Artists and Scientists

Curated by Kim Grant and Carolyn Eyler

September 22 - November 10, 2011

University of Southern Maine Art Gallery

Gorham, Maine

Cole Caswell

Dave Champlin

Sara Crisp

Nina Katchadourian

Barrett Klein

Steven Kutcher

Mike Libby

Jim Nutting

Ken Weber

2 3

September 22-November 10, 2011 USM Art Gallery, Gorham

Opening Reception: ThUrSdAy, SEpT. 22, 6-8 pm

Engaging Insects Roundtable: ThUrSdAy, SEpT. 22, 4:15-5:45 pm in the Art Gallery

Arttalk: Visiting Artist Nina KatchadourianFridAy, SEpT. 23, 1 pm, Burnham Lounge, robie Andrews hall, Gorham

Free Film Screening: Beetle Queen Conquers TokyoMoNdAy, oCT. 17, 5:15-6:45 pm, Lee Auditorium, Wishcamper, portland ThUrSdAy, oCT. 20, 4-5:30 pm, Bailey hall room 10, Gorhamwww.beetlequeen.com

Sponsored by the department of Environmental Science, Communications and Media Studies department, Biology department and the Biology Student Club, Gorham Student Life,

USM Art Gallery, and Women & Gender Studies program.

ArT GALLEry hoUrS: Tuesday-Friday: 11 am-4 pm;

Saturday and Sunday: 1-5 pm. Closed oct. 11.

ALL EvENTS ArE FrEE and open to the public. Call 207.780.5008 www.usm.maine.edu/gallery 37 College Avenue, Gorham, Maine 04038

Foreword

The Engaged contributors intervene with insects in ways

that help us see, understand, and recognize the world.

To some extent, this exhibit was designed as a laboratory

to compare the direct intervention of artists and scientists

with spiders and six types of insects: moth/butterfly, grasshopper,

fly, beetle, bee, and ant. We found a fluidity of interrelationships

among this group of artists, scientists, and hybrids who escape easy

classification in their pursuit of new forms of aesthetic knowledge.

Nina Katchadourian’s unorthodox art emerges from direct observation

of her immediate world and a curiousity to see how her responses might

manifest. The resulting smörgåsbord of different subjects and media

typically have a bright humor packed with suggestive meanings, such

as her use of caterpillars to spell the words “Quit Using Us.”

USM biologist Dave Champlin spends considerable time growing

and dissecting caterpillars, then staining their cells in order to trace

stages of metamorphosis. These intensive lab experiments nourish

Champlin’s expansive thinking. For example, he thinks about genetic

code as origami folding instructions: “it is much easier (and accurate)

to imagine evolution tweaking an origami folding plan than a blueprint.”

Speaking of evolutionary tweaking, Steven Kutcher uses his

considerable insect expertise to carefully nurture their development

as painters. one big problem to overcome has been small feet

brushes. Kutcher first experimented with making “painting shoes,”

then discovered that if he moistened the paper first, the expanding

watercolors marked the insects’ walking patterns in sometimes quite

pleasing ways. Kutcher’s drawings appear in both our art gallery and

in a book documenting insect tracings on the shelf of an entomology

professor’s office in the next campus building. This is just one example

of how keeping multiple reference points in play is best when engaging

with this exhibit – and for that matter, the world.

Carolyn Eyler director of Exhibitions and programs,

University of Southern Maine Art Gallery

Artists and Scientists

4 5

We Are Surrounded.

Insects outnumber, outweigh, out smart us. They preceded us on

the earth by over 300 million years. They will surely survive long

after we are gone. yet, despite their overwhelming numbers and

unquestionable powers of survival and adaptation we usually try to

ignore their presence. For most people an encounter with an insect is

experienced as unpleasant, something more like a minor accident or

illness rather than a pleasure associated with the wonders of nature

such as the sight of an osprey or the Grand Canyon. how many people

welcome the sight of the first flies and anthills of spring with feelings

comparable to those provoked by the first crocuses and daffodils?

insects are more often considered invaders than welcome visitors.

They bite and sting; they destroy plants from pampered garden roses

to entire tracts of forest; they ruin picnics. insects spread disease;

they instigate disasters; they rank with flood and fire as agents of

destruction. Their depredations are recounted in one of the earliest

surviving texts from ancient Sumer, which describes a priest driving

away a plague of locusts by means of a charm. We defend ourselves as

we can, now most often with poisonous chemicals and insurance, but

insects are an unrelenting force of nature. They remind us that our

tenure on the earth is a shaky truce, a balancing act amid the claims

and requirements of others. They may be small, but they out number us

200 million to one. We are at their mercy.

Measured in human scale insects are tiny; their lives are short,

ranging from a few hours to a few months; their reproductive capacities

are stunning, in five months a pair of houseflies could produce

190,000,000,000,000,000,000 descendants. Such considerations, in

addition to their incredible ubiquity, help to explain the widespread

indifference to the fate of individual insects. has anyone ever

attempted to liberate fruit flies from a scientific laboratory on the

basis of their rights? is the fly in the lab any less happy than the one

buzzing around your kitchen? Although the ethical issues involved

may be troubling in the abstract, (are the lives of small, short-lived,

multi-legged creatures less intrinsically valuable than larger, longer-

lived creatures?) it is difficult to feel moved by the plight of creatures

we annihilate both inadvertently and intentionally on a daily basis.

Even if we tread carefully we cannot stop to mourn the death of each

bug that splashes across our windshield. perhaps there is some small

compensatory virtue in simply giving insects our attention.

The common fly occupies a privileged place in Western art history.

in his Lives of the great renaissance artists Giorgio vasari recounts

how the young Giotto tricked his teacher Cimabue by painting a very

life-like fly on the nose of a painted Madonna. Completely fooled by

the illusion Cimabue tried to brush the fly away and was astonished to

discover it had been painted by his precocious student. here one might

say that the history of modern Western naturalistic representation has

its beginnings in the depiction of a fly that could not be brushed away.

The close links between art and science in

the modern world have been increasingly

acknowledged and studied in recent years.

Giotto’s probably mythical trompe l’oeil fly was far

more than a joke; it was part of a new attitude

in which the natural world, from the stars in the

sky to the insects on the ground, was considered

worthy of serious attention and study. Close observation of nature was

accompanied by the development of scientific illustration. Beginning with

Albrecht durer’s 1505 watercolor of a stag beetle a new form of visualizing

knowledge evolved in the wake of the renaissance. What had previously

been difficult or impossible to see with the naked eye was magnified and

drawn to show all of its complex and minute details, revealing not only

previously obscured visual information but beauty as well.

6 7

Before the 20th century scientific study often went hand in

hand with religious conviction. in the 19th century the wondrous

complexity of insects and their activities were often cited as proof

of God’s existence as the grand designer of the universe. The social,

architectural and nutritive systems of bees were considered both

symptoms and symbols of a cosmic order, as were spiders’ webs. Earlier

dutch Baroque still-life paintings combine botanically accurate studies

of plants with entomologically correct representations of caterpillars,

moths and butterflies as symbols of death and Christian resurrection.

other insects are also common in dutch still-life paintings, often

depicted on rotting leaves or fruit they are vanitas symbols that

reminded the viewer of the transience of all earthly beauty. The

Surrealist painter Salvador dali transformed this symbolism into 20th

century psychoanalytic terms when he repeatedly figured his obsession

with sex and death in the form of grasshoppers and putrefying objects

covered in meticulously rendered swarms of ants.

More recently insects have become important figures for

conceptualizing the complex interrelationships between living

beings and their environments. The sensitivity of insects to their

local ecosystem and their elaborate systems of communication and

organization have become common metaphors for decentralized forms

of connectivity like the internet. The swarming of social insects like

ants and bees provide examples of rhizomatic forms of communication

and concerted action that seem particularly relevant to our human

world in which social media and electronic information motivate

widespread human actions from flash mobs to political protest and

revolution. The phenomenon of bee colony collapse has also brought

sharply into view the continued dependence of our technologically

oriented society on an increasingly degraded and destroyed natural

world. it may be that however often they seem to threaten human

interests, to ignore or attempt to eliminate insects is to hasten our

own demise.

The works in this exhibition are products of the attentive

investigation of insects by artists and scientists. Many of them

are visual presentations intended to reveal the insects themselves

from their dNA, through their cellular forms and isolated body parts

to the entire physically present creature in a created environment.

These presentations are part of the long-standing tradition of insect

imaging that brings to light the hidden beauty and designs that

permeate the natural world. A number of works also directly address

the problems and possibilities of human insect interaction. Turned to

human purposes insects become artists and artistic media, unwitting

collaborators in the creation of products for human entertainment

and aesthetic appreciation. Whether their actions are simply traced or

their created forms are celebrated and honored, it seems likely that the

insects are in pursuit of their own, and to us unknown, ends. if they

could speak they might well say, “quit using us.”

Kim Grant Associate professor of Art historyUniversity of Southern Maine

8 9

Using technology and mobile data i engage, record, and

question our contemporary landscape. This practice re-

appropriates and invents tools, technologies, and systems

[GpS tracking systems, multi-perspective sampling proce-

dures, augmented clothing design, and photographic data collection] to

help explore the space between our human perception of the land and

the land’s actual state(s). A constant curiosity in regards to this space

pushes my work into an intricate play between social and geological

landscape; this exploration is framed within the arc of a historic

photographic perception and its contemporary transversal shiftings.

The three projects included in the exhibition invertebrates

consider interior spaces as environments rich with non-human

inhabitants - dwellings as ecologies, ripe for inhabitation. The first

investigatory project Invertebrates samples and catalogues the insects

that co-inhabit my home on peaks island off the coast of Maine.

The second project Colonization focuses on the shape of

growth. Using my darkroom/studio as a testing site the project samples

deceased spiders that have been re-colonized by mold. particular

interest is given to growth patterns and the apparent stages of

colonization found in each specimen.

The third project The Interior Arachnid Territory Tracking Kit 2 is

a fully inclusive kit that investigates interior ecologies and the spiders

that dwell within them. The IATTK 2 houses various experiments

that track both the spiders and the qualities of their chosen interior

dwelling spaces. This kit was developed for the Invertebrates exhibition

and has been deployed in the USM Art Gallery building.

i received an interdisciplinary M.F.A. from the Maine College

of Art. over the last few years i have been an active collaborator with

the Geographic observatory and WEArEX [wax]. in addition to these

collaborations i have worked with the arts collective Spurse and the art

non-profit organization the Creative Material Group [CMG].

www.colecaswell.com

Cole Caswell

UnICorn moThiNKjET priNT 2009, 24” X 30”

10 11

rESEArChErS iN My LAB at University of Southern Maine

use insect metamorphosis as a model to help understand

hormonal control of animal development. Experiments in

the lab focus on metamorphosis of the moth, Manduca

sexta, especially the development of the compound adult eye and the

associated optic lobe of the moth’s brain. We were surprised to find

the precursors to the moth’s eyes actually function as skin cells in the

caterpillar until the start of metamorphosis. At that time, nutritional

status signals hormones that will coordinate responses in virtually

every cell of the caterpillar body. Although the caterpillar’s cells

contain the genetic code to form the adult moth, the developmental

programs to form the adult are not activated until hormones switch

them on at the start of metamorphosis. My images in the exhibit are

mostly of the developing eye and brain of the moth.

Dave Champlin is an associate professor of biology at University of Southern Maine.Champlin completed his doctoral work at Cornell University with John Lis

on the structure of transcriptionally active chromatin. he went on to an

American Cancer Society postdoctoral fellowship with James Truman at

the University of Washington, Seattle, examining the hormonal control of

insect metamorphosis. Champlin has continued those studies in his own

research lab at USm with additional support provided by the national

Science Foundation, the United States Department of Agriculture, and the

national Institutes of health. An important element of the USm research

program has been the mentoring of over thirty graduate, undergraduate,

and high school students as they pursued independent research projects.

Dave Champlin

RIghT: ADULT eye DeveLopmenT, mAnDUCA SexTA

LefT, DeTaIL: brAIn opTIC Lobe (neUrobLAST) STem CeLLS, mAnDUCA SexTA

12 13

Maine artist Sara Crisp utilizes wood panels and employs

the ancient technique of encaustic, in which powdered

pigments are suspended in a wax medium and fused with

heat. She builds up the surface of each painting, layer

by layer, which results in a translucent surface with a worn, pitted and

porous texture. There is a central opening in each piece that acts as a

box trapping an array of found natural objects beneath cloudy layers of

wax and a thin sheet of mica.

There is an obvious sculptural quality to Crisp’s work. The

physicality of the wax, its luster and depth draw you in to it’s delicate

layers, embedding bones, insects, and plants, to a state of fossilization.

She works from an innate sense of duality; man vs. nature; order vs.

chaos; creating a contrast between sharply constructed lines and

raw natural elements. She connects us to the past, not only with

her technique, but by incorporating the grid, the most primitive

manifestation of rationality and order, creating an imaginary space

within which her chosen objects relate to each other and where they

intersect with the human made world.

Crisp has had solo exhibitions throughout New England and

New york. She has also participated in numerous group exhibitions,

and received several awards and reviews. Crisp studied art at the rhode

island School of design and is represented exclusively by denise Bibro

Fine Art in New york City.

www.denisebibrofineart.com

Sara Crisp

UnTITLeD (beehIve)ENCAUSTiC/MiXEd MEdiA200715” X 15”

UnTITLeD (beeTLe WIng SpIrAL)MiXEd MEdiA oN pANEL2007, 25” X 25”

14 15

ENGAGiNG iNSECTS FEATUrES FoUr of Katchadourian’s

unorthodox encounters with insects in photography,

video, installation, and graphic art. natural Crossdressing

[right] depicts the artist wearing a mustache made of live

caterpillars. in the installation Ant Static, a monitor on the floor-with

hidden dvd player- displays a heavily layered and speeded up loop

of swarming ants to produce the look of television “snow” or static.

other works include Quit Using Us,[above] a banner made of caterpillars

spelling the title with their bodies; and gIFT/gIFT, a video showing

tweezers forming letters of thread in a web as a spider struggles to

mend the disruptions.

Nina Katchadourian was born in Stanford, California and

grew up spending every summer on a small island in the Finnish

archipelago, where she still spends part of each year. her work exists

in a wide variety of media including photography, sculpture, video and

sound. her work has been exhibited domestically and internationally

at places such as pS1/MoMA, the Serpentine Gallery, New Langton Arts,

Artists Space, SculptureCenter, and the palais de Tokyo. in january

2006 the Turku Art Museum in Turku, Finland featured a solo show of

works made in Finland, and in june 2006 the Tang Museum in Saratoga

Springs exhibited a 10-year survey of her work and published an

accompanying monograph entitled “All Forms of Attraction.”

The Museum of Contemporary Art San diego presented a solo show of

recent video installation works in july 2008. in February 2010 she was

the artist in residence at the dunedin public Art Gallery in dunedin,

New Zealand, where she had a solo show entitled “Seat Assignment.”

She is currently at work on a permanent public piece, commissioned

by the GSA, for a border crossing station between the US and Canada.

Katchadourian is represented by Catharine Clark gallery in San Francisco.

www.ninakatchadourian .com

Nina Katchadourian

nATUrAL CroSSDreSSIng C-priNT, 2002, 40” X 30”

16 17

AS ‘ENToMoArTiST,’ i fashion ways of exploring, creating,

and communicating both science and art, primarily

with insects at center stage. My science—a combination

of investigating sleep in societies of insects, and

communication in frogs fooled by robot doppelgangers—is enhanced by

visuals, and my art is driven by biological concepts. i produced natural

history exhibits for museums (at the American Museum of Natural

history, and Chase Studio, inc.) and studied entomology at Cornell, the

University of Arizona, and most recently at the University of Texas at

Austin. Today, i celebrate insects through illustration, film, sculpture,

and science. i am presently a visiting scientist living in an apiary

at Cornell University, but will soon move to Germany and panama to

spearhead projects that will weave insect research with visualizing

nature.

A bustling society is difficult to visualize in its entirety, even

when peering through the transparent window of an observation hive

full of honey bees. Some individual behaviors and collective actions are

impossible to perceive with the naked eye. To overcome this obstacle, i

recently recorded and mapped behaviors of bees using infrared imaging

technology. during the course of my scientific research in a German

apiary (BEEgroup, University of Würzburg), i filmed colonies of honey

bees and created thermal visions in which temperature translated

into color and patterns of activity emerged. My thermal portraits

feature bees performing waggle dances (communicating direction and

distance of desirable destinations to sisters), heating brood, thermally

slaughtering invaders, and sleeping. These portraits are an attempt to

capture the invisible actions of a society.

barrett@pupating.org www.pupating.org

Barrett Anthony Klein

hIveThErMAL priNT2008, 10” X 7-1/2”

Curators’ notE: CheCK oUT bArreTT KLeIn’S WonDerFUL eSSAy pAr For ThE pALETTE: iNSECTS ANd ArAChNidS AS ArT MEdiA. IT CAn be DoWnLoADeD AT WWW.pUpATiNG.orG

18 19

My pAiNTiNGS highlight the connection between science

and art; between the natural environment and the

human experience; between classic art techniques and

abstract expressionism; and between an emotive natural,

organic style and creative, constructive ideas.

i have made visible the hidden world of the insect footprint.

When an insect walks on your hand, you may feel the legs move but

nothing visible remains, only a sensation. These works of art render

these insect tracks and routes visible, producing a visually pleasing

piece while conveying pertinent, scientific information.

Kutcher’s lifelong passion for insects and exceptional

understanding of insect behavior combined with formulated ideas enables

him to manipulate an insect’s movement on the canvas. These processes

result in the creation of an unique approach to painting. his artistic

appreciation for color, line, and form helps him translate these small

creatures into living brushes.

Kutcher lives in Arcadia, CA and has obtained a b.S. in

entomology at UC Davis and an m.A. in biology at CSULb with an emphasis

on insect behavior. he is an artist, entomologist, environmentalist, and

educator who has worked in over 90 feature films with arthropods (e.g. the

spider sequences in Spider Man 1). Kutcher has been drawing and painting

since early childhood. In the 1980’s he worked on a commercial project

where he had to figure out how to make a fly walk through ink and leave

fly footprints. In 2003 he used this all of this knowledge to create the first

bug art. Kutcher’s bug art has appeared in galleries, museums, universities,

magazines, newspapers, in europe, and in his movie Bug Art, 2006.

www.BugArtBySteven .com

Steven R . Kutcher

Top RIghT: eye on yoU (USiNG TiGEr MoTh) GoUAChE oN pApEr 2004, 15” X 24”

aBove: SUnrISe #1 (USiNG dArKLiNG BEETLE) GoUAChE oN pApEr2004, 18” X 24”

20 21

roBoT-LiKE iNSECTS ANd iNSECT-LiKE roBoTS are the stuff

of science fiction and science fact. in science fiction,

insects are frequently featured as robotic critters. Either

scurrying across the galaxy as invading aliens or as robo-

bug counterparts to a futuristic human race. From Cronos to The golden

Compass, the insect/robot archetype has been used, re-used and re-

imagined countless times.

in reality, engineers look to insect movement, wing design

and other characteristics for inspiration of new technology. Some of

the most advanced “aircraft” is no bigger, or heavier, than a dragonfly,

and NASA scientists are making big steps in walking rovers and “swarm

theory” probes for planetary exploration.

This hybridization of insects and technology from both

fields, is where insect Lab borrows from. insect Lab celebrates these

correspondences and contradictions. The work does not intend to

function, but playfully and slyly insists that it possibly could.

Mike Libby is a multi-disciplinary artist who makes highly

detailed sculptures, models, collages and drawings. Through diverse

materials and methodologies, Libby explores themes of science, nature,

fantasy, history and autobiography; highlighting illogical and acute

correspondences between a constellation of topics. For the past

12 years, alongside this main body of work, Libby has enjoyed

developing the work presented here as insect Lab.

Libby Graduated with a degree in Sculpture from riSd in 1999

and has since attended the vermont Studio Center, and been artist-in-

residence at the University of Maine at orono. he has been in many solo

and group exhibits, throughout the U.S. and internationally and

is in collections worldwide. he has future shows in Boston, Washington,

New york, and LA. And he will be exhibiting alongside many respected

colleagues at “Extreme Materials 2” on view at rochester University

in New york.

www.insectlabstudio.com www.mikeplibby.com

Mike Libby

hoUSeFLy hoUSEFLy CUSToMiZEd WiTh ANTiQUE WATChpArTS ANd GEArS.GLASS doME ANd WALNUT BASE, 5” X 4” X 4”, 2001

22 23

OriGiNALLy from Millinocket, Nutting moved to Auburn

in the 8th grade. he graduated from Edward Little high

School in 1972 and from Bates College with a Biology

degree in 1976. in March of 2010, jim bought out his

partners Nel and denise and is now the sole owner of Maine Art Glass.

Nutting’s biology background is very evident in his art. Many

of his original works depict wildlife and nature. As a biologist his art

tends to be realistic and accurate.

Nutting is the consummate collector. he has spent a lifetime

collecting natural artifacts, sea shells, fossils, rocks and minerals,

skulls, feathers, and taxidermy. jim has also provided Maine Art Glass

with his extensive library of books on natural history and reference

materials which provides an unlimited supply of design inspiration

and ideas.

When you visit Maine Art Glass, you will encounter the most

extensive and unusual of Nutting’s collections. Up in the mezzanine

(in the former choir loft of the church) and scattered throughout the

galleries of Maine Art Glass, jim has put together a world class display

of tropical and local butterflies and insects, all stunningly displayed in

stained glass display cases and hand made shadow boxes.

This collection, known as The butterfly and Insect museum

at maine Art glass is becoming well known throughout Maine and

across the country. The Butterfly and insect Museum is becoming a

destination for many school groups, summer camps, scout groups, youth

and adult service organizations and families. jim can be scheduled to

provide group tours, talks on insects and also live demonstrations of

insects and arachnids. Nutting is one of the few individuals in Maine

licensed by the Maine inland Fish and Wildlife department to keep

and exhibit live tarantulas, scorpions and other exotic invertebrates.

www.MaineArtGlass .com

Jim Nutting

beeTLe KALeIDoSCopehorN ATLAS(LArGE) hArLEQUiN (CorNEr) ANd jEWEL BEETLES2006

AGGGCTCGATGTGTTTATTCGGGACCGTTTTTCTAAATACTTTCT-

TACTTTTTACTTTTTTAAATTAAAACATCTATTAGCTACGGGTAT-

GCTATTTCTTCAATTGAAATTGCGCACTTGTAAAAAACTAAAGTTA-

AGTTGCATTCATTTAAAATATAATAACAGCATCATGTACATAATAAAA-

CATTGCCTTAATTCATTTTTAACATAATTTCTTCCTTCGTATGTTTTT-

GACTTTCTGTCGTTTTTTAAAACCAAAACACAGTACAGTGCACTA-

AAAATATTTTAAGTTACGATCTTTCTCTTTTTACTTTAAACATACT-

TAACTCCTCTCTACTCATCATATATTTTTTGTTTTGTTTTTTTTATG-

CAATGCAGGTTTCTTACGAACTATAGGTTTAAAGTTAAGCTTAAGT-

TACGATGTTGCTGATTGTTAGTTTGTGGGTTGTTTGTTTGTTTTGTT-

GTCTGCGCGTGCCATAACTTAAAATGCTATTTTCGTGGTAATTTTCAT-

GTATATTTATTTGTAGTTTTTTCTTTATCAATTCAGTAAGATTCCT-

TAATTGTTTGTGTCTTTCCCACTAAGGGGTAGTGTATGAACAGAAAA-

CAGTTCTTAGAGTGAGTTGAATTGTTTAAAATTGGTATAGCTCTTGCATC-

GATTGTTTCTGCTGATTATTATGTTGGATTGGGTGGGTAGTGCTTCTG-

GAGTCTGCCATTTCAGTAGAAGTTTGCGTGCATTTTTCTTGTACTACG-

GATTATAGTTTGTATTTGTTGCTGCCAATGGATCTGAAGGTGTTGCT-

GCTGATGCATCTGTATGTAGCTGTACCCGCCGGAGGTACCTAGTCAG-

GTTCAGTAAACCTGACTTCGCATCGGATTCTAGATGTTCGACTTCGAGA-

AGCTTACACGCAGGTGATTCGACTCGGACAGCTGGTGGTTGTGCATCT-

TAATCAGTGCTAGGACAGCCTCCTCCACGGACAACAGTTGAAGCAGTGC-

CATTTTACGGTCCTTCctgtaaaataaaaaggacgaggttattagtg-

gttgctccgatagttttaatagcacacatagaagggaaaaaaaattt-

taaaaatagttgtctgtgcggccattacttacGGGAAAAATTT-

GAATGCCTTAACTTCAAAGCTGTTTGAGGTGAAAGCTTCTTTGATGT-

CATCCTCAGAGCAGGATGAGctgcagggtaagagagaagatgttgt-

tagttacctttaaagagtgtcagatttaagggtacgtgggtatgtg-

gcagcgcctgctgtgaggctggttcattgattccgctcggtaggc-

gcttcgaagagcctgtggtgcgattggctcgattcataaattcacg-

cagcggagggtagtcaccccgtcttctagttggcatgcgaatcccagc-

cagcggggtgctttgtcaaattttggtagaatagggtgctacgc-

ggggtttccactgctcatagctataattgtaattgccttgtcgtgcc-

gaaatcaagccgtctcacagcatccataccgaagcagtacccgaccac-

gcctactgcccaatctgattccctcaggcacagacagcgcattgtcat-

gccctgtagaatacttacGGAATGTTGCTTAAATGTAGTGTCGCCGAC-

GGCGGATAGATGTTCTGGTAGTTCTTGCTTCCCGGTTTCTTGAAGCG-

GTGCAACGGATTTTGCGAGTAGTCACGTGTGAGTCCTGCGTCCGGCT-

GTCCCTCCTTGGGCAGCTGGACGGCCTGGTGTTTGCTTGCCATCACACG-

AGGGCTCGATGTGTTTATTCGGGACCGTTTTTCTAAATACTTTCTTACTTTTTACTTTTTTAAAT-

TAAAACATCTATTAGCTACGGGTATGCTATTTCTTCAATTGAAATTGCGCACTTGTAAAAAACTA-

AAGTTAAGTTGCATTCATTTAAAATATAATAACAGCATCATGTACATAATAAAACATTGCCTTA-

ATTCATTTTTAACATAATTTCTTCCTTCGTATGTTTTTGACTTTCTGTCGTTTTTTAAAACCAAAA-

CACAGTACAGTGCACTAAAAATATTTTAAGTTACGATCTTTCTCTTTTTACTTTAAACATACTTA-

ACTCCTCTCTACTCATCATATATTTTTTGTTTTGTTTTTTTTATGCAATGCAGGTTTCTTACGAAC-

TATAGGTTTAAAGTTAAGCTTAAGTTACGATGTTGCTGATTGTTAGTTTGTGGGTTGTTTGTTT-

GTTTTGTTGTCTGCGCGTGCCATAACTTAAAATGCTATTTTCGTGGTAATTTTCATGTATATT-

TATTTGTAGTTTTTTCTTTATCAATTCAGTAAGATTCCTTAATTGTTTGTGTCTTTCCCAC-

TAAGGGGTAGTGTATGAACAGAAAACAGTTCTTAGAGTGAGTTGAATTGTTTAAAATTGG-

TATAGCTCTTGCATCGATTGTTTCTGCTGATTATTATGTTGGATTGGGTGGGTAGTGCTTCTG-

GAGTCTGCCATTTCAGTAGAAGTTTGCGTGCATTTTTCTTGTACTACGGATTATAGTTTGTATTT-

GTTGCTGCCAATGGATCTGAAGGTGTTGCTGCTGATGCATCTGTATGTAGCTGTACCCGCCGGAGG-

TACCTAGTCAGGTTCAGTAAACCTGACTTCGCATCGGATTCTAGATGTTCGACTTCGAGAAGCTTAC-

ACGCAGGTGATTCGACTCGGACAGCTGGTGGTTGTGCATCTTAATCAGTGCTAGGACAGCCTCCTC-

CACGGACAACAGTTGAAGCAGTGCCATTTTACGGTCCTTCctgtaaaataaaaaggacgag-

gttattagtggttgctccgatagttttaatagcacacatagaagggaaaaaaaatttta-

aaaatagttgtctgtgcggccattacttacGGGAAAAATTTGAATGCCTTAACTTCAAAGCT-

GTTTGAGGTGAAAGCTTCTTTGATGTCATCCTCAGAGCAGGATGAGctgcagggtaagaga-

gaagatgttgttagttacctttaaagagtgtcagatttaagggtacgtgggtatgtggcagc-

gcctgctgtgaggctggttcattgattccgctcggtaggcgcttcgaagagcctgtggtgc-

gattggctcgattcataaattcacgcagcggagggtagtcaccccgtcttctagttggcatgc-

gaatcccagccagcggggtgctttgtcaaattttggtagaatagggtgctacgcggggtttc-

cactgctcatagctataattgtaattgccttgtcgtgccgaaatcaagccgtctcacagcatc-

cataccgaagcagtacccgaccacgcctactgcccaatctgattccctcaggcacagacagcg-

cattgtcatgccctgtagaatacttacGGAATGTTGCTTAAATGTAGTGTCGCCGACGGCGGATA-

GATGTTCTGGTAGTTCTTGCTTCCCGGTTTCTTGAAGCGGTGCAACGGATTTTGCGAGTAGT-

CACGTGTGAGTCCTGCGTCCGGCTGTCCCTCCTTGGGCAGCTGGACGGCCTGGTGTTTGCTT-

GCCATCACACGTATCGGCTTTCCCCATAAACGTAATTTATCAAGGTGAGACATGGctgtggag-

cagaaagtaacacgttaaaatgtatacactagggaaaagttttttggttgttagatgagtct-

gtatatggaaaatgtggctgtgtcaatatatatgtatttgtaccaatgcaatttatttgct-

gtgacacaagctataaaaatactcctgaatctcagaaagaacattgccaaaaaatttgttttt-

gatccaaacaatatatttagaatattatttttattttatttaacaaattaaatctaaacctgat-

gaatttgatgagttctagctaactgtgccttcaactcgatttttactttgtaacttcgaga-

ataataacgaaaatagtatagtcggataaacaacaatgttacgtattgctttaaaccaatta-

caaccttttttatattaaaagtacggtcctttcctcagtgtagtgaaagatcccgaccaccagc-

cgtcgaacaaagtcaacaataagggcaggcaaatatttacatactcagatgtaactgcaactt-

tatcaatgtcgtctgcctttggtgatttatacgagctgaaatgcttgtttggccgtaaaag-

tattaccaaacaaaagtttgccatctccaggctcttttccggcgcatttccaatggactttgcct-

tatttctcatattctcagaagccataacacctgcggcttggatggaatgcatgtgcagt

actcaaatacatttcaatctgccttttcatttcgatttcagtttcgattacgttttattta-

atttaagttcctgccaagtcatccgacagcttaggtcaggccactgtccagaaaaggttctaa-

cattttttaactctcatgcattacattaataaattacatcacattttatcactgctcctct-

gttttattgtaacgcaatatgcttactcagccgtttattgtttgcctaatggattaagt-

24 25

My experimental organism is the fruit fly, drosophila

melanogaster. i study shape and performance traits. The

shape traits include wing shape, head shape, and other

aspects of fly shape. The performance traits include

ethanol vapor resistance, wind tunnel flight, and other such traits.

By mass selective breeding in large populations, nearly all traits like

these can be greatly modified, in small increments, by the cumulative

contributions of many genes with small effects. This is analogous to

darwinian natural selection, which gradually improves the adaptation

of populations to their environments.

i have built devices for the mass measurement of various traits

in flies including olfactory responses, standing height, wind tunnel

performance, mating speed, larval pupation behavior, resistance to

chemical vapors, aspects of body shape, and other traits. Several of

these systems have been adopted in other labs.

My current research rests mainly on two systems. one measures

wind tunnel performance on up to 15,000 flies at a time. The other

system measures wing shape, on one fly at a time, but rapidly. on these

two parallel tracks, i study the genetics of wing shape and of wind

tunnel performance.

Ken Weber is a member of the Biology Department at University of Southern maine, teaching courses in genetics, evolution,

and cell biology.

his research at USm has been supported mainly by two national

Science Foundation grants. his general area of research is evolutionary

quantitative genetics. In particular, he studies selective breeding in large

populations, and how it gradually changes traits.

Ken Weber

FLy WiNG ANd dNA CodE

26

We Are Surrounded.

if they could speak

they might well say,

“quit using us.”