398 399

Production of l-phenylalanine from glucose by metabolic engineering of wildtype Escherichia coli W3110

Shuang-Ping Liu, Meng-Rong Xiao, Liang Zhang ∗, Jian Xu,Zhong-Yang Ding, Zheng-Hua Gu, Gui-Yang Shi ∗

The Key Laboratory of Industrial Biotechnology of Ministry of Education, National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan University, Wuxi 214122,China

a r t i c l e i n f o

Article history:Received 5 January 2013Received in revised form 25 January 2013Accepted 13 February 2013Available online 24 February 2013

Keywords:l-PhenylalaninePN25 promoteraroGpheAydiBaroK

a b s t r a c t

The market of l-phenylalanine has been stimulated by the great demand for the low-calorie sweeteneraspartame. In this paper, the effects of pivotal genes on l-phenylalanine production were evaluatedby metabolic engineering of wild type Escherichia coli. The bifunctional PheA protein contains two cat-alytic domains (chorismate mutase and prephenate dehydratase activities) as well as one R-domain (forfeedback inhibition by l-phenylalanine). The catalytic domain of PheA was overexpressed to increase l-phenylalanine production. It was firstly indicated that this domain could enhance the metabolic influx tooverproduce l-phenylalanine and improve the survival ability under m-Fluoro-dl-phenylalanine stress.Furthermore, the fermentation performance of aroG feedback inhibition resistant mutants was firstlycompared, aroG29 and aroG15 increased the l-phenylalanine concentration by 5-fold. After that theexpression of aroK and ydiB was also elevated, and the l-phenylalanine yield on cell (0.79 g/g) andmaximum l-phenylalanine productivity (0.073 g/L/h) were subsequently doubled. Meanwhile, the l-phenylalanine yield on glucose increased from 0.124 g/g to 0.153 g/g. It was found that genes ydiB andaroK could elevate the l-phenylalanine yield and productivity and shorten the lag phase.

© 2013 Elsevier Ltd. All rights reserved.

1. Introduction

l-Phenylalanine (Phe) is well known for the commercial valuein pharmaceutical and food additives. Its market has been stimu-lated by the great demand for the low-calorie sweetener aspartame[1]. However, the synthesis of Phe is strictly regulated by the multihierarchical regulations (Fig. 1) and the intracellular Phe concen-tration in wild type cells is too low to secrete into the environment.It is important to find new feedback resistant mutants with decentperformance.

The bifunctional PheA protein (Fig. 1) contains two catalyticdomains (chorismate mutase (CM) and prephenate dehydratase(PDT) activities) as well as one R-domain (for feedback inhibi-tion by Phe). Some pheA feedback inhibition resistants (fbr) havebeen investigated in Phe fermentation [2–6], while the thermosta-bility of these mutants were unclear yet. The catalysis domain(amino residues 1–300) of the PheA protein whose enzymolog-ical characteristics was previously reported [7] could retain the

∗ Corresponding authors at: National Engineering Laboratory for Cereal Fermen-tation Technology, Jiangnan University, 1800 Lihu Road, Wuxi 214122, China.Tel.: +86 510 85918229; fax: +86 510 85918229.

E-mail addresses: zhangl@jiangnan.edu.cn (L. Zhang), biomass jnu@126.com(G.-Y. Shi).

native catalytic activities and the thermostability at 50 ◦C, whilethere was no report on the fermentation performance about theamino residues 1–300 of PheA protein.

In Escherichia coli, the 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase (DAHP-synthase), known as the first commit-ted step of aromatic amino acid synthesis, controls the carbonflow into the common aromatic amino acid pathway. In wild typeE. coli grown on minimal medium, about 80, 20 and 1% of thetotal DAHP-synthase activities are contributed by the aroG, aroF,and aroH products, respectively [8]. Both the Phe- and tyrosine-sensitive isoenzymes (AroG and AroF) can be completely inhibitedby 0.1 mM of the corresponding amino acid (Ki values of 13 �Mand 82 �M, respectively [9]). It was [2,6,10] reported that somearoFfbr mutants had poor thermostability with the highest DAHPsynthesis activity after 13-h culture and no DAHP-synthase activ-ity was detected after 30 h, while the aromatic amino acids alwaysaccumulated after 20 h [4]. The DAHP synthesis activity was notsynchronized with Phe production and sometimes, as a result, wildtype aroF performed better than aroFfbr [2]. Thus, the screeningof DAHP-synthase mutants should not only focus on the enzymeactivity under high Phe concentration, but also the performance inthe fermentation process, as the fermentation performance coulddirectly reflect the practical characterizations in industrial pro-duction. Some of the aroG mutants were reported to show nothermostability attenuation [11] in fermentation process, and it

Reproduced from Process Biochemistry 48: 413-419 (2013).Guiyang Shi: Participant of the 26th UM, 1998-1999.

398 399

PEP E4P

Pi

Glucose

Glucose~P

PTS

PPPEMP

DAHP

DHQ

SHIK

S3P EPSP CHO

DHS

Pi

H2O

NADPH

NADP+

ATP PEP Pi

TCA

PPA

PPY

H2OCO2

L-Glu

αKG

L-Phe

DAHP synthase(aroG, aroF,aroH)

DHQ synthase(aroB)

Shikimate dehydrogenase(ydiB, aroE)

Shikimate kinase(aroL, aroK)

DHQ dehydratase(aroD)

EPSP synthase(aroA)

Chorismate synthase(aroC)

Chorismate mutase/prephenate dehydratase

(pheA)

Aminotransferases(aspC,tyrB,ilvE)Phe

Tyr Trp

Phe

Tyr Phe

Tyr Trp Phe

Inhibition and RepressionRepression Inhibition

Intracellular

ExtracellularCell membrane

L-Phe

aroP pheP

Fig. 1. Biosynthetic pathways, regulation, and transport systems of Phe in wild type E. coli. Metabolites abbreviations: PEP, phosphoenolpyruvate; E4P, erythrose4-phosphate; DAHP, 3-deoxy-d-arabino- heptulosonate-7-phosphate; DHQ, 5-dehydro- quinate;DHS, 5-dehydroshikimate; SHIK, shikimate; S3P, shikimate5-phosphate; ESPS,3-enolpyruvylshimate-5-phosphate; CHO, chorismate; PPA, prephenate; PPY, phenylpyruvate; Phe, l-phenylalanine; l-Glu, glutamate; �KG, �-ketoglutarate; Tyr, l-tyrosine;Trp, l-tryptophan.

would be more reasonable to screen an effective aroGfbr gene accu-mulating Phe as aroG contributed 80% of the total DAHP activities[8]. Till now, there have been six kinds of aroGfbr genes (aroG4,aroG8, aroG15, aroG17, aroG29, and aroG40) [11–15] reported. How-ever, their relative capacities for Phe accumulation have not beenstudied yet. In this paper, we focused on the fermentation perfor-mance of these six mutants intended to find a better one for Pheaccumulation.

The only one enzyme that is inhibited by an intermediate in thecommon aromatic amino acids pathway is shikimate dehydroge-nase (aroE) (Fig. 1), exhibiting linear mixed-type inhibition withan inhibition constant of 0.16 mM of shikimate [16]. In chromo-some, aroE is flanked by genes of unknown or putative functions(yrdD, yrdC, yrdB, yrdA) which are unrelated to the shikimatepathway [12]. While its isoenzyme ydiB is located between thegene ydiN (coding a putative amino acid transportor [17]) andaroD (coding type I 3-dehydroquinase), the gene cluster ydiN-yidB-aroD shares the same promoter. In some plants and bacteria,ydiB and aroD are also found to fuse together into bifunctionalenzyme. Comparing aroE, the ydiB gene should be the majorform of shikimate 5-dehydrogenase in shikimate synthesis path-way [14]. This was also confirmed in a transcriptome analysis ofE. coli W3110 grown under carbon- or phosphate-limited condi-tions [12].

The aroL encoded shikimate kinase II (Fig. 1) in wild type E. coliis the dominant isoenzyme with high substrate affinity and tightregulation. The Km value (20 mM) of the aroK encoded shikimatekinase I is hundred-fold higher than that of AroL [18,19]. How-ever, the AroL is inhibited at a high substrate concentration [15]and the expression of aroL is repressed by TyrR protein [20]. Underthe high intracellular aromatic amino acid metabolite concentra-tions, it is quite possible that the activity of AroL is limited, while

its isoenzyme AroK (Fig. 1) functions well in an uninhibited fusion[18,21].

Considering the information above, the thermostable cat-alytic domain (CM-PDT domain) of PheA protein was firstlyoverexpressed to investigate its influence on Phe production.The fermentation performances of six aroGfbr mutants werefirstly compared. And some other genes were also studiedto supplement the choices of regulated sites in metabolicengineering.

2. Materials and methods

2.1. Bacterial strains and media

The relevant characteristics of the microbial strains and plasmids used inthe present study are summarized in Table 1. Strains were routinely grownon Luria–Bertani media supplemented by appropriate antibiotics (ampicillin(100 mg/L), or kanamycin (30 mg/L)) when necessary for selection.

2.2. Expression of PN25-pheAfbr

The 1–900 bp of pheA from E. coli W3110 was overexpressed under the con-stitutive promoter PN25 [22–24]. Primer pheA EcoRI PN25 S/D fw (Table 2) witha PN25 promoter and ribosome binding site and primer pheA EcoRV rv witha terminator codon were used for cloning the gene pheAfbr coding CM-PDTfrom E. coli W3110 to construct the fragment PN25-pheAfbr. Both the frag-ment PN25-pheAfbr and plasmid pET28a were digested by EcoRI and EcoRV,and then the resulting fragments were ligated together to construct plasmidpNpheA.

2.3. Expression of aroGfbr genes

The six aroGfbr genes were cloned by site-directed mutagenesis PCRmethod [25] by the primers listed in Table 3. Then they were connectedwith the pMD18-T Vector by TA cloning to construct the plasmids BT-aroG4, BT-aroG8, BT-aroG15, BT-aroG17, BT-aroG29, and BT-aroG40. Afterdigestion with restriction enzymes, the target fragments were ligated with

400 401

Table 1Microbial strains and plasmids used in this study.

Relevant characteristics Source or reference

StrainsE. coli JM109 recA1 supE44 endA1 hsdR17 gyrA96

relA1 thi (Lac-proAB) F�[traD36proAB+ lacIq lacZM15

Stratagene

E. coli W3110 F− �− IN(rrnD–rrnE)1 rph-1 ATCC 27325Plasmids

pMD18-T Vector bla TaKaRa, JapanpET28a Kanr lacI NovagenpNpheA Kanr PN25-pheAfbr This workT-aroG4 Ampr aroG4 This workT-aroG8 Ampr aroG8 This workT-aroG15 Ampr aroG15 This workT-aroG17 Ampr aroG17 This workT-aroG29 Ampr aroG29 This workT-aroG40 Ampr aroG40 This workpNpheAaroG4 Kanr PN25-pheAfbr aroG4 This workpNpheAaroG8 Kanr PN25-pheAfbr aroG8 This workpNpheAaroG15 Kanr PN25-pheAfbr aroG15 This workpNpheAaroG17 Kanr PN25-pheAfbr aroG17 This workpNpheAaroG29 Kanr PN25-pheAfbr aroG29 This workpNpheAaroG40 Kanr PN25-pheAfbr aroG40 This workT-ydiBaroK Ampr ydiB aroK This workpNpheABK15 Kanr PN25-pheAfbrydiBaroK aroG15 This work

pNpheA to construct the plasmids pNpheAaroG4, pNpheAaroG8, pNpheAaroG15,pNpheAaroG17, pNpheAaroG29, and pNpheAaroG40. These plasmids were trans-formed into E. coli W3110 respectively to investigate their fermentationperformances.

2.4. Expression of ydiB and aroK

Gene ydiB and aroK was amplified from the chromosome of E. coliW3110 with primers ydiB SmaI FW, ydiB aroK RV and aroK ydiB FW,aroK SmaI RV (Table 2). Then the fragment ydiBaroK was obtained by over-lapping PCR method with primers ydiB SmaI FW and aroK SmaI RV. Afterdigestion by SmaI, the fragment ydiBaroK was ligated with pNpheApQ15which was previously digested by EcoRV. The resulting plasmid was namedpNpheABKpQ15.

2.5. Fermentation condition

The fermentation medium was reported previously [3]. Fermentation exper-iments were performed in triplicate. Shake flask fermentations were carried outin 500-mL Erlenmeyer flasks containing 70 mL fermentation medium inoculatedwith 5% (v/v) seed cultures at 37 ◦C and 150 rpm on rotary shakers. Besides, 20 g/Lglucose and 10 g/L CaCO3 were added. Fed-batch fermentation were performedin a 15-L jar fermentor with an initial broth volume of 6 L of the fermenta-tion medium. After sterilization, the initial glucose concentration was adjustedto 8 g/L, when it was lower than 5 g/L, 600 g/L glucose was fed into the mediato maintain the concentration at 0.1–5.0 g/L to decrease the formation of aceticacid [2]. Ammonia water was used to maintain the pH at 6.6–6.9. The dissolvedoxygen (DO) level was maintained about 25% saturation. The fermentor wasdesigned by the automation engineering research center of Jiangnan Universitywith on-line glucose controller system equipped with YSI 2700 SELECT Biochemicalanalyzer.

Table 2The sequences of the oligonucleotide primers used in this study.

Primer name Sequence(5�–3�) restriction sites are underlineda Restriction sites

pheA EcoRI PN25 S/D fw TTCTTGAATTCTCATAAAAAATTTATTTGCTTTCAGGAAAATTTTTCTGTATAATAGATTCAAGGAGGAACAGACATGACATCGGAAAACCCGTTACTG

EcoRI

pheA EcoRV rv AAAAAGATATCTCATCACAACGTGGTTT TCGCCGGAA EcoRVaroG KpnI FW TTCTTGGTACCGCTCCTGTTATGGTCGTTATGT KpnIaroG HindIII RV AAAAAAAGCTTAATGAGAAAGCCGACTGC HindIIIydiB SmaI FW TCCCCCGGGGAAGGAGGAACAGACATGGATGTTACCGC

AAAATACGSmaI

ydiB aroK RV CGTTTCTCTGCCATTTTTTACCCTTTCTGCACaroK ydiB FW GTGCAGAAAGGGTAAAAAATGGCAGAGAAACGaroK SmaI RV TCCCCCGGGGTTAGTTGCTTTCCAGCATGT SmaIpheAa ACTCAGCAGGCTTTGCTCCApheAb GCCGCAAGATGGGAATAAGAAihfBa GCCAAGACGGTTGAAGATGCihfBb GAGAAACTGCCGAAACCGC

a The (or the predicated) RBS site was indicated by italic type and the initial codon was indicated by bold type.

Table 3The mutant sites of aroG and their primers for site-directed mutagenesis PCR.

Genes and mutant sites Primer name Primer sequencesa

aroG4150 Pro → Leu CCA → CTA

aroG 150R TCAGCGAGATATTGTAGGGTGAaroG 150F TCACCCTACAATATCTCGCTGA

aroG8202 Ala → Thr GCC → ACC

aroG8 F202 GGCTATCGATACCATTAATGCaroG8 R202 GCATTAATGGTATCGATAGCC

aroG15146 Asp → Asn GAT → AAT

aroG15 F146 GTGAGTTTCTCAATATGATCAaroG15 R146 TGATCATATTGAGAAACTCAC

aroG29147 Met → Ile ATG → ATT

aroG29 F147 TCTCGATATTATCACCCCACAATaroG29 R147 ATTGTGGGGTGATAATATCGAGA

aroG17147 Met → Ile ATG → ATT332Glu → Lys GAA → AAA

aroG29 F147 TCTCGATATTATCACCCCACAATaroG29 R147 ATTGTGGGGTGATAATATCGAGAaroG17 F332 CATCGGCTGGAAAGATACCGAaroG17 R332 TCGGTATCTTTCCAGCCGATG

aroG40157 Met → Ile ATG → ATT219 Ala → Thr GCG → ACC

aroG40 F157 CTGACCTGATTAGCTGGGGCGaroG40 R157 CGCCCCAGCTAATCAGGTCAGaroG40 F219 TGGGGGCATTCGACCATTGTGAATaroG40 R219 ATTCACAATGGTCGAATGCCCCCA

a The bold type shows the mutant sites.

400 401

Table 4Survival percentage (%) of E. coli W3110 and E. coli W3110 (pNpheA) under the stressof mFP.

mFP (g/L) E. coli W3110 E. coli W3110 (pNpheA)

0 100 1000.010 48.0 ± 0.02 99.8 ± 0.20.020 19.1 ± 0.05 96.3 ± 0.40.023 0 95.1 ± 0.50.070 0 51.8 ± 3.20.100 0 25.3 ± 0.70.110 0 12.4 ± 0.20.115 0 4.6 ± 0.30.120 0 0

2.6. Analytical methods

The cell concentration was measured as the optical density at 600 nm (OD) with aspectrophotometer (UV-2100 UV/Vis Spectrophotometer, UNICO(Shanghai) Instru-ments Co., Ltd.) after an appropriate dilution, where the dry cell weight (DCW)concentration was calculated as follow: DCW(g/L) = OD600 × 0.3809–0.0048. Pheconcentration was determined by HPLC using a reverse C18 column (Proficiency ODS5 �m 250 mm × 4.6 mm, Candyet Co., Ltd.) and subsequently detected at 210 nmwith a UV detector (UVD 170U, DIONEX Co., Ltd.). Acetic acid concentration wasdetected as described previously [26]. The survival ability of E. coli W3110 (pNpheA)under the stress of m-Fluoro-dl-phenylalanine (a metabolic analog of Phe) wasdetected on M9 agar supplemented with different concentrations of m-Fluoro-dl-phenylalanine (mFP) [27]. The concentration of mFP that completely inhibited thecell growth was difined as lethal dose. Quantitative real-time polymerase chain reac-tion (qPCR) was carried out according to the MIQE Guidelines [28] with the primers(pheAa, pheAb, ihfBa, ihfBb) (Table 2) [29]. The total RNA and cDNA was preparedas the reported methods [29]. The qPCR was performed by the Bio-Rad Real-TimePCR Detection System with software CFX Maganer3.0 using the SYBR Premix Ex TaqII (TakaRa, Japan).

3. Results and discussion

3.1. The overexpression of CM-PDT domain and its influences onPhe production

As a prerequisite for Phe production, the enzymes involved infeedback inhibition of Phe biosynthesis have to be deregulated. InE. coli, these enzymes mainly include CM-PDT in the Phe-branchedpathway and DAHP-synthesis in the common aromatic amino acidpathway.

The 1–900 bp of pheA was amplified from the chromosomeof E. coli W3110. After ligation with pMD18-T Vector, the frag-ment of PN25-pheAfbr was sequenced and ligated with plasmidpET28a to construct pNpheA. After 48 h of fermentation in Erlen-meyer flasks, the E. coli W3110 (pNpheA) produced 0.22 ± 0.01 g/Lof Phe, while no Phe was detected with the wild type strainE. coli W3110 which indicated that the feedback regulation of pheAwas successfully relieved. The lethal dose by mFP increased from0.023 g/L to 0.120 g/L which was multiplied by 5-fold (Table 4).Besides, the expression level of pheA was also demonstratedto be 66.3 ± 1.08 comparing with E. coli W3110 by qPCR. Thestandard curves of qPCR were as follows: pheA: y = −3.250x + 8.326,r2 = 0.999, efficiency = 103.1%; ihfB: y = −3.364x + 21.121, r2 = 0.988,efficiency = 98.3%. These results firstly indicated that overexpress-ion of amino residues 1–300 from PheA protein could enhancethe metabolic influx to overproduce Phe and improve the sur-vival ability under mFP stress. This was coincident with the reportthat this PheAfbr mutant could retain the CM-PDT activities andrelease the Phe feedback inhibition [7]. Other PheAfbr mutants werealso reported achieved a promising result in Phe accumulation[2,3,30,31]. In this paper, the characterization of PheAfbr mutantwas clear [7]; especially it is a thermalstable mutant.

Unfortunately, the Km values of PheAfbr mutant used werehigher than those of PheA [7] which would decrease the bindingability to its substrates (CM to chorismate and PDT to prephenate).Báez-Viveros et al. [32] reported that this decreased binding ability

could be overcome by directed evolution. Otherwise, enhancing theexpression of pheAfbr was also useful by connecting with a strongand constitutive promoter PN25 to increase the enzyme quantity.Furthermore, a high substrate concentration would exist to neutral-ize the decreasing combination ability by overexpression of aroGfbr

mutant alleles [14].

3.2. The Fermentation performances of different aroG alleles

DAHP synthesis in the common aromatic amino acid pathwaycontrolled the influx of carbon sources. There were several aroGfbr

alleles had been reported (Table 3), while there was no reportabout their relative capacities in Phe production. These aroGfbr

alleles were successfully amplified by site-directed mutagenesisPCR method. Then they were respectively connected with pMD18-T Vector, and sequenced by Beijing Genomics Institute (BGI) toconfirm the correct mutants were generated (Table 3). They wereligated with pNpheA to construct the plasmids pNpheAaroG4,pNpheAaroG8, pNpheAaroG15, pNpheAaroG17, pNpheAaroG29,and pNpheAaroG40, respectively.

After the expression of different aroG alleles, these strains had ahigh survival percentage (>90%) under 0.5 g/L mFP in the minimalmedium, indicating that all the six aroG mutants had released thefeedback inhibition as reported [11–15], while these strains per-formed differently in batch fermentation (Fig. 2). The length orderof lag phase of these strains was E. coli W3110 (pNpheAaroG15)>E. coli W3110 (pNpheAaroG4) >E. coli W3110 (pNpheAaroG29)>E. coli W3110 (pNpheAaroG40) >E. coli W3110 (pNpheAaroG17)>E. coli W3110 (pNpheAaroG8), while the Phe concentrationorder of these stains was E. coli W3110 (pNpheAaroG15)> E. coliW3110 (pNpheAaroG29)> E. coli W3110 (pNpheAaroG40)> E. coliW3110 (pNpheAaroG17)> E. coli W3110 (pNpheAaroG4)> E. coliW3110 (pNpheAaroG8). Except E. coli W3110 (pNpheAaroG4),the strains with high Phe concentration always had a long lagphase. As the aroG alleles shared the same expression frame-work (promoter/transcription factor/RBS/terminator/plasmid/hoststrain) and culture condition, their expression levels shouldapproximate. It was also reported that the activity of aroG15 andaroG29 was higher than that of some aroG alleles under 1–4 mmol/Lof Phe [13] (the intracellular Phe concentration is about 2 mmol/L[33]). Due to the higher activities of aroG15 and aroG29, the quan-titative of PEP and E4P inflowing into the aromatic amino acidpathway might be more than others. In the strains carrying aroG15and aroG29, the metabolites used for cell growth would decrease.

Although the lag phases were extended, the final cell con-centrations of E. coli W3110 (pNpheAaroG15) and E. coli W3110(pNpheAaroG29) did not decline. The high concentrations ofPhe (1.31 ± 0.07 g/L for pNpheAaroG15 and 1.24 ± 0.023 g/L forpNpheAaroG29) with lower acetic acid were also achieved showingthat aroG15 and aroG29 were the best feedback inhibition resis-tant genes for Phe accumulation. The mutants AroG15 and AroG29should be thermostable mutants as AroG4 is a thermostable mutant[11] and both aroG15 and aroG29 brought much higher Phe con-centration than aroG4. Jossek et al. [10] observed that incubation ofAroF for 20 min at 37 ◦C led to 50% decrease of DAHP synthesis activ-ity. In our study, the promoter of aroG15 was the native promoter ofaroG which was recognized by transcript factor �70 and repressedby TyrR. After the exponential growth phase (40–43 h), the expres-sion of aroG15 should be repressed [34] while the Phe concentrationincreased continuously (Fig. 3) until the end of fermentation whichindicated that the AroG15 must keep its activity at 37 ◦C in theequilibrium phase. Thus the aroG15 mutant would be thermostableat 37 ◦C. The strain W3110 (pNpheAaroG4) showed an unreason-able fermentation characteristics which may be associated with theunique characterization of AroG4 [15].

402 403

Fig. 2. Changes in parameters during batch cultures of different aroG mutant alleles.

After expression of the six aroGfbr genes, the Phe concentrationwas increased 5-fold by aroG15 and aroG29. The Phe concentrationachieved 21.2 g/L by W3110 (pNpheAaroG15) in a 15-L jar fermen-tor (Fig. 3), while the Phe yield on glucose is less than 50% of thetheoretical yield (around 0.27 g/g by a non-growing culture [35]).The low yield also occurred in another research [36], they knocked-out the genes coding the key enzymes in the branch pathway

Fig. 3. Changes in parameters during fed-batch cultures of (A): E. coli W3110(pNpheAaroG15) and (B): E. coli W3110 (pNpheABKpQ15).

to enhance the target pathway which inevitably generated aux-otrophic mutants. In this report, it was found that overexpressionof ydiB and aroK could also enhance Phe synthesis.

3.3. Expression of ydiB and aroK to improve Phe secretion

Gene fragment ydiBaroK was connected with pMD18-T Vector,and then the resulting plasmid T-ydiBaroK was sequenced by BGIto confirm the sequence. The fragment ydiBaroK was connected tothe downstream of pheA in pNpheAaroG15 to construct plasmidpNpheABKpQ15.

Fed-batch fermentation revealed that Phe production wastightly correlated with cell growth, exhibiting the maximum con-centration after the exponential growth phase (Fig. 3). W3110(pNpheAaroG15) showed a long lag phase and short exponentialphase which was not suitable for Phe accumulation as Phe was atypical first metabolic product and longer exponential phase wouldextend its accumulation period. After overexpression of ydiB andaroK, the lag phage was shortened and the accumulation periodwas extended.

The final Phe concentration were 21.2 g/L and 23.8 g/L for W3110(pNpheAaroG15) and W3110 (pNpheABK15) with Phe yield on glu-cose of 0.124 g/g and 0.153 g/g, respectively (Table 5). The Pheyield on glucose achieved by W3110 (pNpheABK15) is the sameas Gerigk et al. [3]. It might be improved to above 0.2 g/g by

402 403

Table 5Comparison of parameters in the fed-batch fermentation by E. coli W3110(pNpheAaroG15) and E. coli W3110(pNpheABK15) after 48 h.

Strains E. coli W3110 (pNpheAaroG15) E. coli W3110 (pNpheABK15)

Glucose consumption (g/L) 196 ± 8 150 ± 5Maximum glucose consumption speed (g/L/h) 11.9 ± 0.29 8.4 ± 0.20Maximum Phe productivity (g/L/h) 0.036 ± 0.001 0.073 ± 0.002Final Phe concentration (g/L) 21.2 ± 0.6 23.8 ± 1.1Acetic acid concentration (g/L) 1.49 ± 0.17 2.47 ± 0.21Maximum DCW (g/L) 58.7 ± 1.2 30 ± 0.8Phe yield on Glucose (g/g) 0.124 ± 0.05 0.154 ± 0.06Phe yield on cell (g/DCW) 0.35 ± 0.02 0.79 ± 0.07

fermentation parameters optimization [2] and integrated extrac-tion and fermentation [3,31]. It was also shown that changes in PTS[32], glycolysis and pentose–phoshate pathway [15] could increasethe yield. Tyrosine biosynthesis up to prephenate runs in parallel toPhe and it would be a drain of carbon source and energy [6]. Usingan l-tyrosine auxotrophic strain might also increase the yield.

The maximum cell concentration and glucose consumptionspeed of W3110 (pNpheAaroG15) was much higher than thatof W3110 (pNpheABK15), while both the Phe yield on cell(0.79 g/g) and maximum Phe productivity (0.073 g/L/h) achievedby W3110 (pNpheABK15) were twice as much as that of W3110(pNpheAaroG15). Lütke-Eversloh et al. [15] found that overex-pression of ydiB and aroK could improve l-tyrosine production inl-tyrosine producer. In this research, overexpression of ydiB andaroK has little effect on the Phe concentration, while they can raisethe yield and maximum productivity and shorten the lag phase.This might be a result of decreasing in plasmid number due toaddition of ydiB and aroK on the same plasmid. After ydiB and aroKwas expressed by the plasmid, the total activities especially theDAHP-synthase, CM and PDT might be lower as the plasmid num-ber decreased. As the burden is heavier, the cell concentration alsodropped (Fig. 3). After overexpression of ydiB and aroK, the yieldand maximum productivity were increased significantly (Table 5),while the total Phe concentration and average productivity onlyincreased little due to the drop of cell concentration. This nega-tive effect might be overcome by providing a eutrophic medium bysupplementing yeast extract, peptone and so on [30].

The relationship between cell growth and the expression of geneydiB and aroK is reasonable as in a systems biology research, it wasfound that the regulation of ydiB and aroK was closely dependent onthe growth conditions of E. coli W3110 [12]. Rüffer et al. [31] usinga similar method achieved a nearby yield of 0.146 g/g, then theyincreased the yield and the total Phe production using an in situproduct recovery approach. Gerigk et al. [2,3] and Zhou et al. [30]also increases the Phe yield and concentration by the fermentationparameters optimization. The experiences from these researcheswould be helpful for elevating the fermentation performance ofE. coli W3110 (pNpheABK15).

4. Conclusion

In this study, the genes of pheA, aroG, aroK and ydiB were eval-uated their effects on Phe production. The CM-PDT domain ofPheA protein was firstly applied in Phe fermentation. It was indi-cated that the CM-PDT domain of PheA protein could improve themetabolic influx to overproduce Phe and also improve the survivalability under mFP stress. The practical fermentation performance ofaroG mutants was compared and we found that aroG15 and aroG29were the best feedback inhibition resistant genes for Phe fermen-tation. It was also found that the genes ydiB and aroK could raisethe yield and shorten the lag phase. These findings indicated thatcombinational expression of pheAfbr, aroG15, ydiB and aroK on onevector was an effective method for industrial strains constructionfor l-Phe fermentation.

Acknowledgements

This work was financial supported by the “863” Program(2012AA021201), the Program for New Century Excellent Talentsin University (NCET-11-0665), Innovative Research Team of JiangsuProvince, the Priority Academic Program Development of JiangsuHigher Education Institutions, the Innovative Program for GraduateStudent of Jiangsu Province (CXLX12 0733) and the FundamentalResearch Funds for the Central Universities (JUDCF12016).

References

[1] Grinter NJ. Developing an l-phenylalanine process. Chem Tech 1998;28:33–7.[2] Gerigk M, Bujnicki R, Ganpo-Nkwenkwa E, Bongaerts J, Sprenger G, Takors

R. Process control for enhanced l-phenylalanine production using differentrecombinant Escherichia coli strains. Biotechnol Bioeng 2002;80:746–54.

[3] Gerigk MR, Maass D, Kreutzer A, Sprenger G, Bongaerts J, Wubbolts M, et al.Enhanced pilot-scale fed-batch L-phenylalanine production with recombinantEscherichia coli by fully integrated reactive extraction. Bioprocess Biosyst Eng2002;25:43–52.

[4] Konstantinova KB, Nishio N, Seki T, Yoshida T. Physiologically motivated strate-gies for control of the fed-batch cultivation of recombinant Escherichia coli forphenylalanine production. J Biosci Bioeng 1991;71:350–5.

[5] Nelms J, Edwards RM, Warwick J, Fotheringham I. Novel mutations in the pheAgene of Escherichia coli K-12 which result in highly feedback inhibition-resistantvariants of chorismate mutase prephenate dehydratase. Appl Environ Micro-biol 1992;58:2592–8.

[6] Sprenger GA. From scratch to value: engineering Escherichia coli wild type cellsto the production of l-phenylalanine and other fine chemicals derived fromchorismate. Appl Microbiol Biotechnol 2007;75:739–49.

[7] Zhang S, Pohnert G, Kongsaeree P, Wilson DB, Clardy J, Ganem B. Choris-mate mutase-prephenate dehydratase from Escherichia coli. Study of catalyticand regulatory domains using genetically engineered proteins. J Biol Chem1998;273:6248–53.

[8] Herrmann KM. The common aromatic biosynthetic pathway. In: HerrmannKM, Somerville RL, editors. Amino acids: biosynthesis and genetic regulation.Boston: Addison-Wesley; 1983. p. 301–22.

[9] Mccandliss RJ, Poling MD, Herrmann KM. 3-Deoxy-d-arabino-heptulosonate7-phosphate synthase. Purification and molecular characterization of thephenylalanine-sensitive isoenzyme from Escherichia coli. J Biol Chem1978;253:4259–65.

[10] Jossek R, Bongaerts J, Sprenger GA. Characterization of a new d-arabino-heptulosonate 7-phosphate feedback-resistant 3-deoxy-synthase AroF ofEscherichia coli. FEMS Microbiol Lett 2001;202:145–8.

[11] Doroshenko VG, Tsyrenzhapova IS, Krylov AA, Kiseleva EM, Ermishev YV,Kazakova SM, et al. Pho regulon promoter-mediated transcription of the keyPath way gene aroGFbr Improves the performance l-phenylalanine-producingEscherichia coli strain. Appl Microbiol Biotechnol 2010;88:1287–95.

[12] Johansson L, Lidén G. Transcriptome analysis of a shikimic acid producing strainof Escherichia coli W3110 grown under carbon- and phosphate-limited condi-tions. J Biotechnol 2006;126:528–45.

[13] Kikuchi Y, Tsujimoto K, Kurahashi O. Mutational alanalysis of the feedback sitesof phenylalanine-sensitive 3-deoxy-d-arabino-heptulosonate-7-phosphatesynthase of Escherichia coli. Appl Environ Microbiol 1997;63:761–2.

[14] Lütke-Eversloh LE, Stephanopoulos G. l-tyrosine production by deregulatedstrains of Escherichia coli. Appl Microbiol Biotechnol 2007;75:103–10.

[15] Lütke-Eversloh T, Stephanopoulos G. Combinatorial pathway analysis forimproved l-tyrosine production in Escherichia coli identification of enzymaticbottlenecks by systematic gene overexpression. Metab Eng 2008;10:69–77.

[16] Dell KA, Frost JW. Identification and removal of impediments to biocat-alytic synthesis of aromatics from d-glucose: rate-limiting enzymes in thecommon pathway of aromatic amino acid biosynthesis. J Am Chem Soc1993;115:11581–9.

[17] Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. NuclAcids Res 2000;28:27–30.

[18] DeFeyter RC. Shikimate kinases from Escherichia coli K12. Methods Enzymol1987;142:355–61.

404 404

[19] Ely B, Pittard J. Aromatic amino acid biosynthesis: regulation of shikimatekinase in Escherichia coli K-12. J Bacteriol 1979;138:933–43.

[20] Pittard J, Camakaris H, Yang J. The TyrR regulon. Mol Microbiol 2005;55:16–26.[21] DeFeyter RC, Pittard J. Purification and properties of shikimate Kinase II from

Escherichia coli K-12. J Bacteriol 1986;165:331–3.[22] Deuschle U, Kammerer W, Gentz R, Bujard H. Promoters of Escherichia coli:

a hierarchy of in vivo strength indicates alternate structures. EMBO J1986;5:2987–94.

[23] Gentz R, Bujard H. Promoters recognized by Escherichia coli RNA polymeraseselected by function: highly efficient promoters from bacteriophage T5. J Bac-teriol 1985;164:70–7.

[24] Kammerer W, Deuschle U, Gentz R, Bujard H. Functional dissection ofEscherichia coli promoters information in the transcribed region is involvedin late steps of the overall process. EMBO J 1986;5:2995–3000.

[25] Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis byoverlap extension using the polymerase chain reaction. Gene 1989;77:51–9.

[26] Liu SP, Ding ZY, Zhang L, Gu ZH, Wang XL, Sun XJ, et al. Ethanol production fromLycoris radiata Herbert (Amarylllidaceae) residues as a new resource. BiomassBioenerg 2012;37:237–42.

[27] Shetty K, Crawford DL, Pometto AL. Production of l-phenylalanine from starchby analog-resistant mutants of Bacillus polymyxa. Appl Environ Microbiol1986;52:637–43.

[28] Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQEguidelines: minimum information for publication of quantitative real-time PCRExperiments. Clin Chem 2009;55:611–22.

[29] Flores N, Flores S, Escalante A, de Anda R, Leal L, Malpica R, et al. Adaptation forfast growth on glucose by differential expression of central carbon metabolism

and gal regulon genes in an Escherichia coli strain lacking the phosphoenolpyru-vate: carbohydrate phosphotransferase system. Met Eng 2005;7:70–87.

[30] Zhou HY, Liao XY, Liu L, Wang TW, Du GC, Chen J. Enhanced l-phenylalanineproduction by recombinant Escherichia coli BR-42 (pAP-B03) resistant to bac-teriophage BP-1 via a two-stage feeding approach. J Ind Microbiol Biotechnol2011;38(9):1219–27.

[31] Rüffer N, Heidersdorf U, Kretzers I, Sprenger GA, Raeven L, Takors R. Fully inte-grated l-phenylalanine separation and concentration using reactive-extractionwith liquid–liquid centrifuges in a fed-batch process with E. coli. BioprocessBiosyst Eng 2004;26:239–48.

[32] Báez-Viveros JL, Osuna J, Hernández-Chávez G, Soberón X, Bolívar F, Gosset G.Metabolic engineering and protein directed evolution increase the yield of l-phenylalanine synthesized from glucose in Escherichia coli. Biotechnol Bioeng2004;87:516–24.

[33] Doroshenko V, Airich L, Vitushkina M, Kolokolova A, Livshits V, Mashko S. YddGfrom Escherichia coli promotes export of aromatic amino acids. FEMS MicrobiolLett 2007;275(2):312–8.

[34] Navarro Llorens JM, Tormo A, Martínez-García E. Stationaryphase in gram-negative bacteria. FEMS Microbiol Rev 2010;34(4):476–95.

[35] Förberg C, Eliaeson T, Häggström L. Correlation of theoretical and experimentalyields of phenylalanine from non-growing cells of a rec Escherichia coli strain.J Biotechnol 1988;7(4):319–31.

[36] Zhao ZJ, Zou C, Zhu YX, Dai J, Chen S, Wu D, et al. Development of l-tryptophanproduction strains by defined genetic modification in Escherichia coli. J IndMicrobiol Biotechnol 2011;38:1921–9.