned into the Gateway™ entry vector pENTR/SD/D-TOPO

(Invitrogen) and transferred into the modified Gateway™ expression vector pDest41BA (Table 1-1).

The recombinant fusion protein was purified on a nickel affinity column followed by gel filtration on

Superdex 200. Peak fractions were pooled and the 6xHis tag cleaved using TEV protease and reloaded

onto a nickel column to remove both uncleaved protein and the TEV protease. Recombinant protein

(~1.3 mg) was sent to Chemicon (Chemicon-Millipore) for antibody production in rabbits. The rNetB-

toxin antiserum was used in Western blot analysis of C. perfringens strains and for neutralization

studies. In the latter studies antisera raised against recNetB was incubated with semi-purified native

NetB toxin (1:20) for 1 h at room temperature before being tested in the LMH cytotoxicity assay. Pre-

immune sera and untreated toxin were used as controls.

Cell lines and cytotoxicity assay

The chicken hepatoma cell line LMH (ATCC CRL-2117) was maintained in Earl’s minimum essential

medium (EMEM) supplemented with L-glutamine, 10% fetal calf serum (FCS), 10mM 4-(2-

hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 100 U/ml penicillin, 100 µg/ml streptomycin

and 100 µg/ml Fungizone (LMH cells also require 0.2% gelatin for adherence to surfaces). Cells were

incubated in a humidified environment of 5% CO2 at 37oC. To test for cytotoxicity cell lines were

cultured to 70% confluence in 24 well plates (Nunc) and grown in their respective growth medium at

37oC. Culture supernatant or semi-purified toxin was added to the medium and diluted in two-fold

steps across the plate, to a dilution of 1:512, and incubated for up to 16 h at 37oC. Both visual

cytopathic effects and lactate dehydrogenase (LDH) release in the supernatant was used as an indicator

of cytolysis. The Cyto-Tox (Promega) kit was used to measure LDH release and the results expressed

as percentage cytotoxicity.

Results and Discussion

Prevalence of netB in C. perfringens isolates from chickens

The goal of this work was to survey C. perfringens isolates from NE diseased birds and normal healthy

birds to compare the carriage of the netB gene. We were interested to know if the gene was present in

all disease isolates, thus indicating that NetB is likely to be the major virulence factor in all disease

causing strains, and hence a vaccine directed against the toxin my have universal application. C.

11

perfringens from healthy birds were screened to determine if the strains commonly circulating in birds

have pathogenic potential or whether they are generally distinct non-pathogenic strains.

PCR analysis of C. perfringens isolates from both healthy and diseased chickens was used to

determine whether the isolates carried netB. Positive C. perfringens strains gave a 383 bp PCR product

from internal netB sequences (Figure 1-2a). The netB gene was present in 70% (31/44) of the strains

isolated from diseased birds: 3 out of 4 isolates from Belgium were netB positive, 5 out of 7 from

Denmark, 19 out of 24 Australian isolates and 4 out of 9 Canadian strains (Table 1-2). By contrast,

only 2 of 55 isolates from healthy chickens from Australia and Belgium carried netB. In a survey of

32 C. perfringens strains of non-chicken origin none carried the netB gene.

Western blot analysis was carried out using rabbit anti-serum against rNetB (Keyburn et al., 2008); for

those strains positive for NetB toxin, a single immunoreactive band was present at approximately 33

kDa (Figure 1-2b). The results (Table 1-3) showed that there was an absolute correlation between for

the presence of the gene, as detected by PCR, and the ability to produce the NetB toxin.

Figure 1-2. Detection of the netB gene and NetB protein. (a) The presence of the netB gene in C. perfringens isolates was investigated by PCR as detailed in methods. The diagnostic band of 383 bp is seen. (b) Western blot to detect NetB expression. Culture supernatant of C. perfringens isolates were separated by SDS-PAGE and probed with rabbit polyclonal anti-rNetB antibody. The NetB band can be seen at 33 kDa.

38

28

383

a

b

12

Table 1-3. PCR, Western and sequence for NetB from C. perfringens strains isolated from diseased

birds.

a Aus, Australia; Can, Canada; Bel, Belgium; Den, Denmark b PCR analysis of C. perfringens strains, + indicates netB positive product of 383 bp was

amplified, - indicates no amplification product c Western blot results probing with rNetB anti-serum, + indicates product of 33 kDa, -

indicates no product

Strain Sourcea netBb NetBc netB sequenceNAG-NE1 Aus - - NA EHE-NE3 Aus + + Con EHE-NE4 Aus + + Con EHE-NE5 Aus + + Con EHE-NE7 Aus + + G769A (A168T) EHE-NE9 Aus + + G769A (A168T) EHE-NE13 Aus + + Con EHE-NE14 Aus + + Con EUR-NE15 Aus + + Con EHE-NE16 Aus + + Con EHE-NE17 Aus + + Con EHE-NE18 Aus + + Con EHE-NE20 Aus + + Con EHE-NE21 Aus + + Con EHE-NE22 Aus + + Con NAG-NE23 Aus - - NA NAG-NE24 Aus - - NA NAG-NE25 Aus - - NA UNK-NE30 Aus + NAG-NE31 Aus + NAG-NE32 Aus + BER-NE33 Aus - NA SOM-NE34 Aus + SOM-NE35 Aus + GrE ABAT Can + Con 3MB 2003 Can + G769A (A168T) 6MB 2006 Can + Con PF3 Can - NA SHY07 383 Can - NA ENV D4 Can - NA R04-134T Can - NA R04-104 Can - NA R03-382 Can + 48 Bel - - NA 61 Bel + + Con 56 Bel + + Con 37 Bel + + G769A (A168T) 200302-1-1-Ba Dan + + Con 99.63206-34 Dan + + G769A (A168T) 97.78247-2 Dan - - NA 75.65948-1 Dan + + Con 00.82196-2 Dan - - NA 98.78718-2 Dan + + Con 301001-1-B1 Dan + + G769A (A168T)

13

The netB sequence is highly conserved

If NetB is to be used as a vaccine antigen it is important to understand the natural sequence variation

that is present in the circulating C. perfringens strains. High levels of sequence conservation would

indicate that a vaccine based on a single prototype NetB toxin would be sufficient to raise an effective

immune response against all pathogenic strains. A high degree of sequence variation may indicate that

multiple different forms of NetB would have to be included in a vaccine.

A PCR product encompassing the complete netB gene was amplified from 23 netB-positive strains and

sequenced to determine the deduced amino acid sequence of the encoded 322 amino acid full-length

NetB proteins. The toxins were all highly conserved in both nucleotide and amino acid sequence; only

one different NetB sequence type was identified amongst these isolates, even though they represented

several outbreaks of necrotic enteritis from different geographical locations (Table 1-3). The netB

nucleotide sequences of 15 of these strains were identical to the previously determined EHE-NE18

sequence, across the entire region analysed. The remaining 8 strains had very few nucleotide changes,

which were represented in several strains from different countries. Only one change resulted in a NetB

amino acid sequence change, altering the alanine residue at position 168 to threonine (A168T). The six

strains that had this change included isolates from Australia, Canada, Denmark and Belgium (Table 1-

3). Finally, analysis of the non-coding regions surrounding the netB gene showed that they were very

well conserved. Only three changes were observed, in a total of 5 strains. One of these changes

involved an insertion of 10 additional nucleotides when compared to EHE-NE18. However, all

changes are downstream of the netB ORF and are unlikely to alter gene expression.

NetB (A168T) retains cytotoxic activity

To determine if the single amino acid change at residue 168 of NetB affects its cytotoxic activity,

culture supernatants from several strains producing the variant toxin were tested in the LMH cell

cytotoxicity assay (Figure 1-3). LDH release was used as a measure of cytotoxicity. The results

showed that all five of the NetBA168T variants tested had similar toxicity for LMH cells as NetB from

EHE-NE18. In addition, when supernatants from either NetB or NetBA168T derivatives were pre-

incubated with antiserum raised against the E. coli-derived recNetB protein, a marked reduction in

LDH release was observed. This indicated that the cytoxicity resulted from NetB activity and not any

14

other toxic moieties produced by the different strains. Incubation with pre-immune serum did not

affect the cytotoxic activity of any of the NetB variants.

Figure 1-3. Cytotoxic activity of NetB (A168T) supernatants on LMH cells. The LMH cells were grown to 70% confluence in a 96 well tissue culture plate and culture

supernatant added to the medium for 4 h at 37oC. Cytotoxicity was measured by release of

LDH from the the LMH cells using the CytoTox kit (Promega). Legend: A. EHE-NE18; B.

EHE-NE7; C. EHE-NE9; D. 3MB-2003; E. 37; F. 301001-1-B1. 1 dialyzed culture

supernatant ; 2, culture supernatant pre-incubated with pre-immune serum for 1 h at 37oC;

3, culture supernatant pre-incubated with rNetB antiserum for 1 h at 37oC. The values are

averages of triplicate assays with error bars representing SD.

The netB mutants do not produce NE in a chicken disease model To determine the in vivo relevance of NetB we tested the pathogenicity of a netB mutant strain, firstly

by directly observing the cytopathic effects of culture supernatant on LMH cells and then in an NE

disease induction model. The cytopathic assay clearly demonstrated that the supernatant from the netB

mutant strain (ΔnetB1) did not damage LMH cells whereas the supernatants from the wild-type strain

(NE18) and the complemented mutant strain did cause cytopathic effects (Figure 1-4).

1A 2A 3A 1B 2B 3B 1C 2C 3C 1D 2D 3D 1E 2E 3E 1F 2F 3F0

50

100

150

Strains

% C

ytot

oxic

ity

15

Figure 1-4. Cytopathic effects of C. perfringens culture supernatants on LMH cells.

Groups of 10 Ross 308 broiler chickens were challenged with wild-type strain EHE-NE18, the

isogenic NE18ΔnetB1 mutant, or the complemented NE18ΔnetB1 strainsl. No NE lesions were

detected in birds infected with the netB mutant or the mutant complemented with the vector plasmid

pJIR1457. By contrast, significant levels of disease were detected in birds infected with the wild-type

parent strain (P<0.01) or the strain complemented with the netB+ plasmid pALK20 (P<0.05) (Figure 1-

5). Similar results were obtained in independent virulence trials and also with wild type and mutant

strains of the Belgium isolate 56. Bacteria were cultured from the intestines of birds from all groups

and with one exception only the infecting strain was isolated from the lesions. In one of the trials, two

birds in the netB mutant challenge group showed a small number of lesions typical of NE. However,

no thiamphenicol resistant C. perfringens were isolated from these birds and it was concluded that

these lesions were likely to have been caused by environmental or endemic C. perfringens isolates

present in the birds independent of the challenge strains. Analysis of bacteria isolated from the birds

infected with the complemented strains indicated that there was a level of plasmid loss occurring in

these groups, especially from those birds where no disease was observed (data not shown). Indeed, in

those birds that showed disease signs, recombinant plasmid stability in bacteria isolated from the

16

lesions was estimated at 70-100% while the stability in bacteria recovered from the luminal content of

birds without disease was only 10-50%.

Figure 1-5. Virulence of C. perfringens strains in the NE challenge model. The

lesion scores of individual 24-day-old broiler chickens challenged with different

C. perfringens strains are shown. Each group consisted of ten birds. The solid

horizontal bars represent the average lesion score in each group. Intestinal lesions

in the small intestine (duodenum to ileum) were scored as followed: 0, no gross

lesions; 1, thin or friable walls; 2, focal necrosis or ulceration (one to five foci); 3,

focal necrosis or ulceration (six to 15 foci); 4, focal necrosis or ulceration (16 or

more foci); 5, patches of necrosis 2–3 cm long; 6, diffuse necrosis typical of field

cases. The results are from two separate trials. The strains tested are as follows:

EHE-NE18, wild-type; ΔnetB, NE18ΔnetB1; ΔnetB Comp,

NE18ΔnetB1(pALK20); ΔnetB1 + pJIR1457, NE18ΔnetB1(pJIR1457). One-

tailed, nonparametric t-test analysis of the challenge (EHE-NE18) and

complemented mutant derivatives against NE18ΔnetB1 showed a statistical

difference (**, p < 0.01 and *, p < 0.05) but no statistical significance was

observed between the mutant and the plasmid control.

The demonstration of the in vivo importance of the netB gene was a critical GO/NO GO point for the

project. The clear demonstration that the netB gene was of high importance in the virulent phenotype

17

of pathogenic C. perfringens strains indicates that NetB is an excellent candidate for vaccine

development. This work has been peer reviewed and published in the high impact journal PLoS

Pathogens (Keyburn et al. 2008).

C. perfringens isolates lacking netB do not cause disease

Although we have clearly shown that NetB is an essential virulence factor in the strain EHE-NE18

there are several published studies (Chalmers et al. 2008b; Keyburn et al. 2008; Martin and Smyth

2008), including our own work detailed above (Table 1-3), that show that a number of strains isolated

from diseased birds do not carry the netB gene. The question therefore arises as to whether these netB

negative strains produce an alternative toxin that is responsible for necrotic enteritis. We tested the

virulence of 11 netB positive and 7 netB negative strains in our oral challenge disease induction model.

All eleven netB containing strains caused disease in the disease induction model (Table 1-4). However,

the seven netB-negative C. perfringens strains, all of which were derived from birds suffering from

necrotic enteritis, induced little or no signs of disease when used to challenge chickens. In the NAG-

NE25 (netB-negative) challenge, the C. perfringens cells recovered from the few small lesions

(approximately 1 mm in diameter) were clearly from a different source (presumably environmental) as

PCR analysis showed that they carried netB.

Table 1-4. Disease induction by netB positive and negative isolates.

Strain Sourcea netBb % disease inductionc

NAG-NE1 Aus - 0 EHE-NE5 Aus + 47 EHE-NE13 Aus + 87 EUR-NE15 Aus + 75 EHE-NE18 Aus + 100 NAG-NE24 Aus - 0 NAG-NE25 Aus - 11 UNK-NE30 Aus + 154 NAG-NE31 Aus + 68 BER-NE33 Aus - 0 SOM-NE34 Aus + 46 SOM-NE35 Aus + 77 GrE ABAT Can + 77 6MB 2006 Can + 77 PF3 Can - 0 48 Bel - 0 56 Bel + 80 97.78247-2 Den - 0

a Aus, Australia; Can, Canada; Bel, Belgium; Den, Denmark

18

b PCR analysis of C. perfringens strains, + indicates netB positive product of 383

bp was amplified, - indicates no amplification product c Results of strain use in disease induction model. The results are derived from a

series of independent trials. To allow a simple comparison of all the results, the

average lesion score for each group was compared to the lesion score for EHE-

NE18 challenge in the same trial (included in all trials as our standard challenge

strain).

No confirmed netB negative isolates were able to induce disease whereas a range of netB positive

strains, from different geographical locations, were able to induce lesions typical of necrotic enteritis.

These results demonstrate that isolates are not capable of causing disease without NetB. Of course, we

cannot categorically rule out the possibility that our disease induction model does not give a

completely accurate indication of the potential of these netB negative isolates to cause disease in the

field either by themselves or as part of a wider microbial consortium. The results reported here are

entirely consistent with our previous conclusion that NetB is important and most likely essential for

virulence.

This work demonstrates that it is important when testing any isolates (e.g. netB-negative strains) in a

disease model to test the genotype of isolates recovered from lesions. The nature of the disease and the

model systems are such that occasionally environmentally derived C. perfringens can initiate lesion

formation and it is important to differentiate such lesions from lesions caused by the test organism.

Other researchers have reported that some strains isolated from necrotic enteritis-affected chickens

(Chalmers et al. 2008b; Cooper and Songer 2009) and strains from healthy birds (Timbermont et al.

2009), are not virulent in disease induction models, but the netB status of these strains was not

reported.

We postulate that these non-disease causing isolates that originate from disease lesions were either part

of a mixed infection or, more likely, have lost the netB gene. Previous work has suggested that

although different strains of C. perfringens can coexist in the cecum of healthy birds usually only one

strain is involved in disease lesions in any particular bird (Engstrom et al. 2003; Nauerby et al. 2003).

It would therefore seem unlikely that many of the apparently non-pathogenic isolates from diseased

birds could result from mixed cultures of pathogenic and non-pathogenic strains coming from the

sampled lesions. One possible explanation to consider is that the isolates have lost virulence during the

in vitro culturing process that is necessary to derive a pure, defined culture from a lesion sample. We

have shown in other work (CRC Project 09-25) that netB is located on a plasmid. It is possible that the

plasmid may be somewhat unstable and sometimes lost on in vitro culture.

19

The generally accepted model (Van Immerseel et al. 2009) for the development of necrotic enteritis in

chickens proposes that C. perfringens normally resides in the gastrointestinal of birds, essentially

behaving as a benign commensal organism. Some type of physiological, environmental or nutritional

change or stress, results in overgrowth of the resident C. perfringens population, resulting in lesion

formation. This study and other reports in the literature (Chalmers et al. 2008a and 2008b; Drigo et al.

2008; Keyburn et al. 2008; Martin and Smyth 2008) are giving a different picture of the disease

process. It is now clear that the overall gastrointestinal population of C. perfringens in the normal

healthy chicken is different to that of the organisms that cause disease. The netB-positive organisms

commonly found in lesions make up only a small proportion of the C. perfringens population seen in

healthy birds. It now remains to be determined whether the increase in overall C. perfringens numbers

that occurs during the disease process is due to a specific increase in the number of netB-positive

organisms or whether there is a general overgrowth of all C. perfringens cells but only the netB

positive strains colonise, proliferate and cause cell and tissue damage.

20

Chapter 2 - Necrotic enteritis vaccine development

Introduction

The work reported in Chapter 1 clearly demonstrated the central role that NetB has in the pathogenesis

of C. perfringens induced necrotic enteritis in chickens. As NetB is essential for pathogenesis it is a

good target for vaccine development. An immune response directed at NetB should block its action

and hence stop the development of disease. This project aimed to evaluate three types of vaccine

which could be developed based on our knowledge of NetB; (i) a subunit vaccine using recombinant

NetB, (ii) conventional bacterin vaccines supplemented with recNetB, and (iii) live attenuated C.

perfringens strains with the netB gene inactivated. The first two vaccine formats are likely to be easier

to register and so that is where our major efforts were directed.

Materials and Methods In-feed challenge model

After incubation under anaerobic conditions (5% H2:5% CO2:90% N2) at 37 °C for 24 h, 1–2 colonies

of the challenge C. perfringens strains were transferred into 10 ml cooked meat medium (CMM;

Difco) in Hungate tubes and incubated in the same atmosphere at 37 °C for 18 h. The resulting culture

was used to inoculate 100 ml fluid thioglycollate broth (FTG; Difco), which, after incubation as

before, was diluted 1:10 in CMM and incubated as before. Twenty millilitres of the CMM culture was

used as inoculum for 1 L FTG medium and after 18 h incubation this was mixed with feed for

challenge. A separate serially passed culture was prepared for each challenge feeding. Birds were

inoculated on days 15–18 for challenge studies and on days 25-28 for vaccine studies. High protein

feed and FTG medium culture were mixed in a ratio of 3:4 (v/v). The mixture, which had a paste-like

consistency, was then placed in feed trays. Trays were cleaned and remaining feed discarded prior to

each subsequent feeding. Negative control birds were challenged with un-inoculated FTG mixed with

high protein feed at the same ratio. Birds were euthanized and intestinal lesion scored as described in

the oral challenge model (Chapter 1). In vaccine studies, terminal bleeds were taken and serum

collected and stored at -20 oC for further analysis.

21

NetB subunit vaccine

Recombinant NetB expressed in E. coli was purified as described above. Each dose contained 50 µg of

recNetB. In the majority of trials the adjuvant Alum was used as per manufacturer’s instructions.

CSIRO patented triple adjuvant was also used consisting of Quil A, DEAE and Montanide.

Bacterin vaccine

C. perfringens strain EHE-NE18 was grown in 1L TPG broth to a turbidity at 600 nm of 0.6.

Formaldehyde solution was added to the culture to a final concentration of 0.3%. Culture supernatant

and bacterial cells were obtained by centrifugation at 18,000 g for 10 min at 4 oC. Culture supernatant

was concentrated 50x by ultrafiltration. Bacterial cells were resuspended in 0.3% formaldehyde in

PBS and sonicated to release cytostolic proteins. The final bacterin preparation was a 1:1 mix of cells

and concentrated supernatant.

NetB ELISA

For serum ELISA, recombinant NetB purified from E. coli was used as a coating antigen. An end-

point dilution method was used to determine antigen-specific antibody titres by ELISA in vaccinated

chickens in comparison to their concurrent control. Microtiter plates (Maxisorp, NUNC) were coated

with purified protein (3 μg/ml in 0.1 M carbonate buffer, pH 9.6) overnight at 4 °C. Blocking was

carried out by shaking at room temperature (RT) for 1 h with PBS containing 1% Na Casein. Sera

from birds immunized with vaccines together with controls, were diluted in PBS containing 1% Na

Casein and incubated with shaking for 1 h with protein-coated plates at RT. Horse-radish peroxidase

(HRP)-conjugated goat anti-chicken IgY (diluted 1:5000 in 1% Na Casein PBS; Chemicon

International) was used as secondary antibody and the colour reaction was developed by using

3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide. After stopping the reaction with 0.5 M

H2SO4, the absorbance at 450 nm was measured in an ELISA plate reader.

Results and Discussion

Recombinant NetB sub-unit vaccination

22

Recombinant NetB was produced in the Protein Production Unit of the Department of Biochemistry

and Molecular Biology, Monash University. The protein was expressed as a polyHis-NusA-NetB

fusion protein in Escherichia coli. The fusion protein was first recovered on a nickel column then

purified on a gel filtration column. NetB protein was released from the fusion protein by digestion

with TEV protease and re-purified by collecting the flow-through from a nickel column. The quality of

the recNetB used for vaccination studies is shown in Figure 2-1.

Figure 2-1. Bioanalyzer profile of recNetB preparations (1, 2, 3) used for vaccination.

The NetB recombinant protein, formulated in alum as a subunit vaccine, was tested in the oral

challenge disease induction model over a series of trials (Table 2-1). In Trial 1193-4 the NetB vaccine

gave a good, statistically significant, level of protection against necrotic enteritis in chickens compared

to the unvaccinated control groups. In Trial 1219-1 the level of protection was less pronounced but a

moderate level of protection was still achieved. In the third trial, 1250-5, higher levels of recNetB

were used in the vaccines. Each bird in the 3x group had 150 µg of recNetB per vaccination and the

10x group each had 500 µg per dose. No necrotic lesions were seen in either of the vaccine groups

however the level of disease generated in this trial was quite low as can be seen in the lesion score for

the positive control group. A difficulty in achieving adequate disease levels has been a recurring

problem with recent trials.

23

Table 2-1. Independent trials testing the protective efficacy of NetB subunit vaccine.

Trial 1193-4

Group No. in pool Average lesion score

Number affected (Normalised to

group of 10)

Average x Number (Normalised to

group of 10) Positive control (No vaccination, NE18 challenge)

25 1.44 4.4 7.6

Adjuvant control (NE18 challenge)

27 1.74 5.93 12.37

NetB vaccine (NE18 challenge)

18 0.21 2.1 0.46

Unpaired t test of the lesion scores shows that the difference between the NetB group and the Adjuvant

control group is statistically significant at 95% confidence (P=0.0103).

Trial 1219-1

Group No. in pool Average lesion score

Number affected Average x Number (Normalised to

group of 10) Positive control (No vaccination, NE18 challenge)

9 2.33 7 18.1

Adjuvant control (NE18 challenge)

8 1.5 4 7.5

NetB vaccine (NE18 challenge)

11 0.64 3 1.74

Trial 1250-5

Group No. in pool Average lesion score

Number affected Average x Number (Normalised to

group of 10) Positive control (No vaccination, NE18 challenge)

11 0.91 4 3.31

NetB (3X dose) (NE18 challenge)

11 0 0 0

NetB (10X dose) (NE18 challenge)

11 0 0 0

An ELISA to detect antibody levels to NetB was used to determine if there is a correlation between

protection and antibody levels (Figure 2-2). Overall as a group, there was a strong correlation between

NetB specific IgY serum levels and protection (Figure 2-2a). However, looking at individual birds

there appears to be no direct correlation between IgY levels and protection (Figure 2-2b).

24

a. b.

Figure 2-2. NetB specific ELISA of birds vaccinated with rNetB and challenged with EHE-NE18.

Serum from birds were used as primary antibodies (1:50) and HRP-conjugated goat anti-chicken IgY

were used as secondary antibodies (1:5000). Each serum was assayed in triplicate. (a) represents

average ELISA readings of each treatment group, and standard error is represented by the error bars;

(b) a selection of individual birds from rNetB vaccinated groups. Red indicates those birds that had

lesion scores of 2 and above. Standard deviation is represented by the error bars

Bacterin vaccine studies

Bacterin vaccines supplemented with or without recombinant NetB have been tested in chickens for

immunogenicity. Immunological testing has demonstrated that bacterin supplemented with

recombinant NetB induced a greater response to NetB than that found with unsupplemented bacterin

(Figure 2-3). This indicates that the natural amount of NetB present in culture supernatants is not

sufficient to produce an optimal immune response. We have conducted a number of NE challenge

trials using our standard oral challenge method (but one week later than usual to accommodate the

vaccination schedule) with the bacterin vaccines but we have not been able to generate any vaccine

efficacy data as in each case the disease induction process failed. To address this issue we have

evaluated an in-feed challenge method in which very large amounts of C. perfringens culture is mixed

with feed and given to the birds every morning and night over a 3-5 day period. We have had some

success in using this challenge method on older birds and so have used this method in our latest

vaccination trial.

\

Group 2

Adjuvant

Group 10

Adjuva

nt

Group 6

NE18

Group 15

NE18

Group 18

NetB

Group 21

NetB

0.0

0.2

0.4

0.6

0.8

Abs

450n

m

G18B1

G18B3

G18B4

G21B1

G21B3

G21B5

G21B6

G21B10

0.0

0.2

0.4

0.6

0.8

Abs

450n

m

25

Figure 2-3. Western blots of birds immunized with bacterin with and without supplemented rNetB

Birds were vaccinated at 11 and 20 days of age and then challenged with an in-feed challenge at days

25-28 followed by necropsy and lesion scoring at day 29. The results are shown in Table 2-2.

Table 2-2. Trial results for bacterin based vaccines.

Trial 1325-4

Group No. in pool Average lesion score

Number affected Average x Number (Normalised to

group of 10) Positive control group 1 (No vaccination, NE18 challenge)

12 2.00 8 13.3

Positive control group 2 (No vaccination, NE18 challenge)

12 2.00 7 11.7

Adjuvant control (NE18 challenge)

12 2.25 8 15.0

Bacterin vaccine (NE18 challenge)

12 1.08 6 5.4

Bacterin + recNetB vaccine (NE18 challenge)

11 0.55 3 1.5

recNetB vaccine (NE18 challenge)

12 1.5 6 7.5

A Mann-Whitney non-parametric statistical test shows that the bacterin plus recNetB vaccine gave a

significant level of protection, P = 0.034, when compared to either the first unvaccinated control

26

groups or the control group that was vaccinated with the adjuvant (Triple Adjuvent), P = 0.0144 if all

the control groups are combined to give more statistical power. The bacterin vaccine group had a

reduced lesion score but this reduction was not statistically significant with the small group size used

in this trial. Like wise the recNetB vaccinated group had a lower lesion score than the control groups,

although not statistically significant. It was when these two vaccine preparations, the bacterin and the

recNetB were combined that the best protection was achieved. These results are very encouraging and

indicate that a protective vaccine is achievable. The challenge now is to determine a deliver strategy

that will be effective and commercially attractive; clearly the present approach of subcutaneously

vaccinating birds twice is unlikely to be viable.

Immunogenicity of attenuated strains

We had intended to test the netB knockout strain (attenuated mutant) for immunogenicity and

protection in chickens. However, due to difficulties in establishing an appropriate disease model, we

have not yet been successful with this evaluation. In an effort to resolve the difficulties in the disease

induction model, challenge optimization trials have been conducted. As mentioned above we have

successfully investigated a heavy in-feed dosing regimen. Also, working with our oral challenge

model we have tested different grades and sources of fish meal, different C. perfringens culturing

methods, different times of challenge, the effects of hard water, different bedding materials and

different environmental conditions. It has become clear that the biggest influence on challenge success

is the time that it is done; challenge before the birds are 3 weeks of age is generally successful whereas

challenge after that is very variable and often fails.

We have also had reason to rethink the wisdom of producing a live attenuated vaccine. Recent studies

carried out in collaboration with Monash University have shown that the netB gene is on a conjugation

plasmid. This has significant implications for this type of vaccine. It is possible that an attenuated

vaccine strain could act as a recipient for a wild-type plasmid (carrying an intact netB gene) from an

environmental strain and thus revert the vaccine strain to a virulent strain. It is for this reason that most

of our effort has gone into evaluating the subunit and supplemented bacterin vaccines.

27

Discussion of Results

The central role of NetB in the pathogenesis of necrotic enteritis has been proven. We have shown that

most C. perfringens isolates from clinical disease cases carry the netB gene and in all cases gene

carriage coincides with expression of the protein in culture supernatant. Disease isolates that do not

carry the netB gene were not capable of inducing disease in our standard oral challenge model. These

isolates could result from mixed cultures in lesions or loss of netB during the recovery and culture of

the bacteria. In the oral challenge model there is an absolute correlation between carriage of netB and

disease induction; no netB-negative isolates cause disease and all netB-positive isolates do cause

disease, although the severity of disease is variable, indicating that other factors can also influence

virulence. The netB gene is highly conserved, in the strains that we surveyed there was only a single

variant type in which an amino acid was changed. This variant retained full biological activity and was

recognised by anti-sera raised to the originally defined NetB. It is very unlikely that this variant would

not be recognised by an immune response to the original NetB, hence sequence/antigen variation

should not be an issue for vaccine development.

In order to generate an appropriate immune response to antigens we have had to vaccinate first at 7-11

days of age and then re-vaccinate at 18-20 days of age. This has meant that the birds could not be

challenged until they were about 4 weeks of age. In a normal challenge trial the birds are challenged at

days 20 and 21. However, for vaccine trails we have been challenging a week later (days 27 and 28) to

allow the chickens to generate an antibody response to the vaccine antigen. This delay in challenge has

introduced considerable variation in the reproducibility of the induction model. We have tried in

various ways to optimise the challenge model so that it is more robust and reproducible when doing

vaccine trials and one solution to the problem has been to use a very heavy in-feed challenge. The

difficulties with the model have somewhat limited our progress in testing all the vaccine formats that

we had intended but we have been able to demonstrate that recombinant NetB gives a reasonable level

of protection, and possibly very good protection when used at higher doses. The most reliable trial

results showed that recombinant NetB added to a killed, whole cell bacterin gave the best levels of

protection.

This project has established the value of NetB in the design of vaccines against necrotic enteritis.

Work is now needed to optimise the vaccine efficacy and move towards a commercially viable

vaccine.

28

Implications

• There is now overwhelming evidence that NetB is the key major virulence factor in C. perfringens

strains that cause necrotic enteritis in chickens.

• As NetB is such an essential factor in the pathogenesis of the disease it is an excellent candidate

for use in a subunit vaccine.

• Vaccination tests have shown that recombinant NetB can indeed give a good level of protection

from disease.

• The best level of protection has been achieved with a whole cell bacterin preparation

supplemented with recombinant NetB.

• Good progress has been made towards providing the industry with an alternative means of

controlling necrotic enteritis.

Recommendations

• Development of a necrotic enteritis vaccine should continue, with NetB as a lead antigen.

• Ways to enhance vaccine efficacy should be tested, e.g. better adjuvants, co-administration of

cytokines, live delivery to the mucosal surface and incorporation of other recombinant antigens.

• Vaccination of hens should be part of the vaccine assessment.

• It would be valuable to have a commercial partner involved to direct the research towards the most

commercially viable solutions.

29

Publications arising from project

Patent

• Moore, R.J., Keyburn, A., and Rood, J.I. Novel toxin, Preliminary patent application, 8 June

2007, US Serial No. 60/942858.

Peer reviewed publications

• Keyburn, A.L., Yang, X., Bannam, T.L., Van Immerseel, F., Rood, J.I., and Moore, R.J.. (2010)

Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB

toxin. Veterinary Research. 41:21

• Van Immerseel, F., Rood, J.I., Moore, R.J. and Titball, R.W. (2009) Antibiotics in animal

feedstuffs; resolving one problem creates another - necrotic enteritis. Trends in Microbiology

17:32-36.

• Keyburn, A.L., Boyce, J.D., Vaz, P., Bannam, T.L., Ford, M.E., Parker, D., Di Rubbo, A., Rood,

J.I., and Moore, R.J. (2008) NetB, a new toxin is associated with avian necrotic enteritis caused by

Clostridium perfringens. PLoS Pathogens 4:e26.

International conference presentations

• Invited Speaker. The role of NetB toxin in necrotic enteritis. Robert J. Moore, Anthony L. Keyburn,

Trudi L. Bannam, John D. Boyce, Xuxia Yan, Mark E. Ford, Filip Van Immerseel, Julian I. Rood.

6th ClostPath International Conference. Rome, Italy, October 2009.

• Effects of Clostridium perfringens NetB on the small intestines of chickens. Keyburn, A.L., Ford,

M.E., Yan, X., Bannam, T.L., Williamson, M.M., Porter, C.J., Rood, J.I., and Moore, R.J. 6th

ClostPath International Conference. Rome, Italy, October 2009.

National conference presentations

• The role of Clostridium perfringens NetB toxin in necrotic enteritis., Anthony L. Keyburn, Trudi L.

Bannam, John D. Boyce, Mark E. Ford, Julian I. Rood, Robert J. Moore. BacPath 10, Barossa

Valley, South Australia, September 2009.

30

• Effects of Clostridium perfringens NetB on the small intestines of chickens. Keyburn, A.L., Ford,

M.E., T.L., Williamson, M.M., Porter, C.J., Rood, J.I., and Moore, R.J. BacPath 10, Barossa

Valley, South Australia, September 2009.

• Keyburn, A.L., Yan, X., Bannam, T.L., Van Immerseel, V., Rood, J.I., and Moore, R.J. Association

of netB from Clostridium perfringens and necrotic enteritis in chickens. Infection and Immunity

2009, Gold Coast, Queensland, June 2009.

• Putting the Clostridium perfringens Genome to Work: Vaccine Antigens and the Discovery of a

New Virulence Determinant. Moore, R.J., Boyce, J. D., Seemann, T., Harrison, P.F., Bannam,

T.L., Vaz, P., Keyburn, A.L., and Rood, J.I. Australian Society for Microbiology Annual Meeting,

Melbourne, Victoria, July 2008.

• A new toxin associated with avian necrotic enteritis caused by Clostridium perfringens. Keyburn,

A.L., Boyce, J.D., Vaz, P., Bannam, T.L., Ford, M.E., Parker, D., Di Ribbo, A., Rood, J.I., and

Moore, R.J. XXIII World’s Poultry Conference, Brisbane, Queensland, July 2008.

• NetB: A new toxin associated with avian necrotic enteritis caused by Clostridium perfringens and

its use as a vaccine candidate. Keyburn, A.L., Boyce, J.D., Vaz, P., Bannam, T.L., Ford, M.E.,

Parker, D., Di Ribbo, A., Rood, J.I., and Moore, R.J. 10th Avian Immunology Research Group

Conference, Gold Coast, Queensland, June 2008.

• NetB – the next big thing in the vaccine market? Moore, R.J. Australian Poultry CRC Ideas

Exchange, Brisbane, October 2007.

• NetB, a novel Clostridium perfringens toxin that is an essential virulence factor for necrotic

enteritis in chickens. Keyburn, A.L., Boyce, J.D., Vaz, P., Bannam, T.L., Ford, M.E., parker, D.,

Rood, J.I., and Moore, R.J. BacPath9, Lorne, September 2007.

Acknowledgements

This report has been prepared by Rob Moore and Anthony Keyburn. We would like to thank Inghams

staff for supply swabs from healthy chickens for C. perfringens isolations. We would also like to thank

M. Boulianne (Canada) and L. Bjerrrum (Belgium) for supply of disease isolates and Peter Scott and

Soy Rubite for providing access to local disease outbreak material for isolation of pathogenic C.

perfringens strains. We thank the staff of CSIROs Werribee Animal Facility and Dr Mark Ford for

their invaluable assistance in running the animal trials. The recombinant NetB protein used throughout

this work was supplied Dr Noelene Quinsey from Monash University. This project received additional

support from CSIRO and the ARC Centre of Excellence in Structural and Functional Microbial

Genomics.

31

References Al-Sheikhly, F., Al-Saieg, A., 1980. Role of Coccidia in the occurrence of necrotic enteritis of

chickens. Avian Dis 24, 324-333. Al-Sheikhly, F., Truscott, R.B., 1977a. The interaction of Clostridium perfringens and its toxins in the

production of necrotic enteritis of chickens. Avian Dis 21, 256-263. Al-Sheikhly, F., Truscott, R.B., 1977b. The pathology of necrotic enteritis of chickens following

infusion of broth cultures of Clostridium perfringens into the duodenum. Avian Dis 21, 230-240.

Al-Sheikhly, F., Truscott, R.B., 1977c. The pathology of necrotic enteritis of chickens following infusion of crude toxins of Clostridium perfringens into the duodenum. Avian Dis 21, 241-255.

Bains, B.S., 1968. Necrotic enteritis of chickens. Aust Vet J 44, 40. Broussard, C.T., Hofacre, C.L., Page, R.K., Fletcher, O.J., 1986, Necrotic enteritis in cage-reared

commercial layer pullets. Avian Dis 30, 617-619. Chalmers, G., Bruce, H.L., Hunter, D.B., Parreira, V.R., Kulkarni, R.R., Jiang, Y.F., Prescott,

J.F., Boerlin, P., 2008. Multilocus sequence typing analysis of Clostridium perfringens isolates from necrotic enteritis outbreaks in broiler chicken populations. J Clin Microbiol 46, 3957-3964.

Chalmers, G., Martin, S.W., Hunter, D.B., Prescott, J.F., Weber, L.J., Boerlin, P., 2008. Genetic diversity of Clostridium perfringens isolated from healthy broiler chickens at a commercial farm. Vet Microbiol 127, 116-127.

Cooper, K.K., Songer, J.G., 2009. Necrotic enteritis in chickens: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15, 55-60.

Cooper, K.K., Trinh, H.T., Songer, J.G., 2009. Immunization with recombinant alpha toxin partially protects broiler chicks against experimental challenge with Clostridium perfringens. Vet Microbiol 133, 92-97.

Drigo, I., Agnoletti, F., Bacchin, C., Bettini, F., Cocchi, M., Ferro, T., Marcon, B., Bano, L., 2008. Toxin genotyping of Clostridium perfringens field strains isolated from healthy and diseased chickens. Ital J Anim Sci 7, 397-400.

Engstrom, B.E., Fermer, C., Lindberg, A., Saarinen, E., Baverud, V., Gunnarsson, A., 2003. Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet Microbiol 94, 225-235.

Ficken, M.D., Wages, D.P., 1997. Necrotic Enteritis. In: Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald, E. David and Swayne, Editors, Diseases of Poultry, Iowa State University Press, London pp. 261–264.

Gazdzinski, P., Julian, R.J., 1992. Necrotic enteritis in turkeys. Avian Dis 36, 792-798. Heier, B.T., Lovland, A., Soleim, K.B., Kaldhusdal, M., Jarp, J., 2001. A field study of naturally

occurring specific antibodies against Clostridium perfringens alpha toxin in Norwegian broiler flocks. Avian Dis 45, 724-732.

Helmboldt, C.F., Bryant, E.S., 1971. The pathology of necrotic enteritis in domestic fowl. Avian Dis 15, 775-780.

Kaldhusdal, M., Hofshagen, M., 1992, Barley inclusion and avoparcin supplementation in broiler diets. 2. Clinical, pathological, and bacteriological findings in a mild form of necrotic enteritis.

32

Poult Sci 71, 1145-1153. Keyburn, A.L., Boyce, J.D., Vaz, P., Bannam, T.L., Ford, M.E., Parker, D., Di Rubbo, A., Rood, J.I.,

Moore, R.J., 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog 4, e26.

Keyburn, A.L., Sheedy, S.A., Ford, M.E., Williamson, M.M., Awad, M.M., Rood, J.I., Moore, R.J., 2006. The alpha-toxin of Clostridium perfringens is not an essential virulence factor in necrotic enteritis in chickens. Infect Immun 74, 6496-6500.

Keyburn, A.L., Yang, X., Bannam, T.L., Van Immerseel, F., Rood, J.I., Moore, R.J., 2010. Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin. Veterinary Research. 41, 21

Kulkarni, R.R., Parreira, V.R., Jiang, Y.F., Prescott, J.F., 2009. Live oral recombinant Salmonella typhimurium vaccine expressing Clostridium perfringens antigens confer protection of broiler chickens against necrotic enteritis. Clin Vaccine Immunol.

Kulkarni, R.R., Parreira, V.R., Sharif, S., Prescott, J.F., 2006. Clostridium perfringens antigens recognized by broiler chickens immune to necrotic enteritis. Clin Vaccine Immunol 13, 1358-1362.

Kulkarni, R.R., Parreira, V.R., Sharif, S., Prescott, J.F., 2007. Immunization of broiler chickens against Clostridium perfringens-induced necrotic enteritis. Clin Vaccine Immunol 14, 1070-1077.

Long, J.R., 1973. Necrotic enteritis in broiler chickens. I. A review of the literature and the prevalence of the disease in Ontario. Can J Comp Med 37, 302-308.

Lovland, A., Kaldhusdal, M., 2001. Severely impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathology 30, 73-81.

Lovland, A., Kaldhusdal, M., Redhead, K., Skjerve, E., Lillehaug, A., 2004 Maternal vaccination against subclinical necrotic enteritis in broilers. Avian Pathol 33, 83-92.

Martin, T.G., Smyth, J.A., 2008. Prevalence of netB among some clinical isolates of Clostridium perfringens from animals in the United States. Vet Microbiol 136, 202-05.

Nairn, M.E., Bamford, V.W., 1967. Necrotic enteritis of broiler chickens in western Australia. Aust Vet J 43, 49-54.

Nauerby, B., Pedersen, K., Madsen, M., 2003. Analysis by pulsed-field gel electrophoresis of the genetic diversity among Clostridium perfringens isolates from chickens. Vet Microbiol 94, 257-266.

O'Connor, J.R., Lyras, D., Farrow, K.A., Adams, V., Powell, D.R., Hinds, J., Cheung, J.K., Rood, J.I., 2006. Construction and analysis of chromosomal Clostridium difficile mutants. Mol Microbiol 61, 1335-1351.

Parish, W.E., 1961a. Necrotic enteritis in the fowl (Gallus gallus domesticus). I. Histopathology of the disease and isolation of a strain of Clostridium welchii. J Comp Pathol 71, 377-393.

Parish, W.E., 1961b. Necrotic enteritis in the fowl. II. Examination of the causal Clostridium welchii. J Comp Pathol 71, 394-404.

Sambrook, J., Fritsch, E.F., Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, NY., Cold Spring Harbor Laboratory Press).

Scott, P.T., Rood, J.I., 1989. Electroporation-mediated transformation of lysostaphin-treated Clostridium perfringens. Gene 82, 327-333.

Sheedy, S.A., Ingham, A.B., Rood, J.I., Moore, R.J., 2004. Highly conserved alpha-toxin sequences of avian isolates of Clostridium perfringens. J Clin Microbiol 42, 1345-1347.

Songer, J.G., 1996. Clostridial enteric diseases of domestic animals. Clin Microbiol Rev 9, 216-234. Springer, S., Selbitz, H.J., 1999. The control of necrotic enteritis in sucking piglets by means of a

Clostridium perfringens toxoid vaccine. FEMS Immunol Med Microbiol 24, 333-336.

33

Thompson, D.R., Parreira, V.R., Kulkarni, R.R., Prescott, J.F., 2006. Live attenuated vaccine-based control of necrotic enteritis of broiler chickens. Vet Microbiol 113, 25-34.

Timbermont, L., Lanckriet, A., Gholamiandehkordi, A.R., Pasmans, F., Martel, A., Haesebrouck, F., Ducatelle, R., Van Immerseel, F., 2009. Origin of Clostridium perfringens isolates determines the ability to induce necrotic enteritis in broilers. Comp Immunol Microbiol Infect Dis 32, 503-512.

Uzal, F.A., Kelly, W.R., 1998. Protection of goats against experimental enterotoxaemia by vaccination with Clostridium perfringens type D epsilon toxoid. Vet Rec 142, 722-725.

Van der Sluis, W., 2000a. Clostridial enteritis - a syndrome. World Poultry 16, 56-57. Van der Sluis, W., 2000b. Clostridial enteritis is an often underestimated problem. World Poultry 16,

42-43. Van Immerseel, F., De Buck, J., Pasmans, F., Huyghebaert, G., Haesebrouck, F., Ducatelle, R., 2004.

Clostridium perfringens in poultry: an emerging threat for animal and public health. Avian Pathol 33, 537-549.

Van Immerseel, F., Rood, J.I., Moore, R.J., Titball, R.W., 2009. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol 17, 32-36.

34

Plain English Compendium Summary

Project Title:

Project No.: 07-15

Researcher: Robert Moore

Organisation: CSIRO Livestock Industries

Phone: (03) 5227 5760

Fax: (03) 5227 5555

Email: rob.moore@csiro.au

Objectives

Background The Poultry CRC and the poultry production industries have recognised that it would be desirable to have alternative treatment strategies for necrotic enteritis beyond the currently used in-feed antibiotics. It has been claimed that globally necrotic enteritis may cause losses of up to $2 billion annually. We have identified a new virulence factor, NetB, which appears to be important in the pathogenesis of disease. This project aimed to confirm that NetB was of general importance in all necrotic enteritis causing strains of Clostridium perfringens and then go on to develop and test prototype vaccines.

Research Our methodological approach to assessing the general importance of NetB was to survey a diverse collection of C. perfringens isolates from clinical cases of NE for the presence and expression of the netB gene. Gene carriage was assessed using a gene specific PCR test and expression was characterised by immunological analysis via Western blotting using a NetB specific antibody and by a cultured cell cytotoxicity assay. To further investigate the importance of NetB mutant strains in which the netB gene was knocked out were constructed and tested in a disease induction model. The vaccine work in this project focused on testing the efficacy of NetB delivered as a subunit vaccine. To do this it was necessary to make substantial quantities of recombinant NetB as only small amounts of the protein are produced by native C. perfringens strains. The vaccination studies required changes to the disease induction model that we had established in our laboratory.

Outcomes NetB was shown to be essential virulence factor in all disease causing isolates of C. perfringens. As such it makes an excellent antigen to use in vaccine development. Prototype vaccines were produced and showed good efficacy in reducing disease. NetB gave some protection when used as a sole antigen but best protection was obtained by combining it with killed whole cells of C. perfringens.

Implications Work should continue to optimise vaccination and bring this new vaccine to the market.

Publications One patent, three peer reviewed papers and over 10 conference presentations have resulted from this project.