Association of Susceptibility Locus forInflammatory Bowel Disease on

Chromosome 16 with Both Ulcerative Colitisand Crohn’s Disease

MARTIN FARMER, FRCS, LOUISE HUNT, FRCS (Ed), M. ROBERT EICHENBERGER, BA,ROBERT E. PETRAS, MD, JANINE E. JANOSKY, PhD, and SUSAN GALANDIUK, MD, FACS

A susceptibility locus for inflammatory bowel disease (IBD) on chromosome 16 (IBD1) hasbeen linked to Crohn’s disease in genome-wide linkage studies. We performed a case–controlstudy with two markers for this locus using leukocyte DNA from 127 Crohn’s patients, 83ulcerative colitis patients, and 74 control patients. Allele, genotype, and haplotype frequen-cies of the polymerase chain reaction products were determined using autoradiography.Haplotype frequencies differed for ulcerative colitis and Crohn’s disease, particularly forhaplotype CC (22% ulcerative colitis vs 10% Crohn’s disease, P 5 0.002 x2 5 10.0) andhaplotype CD (18% Crohn’s disease vs 9% ulcerative colitis, P 5 0.025 x2 5 5.02). These datademonstrate the association of the IBD1 locus with both ulcerative colitis and Crohn’s diseasein a group of unrelated IBD patients. The use of such microsatellite markers when combinedwith others, might help distinguish ulcerative colitis from Crohn’s disease in patients withambiguous clinical and histological features.

KEY WORDS: Crohn’s disease; ulcerative colitis; inflammatory bowel disease; IBD1.

Inflammatory bowel diseases (IBDs) are chronic in-flammatory disorders of unknown etiology that affectmore than 1 million people in the United Statesalone. Inflammatory bowel disease comprises twomain disorders: Crohn’s disease and ulcerative colitis.Previous studies have indicated a genetic componentthat is thought to have a complex non-Mendelianmode of inheritance (1–3).

Family studies have found a 10- to 35-fold in-creased risk among first-degree relatives of patientswith IBD compared to that of the general population(4–7). This is supported by both twin studies (8, 9)and studies of Ashkenazi Jewish groups (2, 10, 11).These findings have prompted the search for suscep-tibility genes for IBD. The major approach thus farhas been genome-wide scans in patients with multipleaffected family members. A susceptibility locus forCrohn’s disease on chromosome 16 (IBD1) has beenreported (12) and confirmed by others (13–16). Al-though this locus, designated as IBD1 by Hugot et al(12), was initially associated only with Crohn’s disease(17), two groups (18, 19) have recently reported anassociation with ulcerative colitis as well.

Our study aims to confirm the association of IBD1with both Crohn’s disease and ulcerative colitis using

Manuscript received December 23, 1999; accepted August 2,2000.

From the Price Institute of Surgical Research, Department ofSurgery, University of Louisville, Louisville, Kentucky; Depart-ment of Anatomic Pathology, Cleveland Clinic Foundation, Cleve-land, Ohio; and Department of Family Medicine and ClinicalEpidemiology, School of Medicine, University of Pittsburgh, Penn-sylvania.

Address for reprint requests: Dr. Susan Galandiuk, Departmentof Surgery, University of Louisville School of Medicine, Louisville,Kentucky 40292.

Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001), pp. 632–636

632 Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001)0163-2116/01/0300-0632$19.50/0 © 2001 Plenum Publishing Corporation

a population-based case–control study. This type ofapproach is thought to be more powerful than linkageanalyses in diseases in which various genes may eachhave a small or modest effect, such as may be true forIBD (20–22).

MATERIALS AND METHODS

Patients. Peripheral leukocyte DNA was obtained frompatients belonging to a single surgical practice representinga statewide referral area. Studies were carried out withUniversity of Louisville Human Studies Committee ap-proval, and written informed consent was obtained from allpatients. One hundred twenty-seven patients were diag-nosed with Crohn’s disease and 83 with ulcerative colitis.Initial diagnosis was made using standard clinical, radiolog-ical, and endoscopic criteria. All histology was reviewed bya single specialist gastrointestinal pathologist in order toeliminate interobserver variability and reduce the chance ofmisdiagnosis.

A control population of 74 patients was obtained fromthe same surgical practice, matched for age, sex, and eth-nicity. These subjects had non-IBD, nonmalignant gastro-intestinal disease (ie, diverticulitis).

Methods. DNA was extracted from peripheral bloodleukocytes by using a commercial DNA isolation kit (Pure-gene, Gentra Systems, Minneapolis, USA). The solutionwas diluted to a concentration of 50 ng/ml. Two previouslyidentified tetranucleotide microsatellite markers for theIBD1 locus (D16S541 and D16S771) were used. Thesemarkers have logarithm of odds (LOD) scores relative toD16S409 of 20.9 and 13.9, respectively. Both markers wereamplified by using polymerase chain reaction (PCR).Primer sequences were as follows:

D16S541 CCACACCAGCGGTTTTTCTAACACACTTTACACACACCTATACCC

D16S771 GTCCAAACACCACCCTCTAAAGTAGATCAGTCATCTTGCTGC

Polymerase chain reaction was carried out in a 10-mlvolume using 100 ng genomic DNA, 70 mM deoxyribonu-cleotide triphosphate (dNTP), 1.0 mM of each primer, 0.5–1unit of Taq gold DNA polymerase, 1.5 mM of MgCl2 andmagnesium-free storage buffer (5 mM KCl, 1 mM Tris HCl,1% Triton), and 1 mCi of [a-32P] deoxycytidine triphos-phate (dCTP). The PCR conditions included a hold cycle at94°C for 10 min, denaturation at 94°C for 2 min, then 25cycles (94°C for 20 sec, 57°C for 30 sec for D16S771 or 55°Cfor 30 sec for D16S541, 72°C for 60 sec) followed byextension at 72°C for 5 min.

Polyacrylamide gel electrophoresis was performed on thePCR-amplified products by using a 6% “long ranger” gel.Genotypes were detected by using autoradiography (X-OMAT AR, Kodak, Rochester, USA) and scored by twoseparate blinded investigators. Allele frequencies were de-termined manually. Haplotypes were determined by com-bining alleles from the two markers (Figure 1).

Statistical Analysis. Hardy-Weinberg equilibrium wascalculated by a x2 goodness-of-fit test, and a comparison ofgenotype frequencies between both the disease and controlgroups was made with the x2 contingency test. Evaluation ofclinical importance was set as an odds ratio (OR) of greater

than 3. All clinical and genetic information was incorpo-rated into a custom-designed database that was created forthis study. The Genotype/Haplotype Database is a Mi-crosoft Access relational database designed to organize,calculate, tabulate, graph, and export information aboutIBD patients. Using SQL (Microsoft, Redmond, WA,USA) and Access basic language programming (Microsoft),the database also calculated inferred haplotypes for specificalleles and markers. This allowed analysis of allele, geno-type, and haplotype frequencies for the different groups.

RESULTS

Clinical data are listed in Table 1. One hundredtwenty-two Crohn’s disease patients, 83 ulcerative

Fig 1. Representative autoradiograph of (A) D16S771 and (B)D16S541.

TABLE 1. PATIENT DEMOGRAPHICS

Ulcerativecolitis

Crohn’sdisease Control

Patients (N) 83 127 74Mean age [yr (range)] 45 (11–80) 41 (9–81) 55 (9–87)Age of onset (mean) 34 30 47Gender (%)

Women 60 63 69Men 40 37 31

Race (%)Caucasian 98 89 96African-American 2 6 1Jewish 4 3Asian 1

Family historyIBD (%) 11 11 11Colorectal cancer (%) 11 9 35

Extraintestinalmanifestations (%)

10 13 NA

Prior surgery (%) 61 74 33Dysplasia (%) 26 5 NACancer (%) 5 2 NA

ASSOCIATION OF IBD1 WITH IBD

633Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001)

colitis patients, and 61 controls were successfullygenotyped for D16S771; while 127 Crohn’s diseasepatients, 77 ulcerative colitis patients, and 74 controlswere genotyped for D16S541. Haplotypes for the twomarkers were determined as previously described.

Allele Frequencies. There were six alleles formarker D16S541 and eight alleles for markerD16S771. There was no difference in allele frequencybetween control, Crohn’s disease, and ulcerative co-litis groups.

Genotype Frequencies. The frequency of D16S771genotype BC differed for ulcerative colitis comparedto the control group (21% vs 12%, P 5 0.228, x2 5

1.452; OR 5 2.69) as well as ulcerative colitis com-pared to Crohn’s disease (21% vs 11.0%, x2 5 2.9;OR 5 2.67). These differences were, however, notstatistically significant. There were no intergroup dif-ferences in D16S541 genotype frequencies.

Haplotype Frequencies. Haplotypes were deter-mined by combining the allele for D16S541 with theallele for D16S771. Haplotype frequencies were sta-tistically different for ulcerative colitis patients com-pared to patients with Crohn’s disease (Table 2). Thedifference was most pronounced for haplotype CC(22% ulcerative colitis vs 10% Crohn’s disease, P 50.002, x2 5 10.0; OR 5 4.42), however. The fre-quency of haplotype CD differed between Crohn’sdisease and ulcerative colitis (18% Crohn’s disease vs9% ulcerative colitis, P 5 0.025, x2 5 5.02; OR 52.27) (Figure 2). There were no differences in thehaplotype frequencies between both forms of IBDand the control group.

DISCUSSION

Inflammatory bowel disease is a major health prob-lem in the Western world. Extensive research is cur-rently attempting to unravel the etiology of thesehighly complex disease processes. In many cases, it isdifficult to distinguish between Crohn’s disease andulcerative colitis affecting the colon, either by histol-ogy or clinical presentation. In such cases, a diagnosisof “indeterminate colitis” is made (23–24). Accuratediagnosis is important. Ulcerative colitis may be po-tentially cured by colectomy and ileal pouch–analanastomosis. However, this type of surgery may beassociated with significant complications, such as fis-

Fig 2. Haplotype frequencies D16S541/D16S771 for Crohn’s dis-ease (CD) patients, ulcerative colitis (UC) patients, and controlgroup.

TABLE 2. HAPLOTYPE FREQUENCIES D16S541/D16S771*

Controls % UC % CD %

AA 0 0 0 0 1 0AB 1 1 1 1 0 0AC 1 1 0 0 2 1AD 0 0 1 1 1 0AE 1 1 0 0 1 0BA 1 1 3 2 2 1BB 8 7 6 4 15 7BC 5 5 8 6 18 8BD 12 11 4 3 8 4BE 1 1 4 3 7 3BF 2 2 2 1 2 1BG 1 1 0 0 0 0BZ 0 0 1 1 1 0CA 0 0 4 3 6 3CB 7 6 6 4 10 5CC 11 10 30 22 21 10CD 9 8 12 9 39 18CE 6 5 6 4 7 3CF 1 1 2 1 6 3CG 2 2 0 0 0 0CZ 2 2 0 0 1 0DA 0 0 2 1 2 1DB 10 9 11 8 12 6DC 6 5 8 6 22 10DD 12 11 11 8 11 5DE 3 3 3 2 5 2DF 0 0 0 0 3 1DG 0 0 0 0 0 0DZ 0 0 0 0 0 0EA 0 0 1 1 1 0EB 0 0 3 2 4 2EC 2 2 1 1 2 1ED 2 2 2 1 1 0EE 1 1 1 1 1 0EF 0 0 0 0 1 0EZ 0 0 0 0 1 0FA 1 1 1 1 0 0FB 1 1 0 0 1 0FC 0 0 0 0 1 0FD 0 0 1 1 0 0FE 0 0 0 0 0 0FF 1 1 0 0 0 0FG 0 0 1 1 0 0

*Bold type for CC and CD indicates significant differences forhaplotype frequency between Crohn’s disease and ulcerative co-litis patients.

FARMER ET AL

634 Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001)

tulas and abscesses, when inadvertently performedfor Crohn’s disease (25–27).

Differences in D16S541/D16S771 haplotype fre-quencies between Crohn’s disease and ulcerative co-litis raise the possibility of using such microsatellitemarkers in conjunction with others as a screening toolto aid in the differentiation between ulcerative colitisand Crohn’s disease.

The IBD patients in this study are derived from asurgical practice and may therefore represent a moresevere disease phenotype in that they have failedmedical management. Future studies will be neededto compare surgical patients with those managed bymedical treatment to investigate whether these IBD1microsatellite markers are also predictors of diseasebehavior, as was suggested for ulcerative colitis byRoussomoustakaki et al (28) for the HLADRB1*0103.

It is now widely accepted that there is a stronggenetic component to the etiology of IBD. The oc-currence of both forms of IBD in families implies adegree of sharing of susceptibility genes. There maybe yet other genes that are not shared and are re-sponsible for the distinct phenotypes of IBD. Deter-mining which genes are shared and which are notwould increase our understanding of the etiologies ofthese two different disorders. Identification of genesthat are not present in both Crohn’s disease andulcerative colitis could prove clinically useful as apanel of molecular markers to differentiate the twodisorders in the 10% to 20% of patients in whom thediagnosis is not clear. Since the surgical treatment canbe different for these disorders, adverse clinical out-comes because of an incorrect diagnosis may beavoided. This would allow surgeons to select an ap-propriate operation for a given patient.

Several studies are searching for genetic associa-tions with specific types of IBD. The majority of thesefocus on families in whom more than one familymember is affected with IBD (multiplex families).Linkage studies based on genome-wide searches havesuggested that multiple genes may be involved, eachperhaps with only a small effect contributing to a“genetic predisposition” to developing the disease.This concept would also support the idea that thesediseases may be examples of genetic heterogeneity inwhich there are a number of genetic mutations thatproduce phenotypes similar enough to have beengrouped together. Although IBD has traditionallybeen stratified into Crohn’s disease and ulcerativecolitis, it more likely consists of multiple differentdiseases with somewhat similar phenotypes or related

polygenic diseases sharing some but not all suscepti-bility loci (2). Diagnostic variation may confound theresults of such genetic studies and obscure true asso-ciations.

The linkage of IBD1 and Crohn’s disease has beenconfirmed by some (12–17). However, other investi-gators have not been able to do so and have obtainedevidence of linkage for other markers on chromo-somes 3, 7, and 12 (14, 29, 30). To date, only Mirza etal (18) and Annese et al (19) have reported linkage ofboth Crohn’s disease and ulcerative colitis to IBD1.This may be in part due to the problems inherent inthe accurate definition of the disease phenotype.With complex diseases, genes or loci that cause thesedisorders may have a modest effect. This would ex-plain the occasionally contradictory results of linkagestudies that have been reported (21). We believe thatsimilar to two other genetically heterogeneous dis-eases, breast cancer and Alzheimer’s disease, bothcase–control and linkage studies will be needed. As-sociation studies have the advantage that fewer fam-ilies may be required for identification of loci thanusing affected sibling pairs (22). Association-basedmethods can be more powerful for identifying lociwhen there is an association. The association of ul-cerative colitis with IBD1 adds chromosome 16 to thelist of chromosomes with susceptibility loci shared byboth Crohn’s disease and ulcerative colitis. A numberof possible candidate genes are located near IBD1,including the gene encoding E-cadherin, CD-11, andinterleukin-4 receptor. In our future studies, we willconfirm our data with the use of transmission disequi-librium testing of parents and unaffected relatives asthe control population to exclude potential popula-tion bias and stratification.

ACKNOWLEDGEMENTS

This study is supported in part by a donation from Mrs.Barbara Greenberg.

REFERENCES

1. Koutroubakis I, Pena AS: Genetics of inflammatory boweldiseases. In Inflammatory Bowel Disease. RN Allan, JMRhodes, S Hanauer, MRB Keighly, J Alexander-Williams(eds). New York, Churchill Livingstone 1991, pp 13–26

2. Satsangi J, Jewell DP, Rosenberg WMC, Bell JI: Genetics ofinflammatory bowel disease. Gut 35:696–700, 1994

3. Lander ES, Schork NJ: Genetic dissection of complex trait.Science 265:2037–2048, 1994

4. Satsangi J, Rosenberg WMC, Jewell DP: The prevalence ofinflammatory bowel disease in relatives of patients withCrohn’s disease. Eur J Gastroenterol Hepatol 6:413–416, 1994

5. Probert CSJ, Jayanthi V, Hughes AO, Thompson JR, Wicks

ASSOCIATION OF IBD1 WITH IBD

635Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001)

AC, Mayberry JF: Prevalence and family risk of ulcerativecolitis and Crohn’s disease: An epidemiological study amongEuropeans and South Asians in Leicestershire. Gut 34:1547–1551, 1993

6. Satsangi J, Grootscholten C, Holt H, Jewell DP: Clinical pat-terns of familial inflammatory bowel disease. Gut 38:738–741,1996

7. Orholm M, Munkholm P, Langholz E, Nielsen OH, SorensenTIA, Binder V: Familial occurrence of inflammatory boweldisease. N Engl J Med 324:84–88, 1991

8. Thompson NP, Driscoll R, Pounder RE, Wakefield AJ: Ge-netics versus environment in inflammatory bowel disease: re-sults of a British twin study. Br Med J 312:95–96, 1996

9. Tysk C, Lindberg E, Jarnerot G, Floderus-Myrhed B: Ulcer-ative colitis and Crohn’s disease in an unselected population ofmonozygotic and dizygotic twins. A study of heritability and theinfluence of smoking. Gut 29:990–996, 1988

10. McConnell RB, Vadheim CM: Inflammatory bowel disease. InThe Genetic Basis of Common Diseases. RA King, JI Rotter,AO Motulsky (eds). New York, Oxford University Press, 1992,pp 326–348

11. Rotter JI, Yang H, Shohat T: Genetic complexities of inflam-matory bowel disease and its distribution among the Jewishpeople. In Genetic Diversity among Jews. B Bonne-Tamir, AAdam (ed). New York, Oxford University Press, 1992, p 395

12. Hugot JP, Laurent-Puig P, Gower-Rousseau C, Olson JM, LeeJC, Beaugerie L, Naom I, Dupas JL, Van Gossum A, OrholmM, Bonaiti-Pellie C, Weissenbach J, Mathew CG, Lennard-Jones JE, Cortot A, Colombel JF, Thomas G: Mapping of asusceptibility locus for Crohn’s disease on chromosome 16.Nature 379:821–823, 1996

13. Bryant SR, Fu Y, Fields CT, Baltazar R, Ravenhill G, PicklesMR, Rohal PM, Mann J, Kirschner BS, Jabs EW, Bayless TM,Hananer SB, Cho J: American families with Crohn’s diseasehave strong evidence for linkage to chromosome 16 but notchromosome 12. Gastroenterology 115:1056–1061, 1998

14. Hampe J, Schreiber S, Shaw SH, Lau KF, Bridger S, Macpher-son AJ, Cardon LR, Sakul H, Harris TJ, Buckler A, Hall J,Stokkers P, van Deventer SJH, Nurnberg P, Mirza M, LeeJCW, Lennard-Jones JE, Mathew CG, Curran ME: A genomewide analysis provides evidence for novel linkages in inflam-matory bowel disease in a large European cohort. Am J HumGenet 64:808–816, 1999

15. Curran ME, Lau KF, Hampe J, Schreiber S, Bridger S,Macpherson AJ, Cardon LR, Sakul H, Harris TJ, Stokkers P,Van Deventer SJ, Mirza M, Raedler A, Kruis W, Meckler U,Theuer D, Herrmann T, Gionchetti P, Lee J, Mathew C,Lennard-Jones J: Genetic analysis of inflammatory bowel dis-ease in a large European cohort supports linkage to chromo-somes 12 and 16. Gastroenterology 115:1066–1071, 1998

16. Cavanaugh JA, Callen DF, Wilson SR, Stanford PM, SramlME, Gorska M, Crawford J, Whitmore SA, Shlegel C, Foote S,Kohonen-Corish M, Pavli P: Analysis of Australian Crohn’sdisease pedigrees refines the localization for susceptibility toinflammatory bowel disease on chromosome 16. Ann HumGenet 62:291–298, 1998

17. Ohmen JD, Yang H-Y, Yamamoto KK, Zhao H-Y, Ma Y,Bentley LG, Huang Z, Gerwehr S, Pressman S, McElree C,Targan S, Rotter JI, Fischel-Ghodsian N: Susceptibility locusfor inflammatory bowel disease on chromosome 16 has a rolein Crohn’s disease, but not in ulcerative colitis. Hum MolGenet 5:1679–1683, 1996

18. Mirza MM, Lee J, Teare D, Hugot JP, Laurent-Puig P, Colum-bel JF, Hodgson SV, Thomas G, Easton DF, Lennard-JonesJE, Mathew CG: Evidence of linkage of the inflammatorybowel disease susceptibility locus on chromosome 16 (IBD1) toulcerative colitis. J Med Genet 35:218–221, 1998

19. Annese V, Latiano A, Bovio P, Forabosco P, Piepoli A, Lom-bardi G, Andreoli A, Astegiano M, Gionchetti P, Riegler G,Sturniolo G, Clementi M, Rappaport E, Fortina P, Devoto M,Gasparini P, Andriulli A: Genetic Analysis in Italian familieswith inflammatory bowel disease supports linkage to the IBD 1locus—A GISC study. Eur J Hum Genet 7:567–573

20. Gusella JF, Podolsky DK: Inflammatory bowel disease: Is it inthe genes? Gastroenterology 115:1286–1289, 1998 (editorial)

21. Risch N, Merikangas K: The future of genetic studies ofcomplex human diseases. Science 273:1516–1517, 1996

22. Tu IP, Whittemore AS: Power of association and linkage testswhen the disease alleles are unobserved. Am J Hum Genet64:641–649, 1999

23. Price AB: Overlap in the spectrum of non-specific inflamma-tory bowel disease—“colitis indeterminate”. J Clin Pathol31:567–577, 1998

24. Lee KS, Medline A, Shockey S: Indeterminate colitis in thespectrum of inflammatory bowel disease. Arch Pathol Lab Med103:173–176, 1979

25. Hyman NH, Fazio VW, Tuckson WB, Lavery IC: Conse-quences of ileal pouch-anal anastomosis for Crohn’s colitis. DisColon Rectum 34:653–657, 1991

26. Deutsch AA, McLeod RS, Cullen J, Cohen Z: Results of thepelvic pouch procedure in patients with Crohn’s Disease. DisColon Rectum 34:475–477, 1991

27. Galandiuk S, Scott NA, Dozois RR, Kelly KA, Ilstrup DM,Beart RW Jr, Wolff BG, Pemberton JH, Nivatvongs S, DevineRM: Ileal pouch-anal anastomosis: Reoperation for pouch-related complications. Ann Surg 212:446–454, 1990

28. Roussomoustakaki M, Satsangi J, Landers E, Louis E, FanninyG, Welch K, Targan S, Jewell DP: Genetics of ulcerativecolitis: HLA DRB1*0103 (DR103) is associated with the pres-ence of extra-intestinal manifestations and need for surgery.Gastroenterology 110:A1004, 1996

29. Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K,Terwilliger JD, Lathrop GM, Bell JI, Jewell DP: Two stagegenome-wide search in inflammatory bowel disease providesevidence for susceptibility loci on chromosomes 3,7 and 12.Nature Genet 14:199–202, 1996

30. Duerr RH, Barmada MM, Zhang L, Davis S, Preston RA,Chensby LJ, Brown JL, Ehrlich GD, Weeks PE, Aston CE:Linkage and association between inflammatory bowel diseaseand a locus on chromosome 12. Am J Hum Genet 63:95–100,1998

FARMER ET AL

636 Digestive Diseases and Sciences, Vol. 46, No. 3 (March 2001)