article in press - mcbl.iisc.ernet.in · fusa-like locus, fusa2 which encodes efg2. a comparison of...

lable at ScienceDirect

ARTICLE IN PRESS

Tuberculosis xxx (2009) 112

Contents lists avai

Tuberculosis

journal homepage: ht tp: / / int l .e lsevierheal th.com/journals / tube

Analysis of the fusA2 locus encoding EFG2 in Mycobacterium smegmatis

Anuradha Seshadri, Laasya Samhita, Rahul Gaur, Vidyasagar Malshetty, Umesh Varshney*

Department of Microbiology and Cell Biology, Indian Institute of Science, CNR Rao Circle, Bangalore 560012, India

a r t i c l e i n f o

Article history:Received 30 April 2009Received in revised form1 June 2009Accepted 5 June 2009

Keywords:EFG2GTPaseMycobacterium smegmatisCompetitive fitness

* Corresponding author. Tel.: 91 80 2293 2686; faE-mail addresses: [email protected],

(U. Varshney).

1472-9792/$ see front matter 2009 Elsevier Ltd.doi:10.1016/j.tube.2009.06.003

Please cite this article in press as: Seshadri Adoi:10.1016/j.tube.2009.06.003

s u m m a r y

The translation elongation factor G (EFG) is encoded by the fusA gene. Several bacteria possess a secondfusA-like locus, fusA2 which encodes EFG2. A comparison of EFG and EFG2 from various bacteria revealsthat EFG2 preserves domain organization and maintains significant sequence homology with EFG,suggesting that EFG2 may function as an elongation factor. However, with the single exception of a recentstudy on Thermus thermophilus EFG2, this class of EFG-like factors has not been investigated. Here, wehave characterized EFG2 (MSMEG_6535) from Mycobacterium smegmatis. Expression of EFG2 wasdetected in stationary phase cultures of M. smegmatis (Msm). Our in vitro studies show that whileMsmEFG2 binds guanine nucleotides, it lacks the ribosome-dependent GTPase activity characteristic ofEFGs. Furthermore, unlike MsmEFG (MSMEG_1400), MsmEFG2 failed to rescue an E. coli strain harboringa temperature-sensitive allele of EFG, for its growth at the non-permissive temperature. Subsequentexperiments showed that the fusA2 gene could be disrupted in M. smegmatis mc2155 with KanR marker.The M. smegmatis fusA2::kan strain was viable and showed growth kinetics similar to that of the parentstrain (wild-type for fusA2). However, in the growth competition assays, the disruption of fusA2 wasfound to confer a fitness disadvantage to M. smegmatis, raising the possibility that EFG2 is of somephysiological relevance to mycobacteria.

2009 Elsevier Ltd. All rights reserved.

1. Introduction

The translation elongation factor G (EFG) is a member of thetranslation-associated GTPase family1,2 which includes IF2, EF-Tu,RF3, and the less commonly known LepA, all of which contain aG-domain with the characteristic signature motifs and carry outGTP hydrolysis in a ribosome-dependent manner. EFG participatesat two steps during translation: translocation and ribosome recy-cling. During the elongation step, binding of EFG to the ribosome(after peptide bond formation) and subsequent GTP hydrolysis byEFG induces a conformational change of the ribosome whichpromotes tRNA:mRNA translocation.35 On the other hand, duringribosome recycling, EFG collaborates with the ribosome recyclingfactor (RRF) to dissociate the post-termination complex (thecomplex after translation termination which consists of the 70Sribosome and deacylated tRNA bound to the mRNA). Biochemicaland genetic studies have revealed that specific interactionsbetween RRF and EFG are important for ribosome recycling.68 Thegene encoding EFG (fusA) has been shown to be essential in E. coli.9

Genome sequencing data have revealed that homologs of EFG,encoded by fusA2, are found in several bacteria such as Thermus

x: 91 80 2360 [email protected]

All rights reserved.

, et al., Analysis of the fusA2 lo

thermophilus, Pseudomonas aeruginosa, Thermoanaerobacter teng-congensis and several mycobacterial species including Mycobacte-rium smegmatis, Mycobacterium tuberculosis and Mycobacteriumavium paratuberculosis. However, in Mycobacterium leprae, EFG2 isfound as a pseudogene. The observation that many bacterial speciespossess fusA2 suggests a biological significance of the EFG2 protein.However, with the exception of a study on EFG2 from T. thermo-philus (TthEFG2),10 the structure, function or biological role of thisclass of factors has not been investigated. The study on TthEFG2showed that it is a ribosome-dependent GTPase (at par withTthEFG), and is active in in vitro polyphenylalanine synthesis pro-grammed by poly(U). The overall structure of TthEFG2 complexedwith GTP, and its binding to T. thermophilus ribosome as determinedby cryo-EM, were found to be similar to that of EFG.10 However,unlike EFG, TthEFG2 possesses a detectable intrinsic GTPaseactivity, suggesting a possible divergence in its biological function.

A gene (Rv0120c) encoding EFG2 (MtufusA2) is present inM. tuberculosis, a successful pathogen which infects over one-thirdof the world population and causes tuberculosis in humans. EFG2was found to be expressed in M. tuberculosis cultures,11 and theEFG2 mRNA was up-regulated during starvation.12 Mycobacteriaresiding in the host are often exposed to low or restricted nutrientconcentrations, which they survive for extended periods oftime.13,12 These observations raised the question whether EFG2plays a role in the biology of mycobacteria, especially during

cus encoding EFG2 in Mycobacterium smegmatis, Tuberculosis (2009),

mailto:[email protected]:[email protected]/science/journal/14729792http://http://intl.elsevierhealth.com/journals/tube

A. Seshadri et al. / Tuberculosis xxx (2009) 1122

ARTICLE IN PRESS

starvation conditions. In this study, we have employed M. smeg-matis, a fast-growing non-pathogenic saprophyte which containsMSMEG_6535 as the homolog of Rv0120c, as a model to study thefunctional relevance of EFG2 in mycobacteria.

2. Materials and methods

2.1. Bacterial strains, culture conditions and reagents

The bacterial strains, plasmids and the DNA oligomers are listedin Table 1. Culture media components were procured from Difco,USA. Escherichia coli strains TG1 and BL21 (DE3), respectively, wereused for cloning and expression studies, and grown in Luria Bertani(LB) broth or LB agar (LB with 1.6% agar) at 37 C or other specifiedtemperatures. The media for E. coli were supplemented withampicillin (Amp, 100 mg ml1), tetracycline (Tet, 7.5 mg ml1),kanamycin (Kan, 25 mg ml1), gentamycin (Gen, 20 mg ml1), orisopropyl-b-D-thiogalactopyranoside (IPTG, 0.5 mM) as required.E. coli PEM100 was cultured in low salt-LB (LSLB) medium or agar

Table 1List of strains, plasmids and oligonucleotides used in this study.

Strains/plasmids/oligonucleotide

Relevant details Reference

M. smegmatis SN2 Wild-type Lab stockM. smegmatis mc2155 A high efficiency transformation strain

of M. smegmatis43

M. smegmatis mc2155fusA2::kan

M. smegmatis mc2155 derivative whereinfusA2 gene has been disrupted with kancassette; KanR

This study

M. smegmatis mc2155L5att::pDK20

Contains pDK20 (vector control) integratedat the L5att site in the genome ofM. smegmatis mc2155; KanR

This study

E. coli LJ14 E. coli MC1061 containing the frrts

(frr14) allele44

E. coli PEM100 ara D(lac-proAB) F80lacZDM15 fusA100ts 9E. coli BL21 (DE3) hsdS gal (lcIts857 ind 1 Sam7 nin5

lacUV5-T7 gene 145

E. coli TG1 supE hsdD5 thi D(lac-proAB) F0

[traD36 proAB lacIq lacZDM15]20

pTrc99C E. coli expression vector; AmpR AmershampTrcEcoEFG E. coli EFG (fusA) cloned into

pTrc99C (AmpR)6

pTrcMsmEFG M. smegmatis EFG (fusA) cloned intopTrc99A (AmpR)

46

pTrcMsmEFG2 M. smegmatis EFG2 cloned intopTrc99C; AmpR

This study

pRSETBMsmEFG2 pRSETB based expression construct ofMsmEFG2, allowing expression ofMsmEFG2 as a His-tag fusion protein;AmpR

This study

pACDH A vector harboring ACYC origin ofreplication, compatible with ColE1origin of replication; TetR

47

pACDHMsmRRF M. smegmatis RRF gene and downstreamregion (~400 bp) cloned into pACDH; TetR

46

pPR27 An E. coli-mycobacteria shuttle vectorcontaining a temperature-sensitiveorigin of replication (mycobacteria) anda sacB counter-selection marker; GenR

17

pTrcMsmEFG2::kan pTrcMsmEFG2 wherein EFG2 gene hasbeen disrupted with kan; AmpR, KanR

This study

pPR27MsmEFG2::kan pPR27 harboring the disrupted MsmEFG2::kan for allelic exchange of the M. smegmatischromosomal gene; GenR, KanR

This study

pDK20 An integration vector for mycobacteria; KanR 48MsmEFG2-fp 50 ACAGCCATGGCGGACAGAACACAT 30 This studyMsmEFG2-rp 50 CGGCAAGCTTACTCAGGCGCTCGT 30 This studyMsmEFG2-IP2 50 GCCTCGTTCTTCCCGGTGAT 30 This studyMsmEFG2 dn-rp 50 GTCCAGCTTGAGGAAGGCGC 30 This studyMsmEFG2-IP3 50 GTGGTGGCGGGCGACATCTG 30 This studyMsmEFG2-IP4 50 ATCTTCGTCGCCGCCGCGGC 30 This study

Please cite this article in press as: Seshadri A, et al., Analysis of the fusA2 lodoi:10.1016/j.tube.2009.06.003

(LSLB with 1.6% agar) containing 0.4% NaCl (as opposed to thestandard 1%). M. smegmatis mc2155 or its derivatives were grown inLBT broth (LB supplemented with 0.2% Tween-80 v/v) or LBT agar(LBT with 1.6% agar), or Middlebrook 7H9 medium (7H9) supple-mented with 0.2% Tween-80 (v/v) and 0.2% glycerol (v/v). Unlessmentioned otherwise, growth in liquid medium was carried outunder shaking conditions at 37 C. The media for M. smegmatiswere supplemented with Gen (5 mg ml1) and Kan (50 mg ml1) asrequired. Sucrose selection for M. smegmatis was performed onMiddlebrook 7H10 solid medium with 0.2% glycerol (v/v), 0.2%Tween-80 (v/v) and 10% sucrose (w/v). For in vitro hypoxia exper-iments, M. smegmatis strains were grown in Dubos medium (DBT)containing Dubos broth base supplemented with 5% glycerol (v/v),0.2% Tween-80 (v/v) and 10% (v/v) ADC (bovine albumin fraction V,dextrose and catalase). For growth curve analysis, five individualcolonies of each strain were grown to saturation (~50 h) in LBT or7H9 (as specified) with the appropriate antibiotics at 37 C, anddiluted 1000-fold in the corresponding medium (LBT or 7H9)containing 0.5% bovine serum albumin (BSA) but without antibi-otics. Aliquots (200 ml) of the diluted culture were taken inhoneycomb plates and shaken in automated Bioscreen C growthreaders (Oy Growth, Helsinki, Finland) maintained at 37 C. Thegrowth was monitored by measuring OD600 at 3 h intervals, anddata were plotted as mean standard error of mean (SEM).

2.2. Cloning and purification of EFG2 from M. smegmatis

The nucleotide sequence of the gene encoding M. smegmatisEFG2 (MsmfusA2, MSMEG_6535; Fig. S1) was obtained from TheInstitute of Genomic Research (TIGR) web site (http://www.tigr.org), and amplified by PCR from the genomic DNA of M. smegma-tis SN2 in a 50 ml reaction containing ~200 ng of the template DNA,200 mM dNTPs and 30 pmol each of the forward (MsmEFG2-fp) andreverse (MsmEFG2-rp) primers using Pfu DNA polymerase. The PCRconditions included heating at 94 C for 5 min, followed by 30cycles of incubations at 94 C for 1 min, 58 C for 15 s, 68 C for5 min, and a final extension at 68 C for 10 min. The product(~2.1 kb) was digested with NcoI and HindIII and cloned intosimilarly digested pTrc99C vector to generate pTrcMsmEFG2. Theclones obtained were confirmed by DNA sequencing. To generatea T7 RNA polymerase based expression construct, pTrcMsmEFG2was first digested with NcoI, end-filled, and then digested withHindIII to release the insert (w2.1 kb) which was then cloned intoNheI (end-filled)-HindIII sites of pRSETB.

The pRSETB MsmEFG2 construct was introduced into E. coli BL21(DE3), and the transformants were grown in LB medium at 30 C,induced with IPTG (0.5 mM) at OD600 of w0.6, and then harvested6 h post-induction by centrifugation at w7500 g (RA-1500,Kubota). The cells were resuspended in 15 ml of binding buffer(50 mM potassium phosphate, pH 7.85 and 500 mM NaCl), soni-cated 1012 times (3 pulses of 3 s each) using a macroprobe (Vibra-cell, Sonics and Materials Inc, USA) and then centrifuged atw18,000 g (RA-300 G, Kubota) for 30 min at 4 C. The supernatantwas loaded onto a Ni-NTA column (Amersham), and eluted witha linear gradient of imidazole (10500 mM) in the same buffer. Thefractions containing apparently homogenous protein were pooledand dialyzed against the buffer containing 20 mM TrisHCl, pH7.85, 50 mM NaCl, 2 mM b-mercaptoethanol, 1 mM Na2EDTA and10% (v/v) glycerol, and stored at 20 C.

2.3. Crosslinking of [a-32P]GTP with MsmEFG2

One mg of MsmEFG2, EcoEFG, MsmEFG (w1.25 mM concentrationin the reaction) or EcoRRF (w5 mM) was mixed with 0.1 mCi of[a-32P]GTP along with either nil, 1.25 mM, 12.5 mM or 125 mM of


http://www.tigr.orghttp://www.tigr.org

A. Seshadri et al. / Tuberculosis xxx (2009) 112 3

ARTICLE IN PRESS

non-radioactive GTP/GDP/ATP in 10 ml of a buffer (20 mM Trisacetate, pH 7.9, 50 mM potassium acetate, 10 mM magnesiumacetate, 1 mM DTT) and exposed to 254 nm UV light from a distanceof w2.5 cm for 10 min using a hand held source (UVAC-16, UltraLum Inc., Carson CA). An equal volume of 2 SDS-loading dye wasthen added and the reactions were heated at 90 C for 5 min,separated on 12% SDS-PAGE, stained with Coomassie blue to ensureequal protein concentration, and subjected to BioImage Analyzer(FLA2000, Fuji Film, Japan). For competition with pppGpp, 0.1 mCi of[a-32P]GTP and 1.25 mM (1-fold with respect to protein) of non-radioactive GTP was taken along with either nil, 1.25 mM, 12.5 mM or125 mM (corresponding, respectively, to nil, 1-fold, 10- or 100-foldmolar excess with respect to the proteins) of pppGpp, and the assayperformed as above.

2.4. Isolation of polysomes from log phase or stationary phasecultures of E. coli and M. smegmatis

Polysomes from the log phase cultures of E. coli MRE600 wereisolated using sonication method to lyse the cells.14 Polysomes fromM. smegmatis were isolated from both stationary phase as well aslog phase cultures by growing M. smegmatis mc2155 cultures in LBTmedium at 37 C till mid-log phase (w0.70.8 OD600) or till satu-ration (for 43 h after inoculation using 1.5% inoculum from a satu-rated culture). The cultures were quick chilled on ice-salt mix.M. smegmatis cells were harvested by centrifugation at w7500 g(RA-1500, Kubota), and resuspended in 20 ml of buffer B (10 mMTris-HCl, pH 7.8, 1 M NH4Cl, 40 mM magnesium acetate, 10 mMb-mercaptoethanol and 2 mM Na2EDTA), and mixed with 5 ml ofa solution containing 1.67% Brij-35, 0.1% deoxycholate, 90 mMNH4Cl and 35 mM magnesium acetate. Subsequently, 2 ml of30 mM Tet solution (prepared in 80% ethanol) was added, andincubated for 5 min on ice. One millilitre of lysozyme (40 mg ml1

prepared in buffer B) was then added and incubated for 5 min onice. The cells were sonicated five times (3 pulses of 3 s each) usinga macroprobe (Vibra-cell, Sonics and Materials Inc., USA) andcentrifuged at 25,000g (RA-300 G, Kubota) for 10 min. The pelletwas resuspended in buffer B, sonicated and centrifuged again, asabove. Both the supernatants were pooled and centrifuged at100,000g for 2 h (SW28, Beckman). The pellet was resuspended inbuffer B (w20 ml) and layered on 7 ml of 34% sucrose solution(prepared in buffer B), and centrifuged at 70,000g for 10 h (SW28,Beckman). The polysome pellet so obtained was resuspended in thebuffer containing 10 mM TrisHCl, pH 7.4, 8.2 mM MgSO4 and80 mM NH4Cl for polysomes isolated from stationary phasecultures, and in a buffer of similar composition, but of pH 7.2 andwith 7.8 mM MgSO4 for the polysomes isolated from log phasecultures of M. smegmatis.

2.5. GTPase assays

Reactions (25 ml) containing 0.1 mM polysomes (2.5 pmol) fromM. smegmatis (Msm polysomes) or E. coli (Eco polysomes) and0.1 mM (w0.2 mg), 0.5 mM (w1 mg), 1 mM (w2 mg), 2.5 mM (5 mg) or5 mM (10 mg) of EFG (Eco- or Msm-EFG) or MsmEFG2 in 50 mM TrisHCl, pH 7.8, 60 mM NH4Cl, 16 mM MgCl2, 7 mM b-mercaptoethanoland 250 mM GTP containing trace amounts (0.2 mCi/reaction) of[g-32P]GTP were incubated at 37 C for 30 min, and stopped byaddition of an equal volume (25 ml) of 40% formic acid solution. Onemicrolitre of the reaction was spotted on a PEI-Cellulose TLC plate(Polygram 300 CEL PEI-/UV254 plates from Aldrich) and developedusing 0.75 M KH2PO4, pH 3.5 as the mobile phase.

15 The spotscorresponding to the substrate (S) and product (P) were quantifiedby a BioImage Analyzer (FLA2000, Fuji Film, Japan), and the %product formed was calculated as [P/(S P)] 100. One microlitre


(10 U) of calf intestinal alkaline phosphatase (NEB) was used asa positive control and a marker for the [32P] phosphate spot.

2.6. Generation of polyclonal antibody to MsmEFG2

A six-week-old rabbit was immunized (through the intradermalroute) with w1 mg of purified MsmEFG2 protein mixed withFreunds incomplete adjuvant. The first booster (w500 mg ofMsmEFG2 mixed with Freunds incomplete adjuvant) was givenafter three weeks, and the second and third boosters were givensubsequently at two-week intervals. The antiserum was collectedone week after the third booster.

2.7. Expression analysis of MsmEFG2 in M. smegmatis mc2155

M. smegmatis mc2155 cultures were grown in either LBT or 7H9media till saturation, and used for inoculation of fresh cultures inthe corresponding media using 1.5 and 2% inoculum, respectively.The fresh cultures were grown at 37 C and harvested at approx-imately 0.3 OD600 (early log phase), w0.6 OD600 (mid-log phase)or 1 OD600 (early stationary phase, w1314 h post-inoculation), aswell as w24 h after reaching 1 OD600 (w36 h post-inoculation).The culture pellets were resuspended in 25 mM TrisHCl, pH 8.0,2 mM b-mercaptoethanol and 1 mM Na2EDTA (TME buffer),sonicated 45 times (three pulses of 3 s each) using a microprobe(Heat Systems-Ultrasonics Inc., USA), and the lysates cleared bycentrifugation in a microfuge for 30 min at 4 C. The supernatantwas transferred into a fresh tube and quantified for proteincontents.16 Fifty micrograms of these cell-free extracts wereseparated on 12% SDS-PAGE and electroblotted (using Trans-Blotsemi-dry transfer cell, Bio-Rad) onto a PVDF membrane at 15 V for60 min. The blot was probed using a 1:7500 dilution of anti-MsmEFG2 rabbit antiserum, and detected using alkaline phos-phatase-conjugated goat anti-rabbit IgG with the substratesp-nitrotetrazolium blue chloride and 5-bromo-4-chloro-3-indolylphosphate. The antiserum used was specific to MsmEFG2; nocross-reactivity was observed with EFG from M. smegmatis orM. tuberculosis (data not shown).

2.8. Disruption of the fusA2 gene in M. smegmatis mc2155

The targeted gene knockout strategy using pPR27 containinga thermo-sensitive origin of replication of pAL5000 and sacBcounter-selection marker was used.17 The MsmEFG2::kan knockoutconstruct was generated by replacing the 450 bp BamHI-fragmentof pTrcMsmEFG2 (nucleotide positions 9871413 within the2.196 kb long ORF) with the 1.264 kb BamHI-fragment of pUC4 K(Amersham Biosciences) containing the kan cassette.pTrcMsmEFG2::kan was subsequently digested with the vectorspecific enzymes EcoRV and ScaI, and the 4.4 kb fragment con-taining the MsmEFG2::kan region was ligated to BamHI digestedand end-filled pPR27 to generate pPR27MsmEFG2::kan construct,which confers resistance to Gen and Kan. The pPR27MsmEFG2::kanconstruct was introduced into M. smegmatis mc2155 by electro-poration,18 and the transformants selected at 30 C on 7H10 solidmedium containing Gen and Kan. Several transformants weregrown at 30 C in LBT medium containing Kan and plated on 7H10solid medium containing Kan and 10% sucrose at 39 C. The colo-nies that appeared were checked for sensitivity to Gen (GenS) on7H10 media plates containing Gen and sucrose at 39 C. The GenS

colonies were resuspended in 75100 ml water, heated at 95 C for15 min, and centrifuged in a microfuge for 5 min. The supernatantwas extracted once with an equal volume of chloroform, and1012 ml used for screening by PCR, in 25 ml reactions containing 2%DMSO (v/v), 350 mM dNTPs, 20 pmol each of the forward primer



ARTICLE IN PRESS

MsmEFG2-IP2 (which anneals w785 bp downstream of the startcodon in the EFG2 ORF) and the reverse primer MsmEFG2 dn-rp(which anneals w45 bp downstream the stop codon of EFG2), and1 U of Dynazyme II (Finnzymes) in 1 buffer containing 1.5 mMMgCl2. Samples were heated at 94 C for 4 min, followed by 25cycles of incubations at 94 C for 1 min, 53 C for 1 min and 72 Cfor 2 min 20 s.

2.9. Genomic blot analysis

Genomic DNA (w2 mg) from the M. smegmatis mc2155 (wild-type for fusA2) as well as its fusA2::kan derivative were digestedwith excess of restriction enzyme (20 U of either BclI or PvuI),separated on 1% agarose gels using TBE, transferred19 onto nylonmembrane (Biodyne B, Pall Gelman Laboratory) and subjected tohybridization20,21 with a radiolabeled probe against a portion of thefusA2 gene of M. smegmatis. The pTrcMsmEFG2 andpPRMsmEFG2::kan DNA were also digested with PvuI (5 U) asmarkers for fusA2 (wild-type) and fusA2::kan (knockout) locirespectively. The radiolabeled probe was prepared by a two-stepPCR based method using [a-32P]dCTP. In the first step, 20 pmol ofthe primers MsmEFG2-IP3 and MsmEFG2-IP4 (the internal forwardand reverse primers that anneal w1220 bp downstream of the startcodon and w280 bp upstream of the stop codon, respectively, in theEFG2 ORF) were used in a 50 ml reaction containing 350 mM dNTPs,w100 ng of the template pTrcMsmEFG2 and 1 U of Dynazyme II(Finnzymes) in 1 Dynazyme buffer containing 1.5 mM MgCl2. Thereaction conditions include heating at 94 C for 4 min, followed by30 cycles of incubations at 94 C for 1 min, 58 C for 45 s, 72 C for50 s, and final extension at 72 C for 10 min. The PCR product(0.7 kb) so obtained was eluted from an agarose gel and w50 ngDNA was used as template for the second PCR (50 ml) containing350 mM of dNTP(-dCTP) mix and w10 mCi of [a-32P]dCTP, under thesame reaction conditions. Hybridization of the nucleic acids fixedonto the nylon membrane was done as described previously,20,21

except that it was carried out at 60 C. The membrane was subse-quently washed with decreasing concentrations of SSC (4, 2 andthen 1, 30 min each) containing 0.1% (w/v) SDS at 65 C, andanalyzed by BioImage Analyzer (FLA2000, Fuji Film, Japan).

2.10. Viability of M. smegmatis mc2155 fusA2::kan in latestationary phase cultures

Isolated colonies of the various M. smegmatis strains (one colonyeach) were grown to saturation (54 h) in LBT medium (in thepresence of antibiotics as required), diluted 1:100 in LBT (in theabsence of antibiotics) and grown at 37 C under shaking condi-tions. Aliquots were withdrawn at regular intervals for 6 days andviable counts determined by dilution plating.

2.11. Pellicle formation

48 h saturated cultures of M. smegmatis mc2155 and itsfusA2::kan derivative were diluted 1:100 in 3 ml of LB medium(without Tween-80), and allowed to stand at 37 C for 3 days.22

Formation of the pellicle at the surface of the medium was moni-tored visually.

2.12. In vitro hypoxia

The procedure described by Dick et al.23 was followed. Briefly,isolated colonies of the M. smegmatis strains were grown in DBTmedium (containing ADC) to saturation, and diluted 1:100 in freshDBT medium (containing ADC) and grown to mid-log phase (OD600w0.60.8) to yield the starter cultures. These starter cultures were


diluted 1:100 in 20 ml of fresh DBT medium (containing ADC, butno antibiotics) taken in screw-cap flat bottom culture tubes (headspace air volume: liquid medium ratio of 0.5).23 The tubes weresealed and the cultures were grown with slow stirring usinga multipoint magnetic board at 37 C for 10 days, during which theybecome progressively subjected to hypoxic conditions.23 Oxygendepletion was monitored using the indicator dye methylene blue(1.5 mg ml1) in control cultures, which under these conditionsdecolorized completely in about 45 days. The viable counts of thestarter cultures, as well as after 10 days of growth in hypoxicconditions, were determined by dilution plating, and plotted aslog10 c.f.u. ml

1. The histograms represent values of the mean - standard deviations (S.D.).

2.13. Growth competition assays

The competition assays were carried out in either LBT or 7H9media. For competition in LBT, the various M. smegmatis strains (asindicated in figure legends) were grown in LBT (in the absence ofantibiotics) to saturation. The two strains being competed werethen mixed in a 1:1 ratio. The mixed pre-culture was used forinoculation (using 1% inoculum) of 50 ml of LBT (without antibi-otics) and grown at 37 C under shaking conditions. A loopful of themixed pre-culture (0 h time point) was streaked on LBT agar.Similar procedure was followed at 24 h intervals for 7 days. The twostrains being competed differ in antibiotic resistance markers(KanR); hence to distinguish the two strains to determine their %abundance, the colonies that appeared on LBT agar were patchedon LBT agar with, and without Kan. The competition assays werealso done in 7H9 medium, for which the pre-culture was grown in7H9; the streaking and patching were also done on 7H10 solidmedium.

3. Results

3.1. Comparison of primary sequences of EFG and EFG2

An alignment of the primary sequences of EFG from E. coli andEFG and EFG2 from M. smegmatis, M. tuberculosis and T. thermo-philus is shown in Fig. 1. The comparison shows a high degree ofhomology amongst the EFG sequences (83% identity between Msm-and Mtu-EFGs; 60% identity between Eco- and Tth-EFGs; and 5760% identity between Msm- or Mtu-EFGs with EFG from E. coli orT. thermophilus). The degree of homology amongst EFG2 sequencesis less uniform (78% identity between Msm- and Mtu-EFG2s; 33%between Msm- and Tth-EFG2s; and 36% between Mtu- and Tth-EFG2s). And, the homology between EFG and EFG2 is relatively less(w30% identity between EFG and EFG2 from M. smegmatis orM. tuberculosis; and 36% identity between TthEFG and TthEFG2).However, several motifs and residues of functional importance inEFG are conserved in EFG2. In the G-domain (domain I), the GTP-binding motifs ([G,A]XXXXGK[T,S]; DXXG and [N/T]KXD; indicatedas motifs G1, G3 and G4, respectively)1,24 are conserved amongstEFG and EFG2 from various organisms. Amongst these, the N/TKXDmotif (motif G4) forms important interactions with the nucleotidebase,25 and is responsible for the specificity of guanine over otherbases.1,2 The conserved P-loop Walker A motif ([G,A]XXXXGK[T,S];motif G1) interacts with the a- and b-phosphates of GTP or GDP1

and properly positions the triphosphate moiety of the boundnucleotide,2 and the conserved Walker B motif (motif G3; the DXXGmotif which forms a part of the switch II region) interacts with theg-phosphate of GTP and binds a water bridged Mg2 ion.1,2 On theother hand, the RGITI (motif G2; that forms a part of the switch Iregion in the translational GTPases),1 and GSA(L/K) (motif G5;a functionally important consensus motif which is C-terminal to G0


Fig. 1. Multiple sequence alignment of EFG from E. coli (abbreviated as EcoEFG), Thermus thermophilus (TthEFG), M. smegmatis (MsmEFG), M. tuberculosis (MtuEFG) and EFG2 fromThermus thermophilus (TthEFG2), M. smegmatis (MsmEFG2), M. tuberculosis (MtuEFG2). The conserved GTPase motifs are boxed and numbered: G1 ([G,A]XXXXGK[T,S]); G2 (RGITI);G3 (DXXG); G4 ([N/T]KXD); and G5 (GSA[L/K]). The G0 sub-domain is boxed (using broken lines) and labeled. Other conserved motifs which are boxed and labeled include thedomain II consensus sequence (denoted as A) and the domain III conserved region (denoted as B). Other conserved residues of functional importance (refer text) are boxed andindicated with asterisks *, filled circle , filled diamond A or filled triangle ;. The sequence alignment was done using ClustalW, and Boxshade was used to obtain the shadedschematic representation (www.ch.embnet.org). The various domains of EFG are indicated (IV), with ( ) and ( ) indicating the beginning and end of the respective domains, asspecified. [Note: Earlier annotations in the NCBI database showed sequences corresponding to MSMEG_1400 and MSMEG_6535 as EFG and EFG2, respectively. In a more recentlisting, the MSMEG_1400 has been annotated as a pseudogene whereas MSMEG_6535 has been annotated as the main EFG. However, experimentally we have observed that theMSMEG_1400 encodes for a functional EFG (e.g. refer to Fig. 2). Therefore, we have retained the earlier annotations for these genes.]


ARTICLE IN PRESS

sub-domain)2,26 motifs are not well conserved in EFG2 proteins.The RGITI motif is found in most EFG sequences,26 and its criticalthreonine moiety is conserved in most GTPases.1 The residues I andT of the RGITI motif have been shown to be important for the

Fig. 2. Complementation analysis of E. coli PEM100 (fusAts). Overnight cultures of E. coli PEM1plates containing Amp and IPTG (0.5 mM), and incubated for 24 h at the indicated tempera


GTPase activity in EF-Tu by forming interactions that may stabilizetransition states during GTP hydrolysis.27 In TthEFG2 (which showsa GTPase activity),10 only the critical threonine moiety of the RGITImotif and the serine of the GSA motif are conserved. On the other

00 harboring various plasmids as indicated were grown at 30 C, streaked on LSLB agartures.


http://www.ch.embnet.org

GTP (M)

-Protein (1.25 M)

0012512.51.25012512.51.25012512.51.250

MsmEFG2 EcoEFG MsmEFG EcoRRF

1413121110987654321Lanes:

-Protein (1.25 M) MsmEFG2 EcoEFG MsmEFG EcoRRFGDP (M) 0012512.51.25012512.51.25012512.51.250

1413121110987654321Lanes:

ATP (M)

-Protein (1.25 M)

0012512.51.25012512.51.25012512.51.250

MsmEFG2 EcoEFG MsmEFG EcoRRF

1413121110987654321Lanes:

-Protein (1.25 M) MsmEFG2 MsmEFG EcoEFG EcoRRFGTP (M)

pppGpp (M) 0012512.51.25012512.51.25012512.51.2501.251.251.25

1413121110987654321Lanes:

A

B

C

D

Fig. 3. UV crosslinking of MsmEFG2 to various nucleotides. Reactions (10 ml) contain w1.25 mM of MsmEFG2, MsmEFG, EcoEFG or w5 mM of EcoRRF; 0.1 mCi of [a-32P]GTP; and 0, 1.25,12.5 or 125 mM of non-radioactive GTP (A), GDP (B), ATP (C) or pppGpp (D). In (D), non-radioactive GTP (1.25 mM) was also included. The reactions were separated on 12% SDS-PAGE,and visualized by BioImage Analyser (FLA2000, Fuji Film, Japan).


ARTICLE IN PRESS

hand, the conserved threonine of the RGITI motif is replaced bya serine residue in EFG2 from M. smegmatis and M. tuberculosis,while the other residues of this motif are not conserved. The GSAmotif is altogether absent in Msm- and Mtu-EFG2s.

The G0 sub-domain (which is unique to EFG among the knownGTPases but whose sequence is not very well conserved amongstvarious EFGs) is also present in EFG2 (Fig. 1). Moreover, some of thefunctionally important residues in the G0 sub-domain of EcoEFG(corresponding to TthEFG residues E218, D222, E225), which havebeen shown to interact with the L7/L12 stalk of the 50S subunit,28,29

are mostly conserved between EFG and the EFG2 sequences andshown by asterisks * in Fig. 1.

Domain II of EFG encompasses the residues 288400 (TthEFGnumbering),30 and includes the consensus motif (GX[L,I,V,F][Y,F,-]XXXR[L,V,I][F,W,Y]SGX[LIV])26 spanning the residues 323335,which is conserved amongst Mtu- and Msm-EFG2 (Fig. 1). Theresidue R329 (indicated by a filled circle ) of domain II, which isconserved among EFG and EFG2 from several organisms, has beenobserved to form a salt bridge with another conserved residueD102 in the G-domains of EFG and EF-Tu.24 The residue D102 isalso conserved in EFG2 from various organisms (indicated bya filled diamond A). However, compared to the sequences of


TthEFG2 or EFG from various organisms, the domain II of MtuEFG2and MsmEFG2 contains an insert of w16 and 27 residues,respectively (amino acids 350365 in MtuEFG2, amino acids 355381 in MsmEFG2, Fig. 1) immediately after the domain II consensusmotif.

Domain III of EFG (residues 405482, TthEFG numbering)30

includes a stretch that contains several strictly conserved residues(GXGELH; residues 453458), which are in close contact with theswitch II region of G-domain.30,31 These residues are conserved inTthEFG2 but not in Msm- or Mtu-EFG2 (Fig. 1). The residue H573 ofdomain IV (TthEFG numbering), which is strictly conserved in EFGand has been shown to be important for tRNA translocation,32 isalso conserved in EFG2 from various organisms (indicated by a fil-led arrowhead ;). However, while the motif YHEVDS at the tip ofdomain IV (which includes H573) is well conserved in EFG33 andalso in TthEFG2 (Fig. 1), it is represented by the sequence, AHSVDSin Msm- and Mtu-EFG2 proteins.

3.2. Is MsmEFG2 a functional backup for EFG?

The observation that many of the conserved and functionallyimportant residues of EFG are also preserved in the mycobacterial


+ puromycin

MsmEFG MsmEFG2 MsmEFG MsmEFG21110U2.510.50.110.12.510.50.110.1

Msm

EFGMsm

EFG2CIP

Msm polysomes (0.1 M)

:++++------+- ++ ++-

Protein(M/Units, U)

-

Pi:

GTP

987654321

% Product:Lanes: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

1847922219181845825445148175

Fig. 4. GTPase assay of MsmEFG2 on Msm polysomes isolated from log phase culture of M. smegmatis mc2155. The indicated amounts of MsmEFG or MsmEFG2 were incubated with250 mM GTP containing trace amounts (0.2 mCi/reaction) of [g-32P]GTP in the absence () or presence () of Msm polysomes (0.1 mM) for 30 min, separated by thin layer chro-matography, and visualized by BioImage Analyzer (FLA2000, Fuji Film, Japan). The % product formed is indicated. Puromycin (10 mM) was added where indicated.


ARTICLE IN PRESS

EFG2 suggested that MsmEFG2 could function as an EFG. We haveearlier used E. coli PEM100, which harbors a temperature-sensitiveallele of EFG (fusAts) and E. coli LJ14, which harbors a temperature-sensitive allele of RRF (frrts) for in vivo analysis of mycobacterialEFG.6 Thus, to check if MsmEFG2 complements E. coli PEM100, weintroduced pTrc99C based expression constructs of EcoEFG,MsmEFG, MsmEFG2 or the vector alone (pTrc99C) into the strainand subjected the transformants to growth on plates (Fig. 2) ateither the permissive (30 C, left panel) or non-permissive (42 C,right panel) temperatures. As expected, all transformants grew atthe permissive temperature (left panel). As controls, while thetransformants harboring the EcoEFG construct (sectors 3 and 4,right panel) grew, the ones harboring vector alone (sectors 1 and 2,right panel) failed to grow at the non-permissive temperature.Under these conditions, while MsmEFG supported the growth of E.coli PEM100 at the non-permissive temperature (sectors 5 and 6,right panel), MsmEFG2 did not (sectors 7 and 8, right panel).Subsequently, to check for MsmEFG2 function at a specific step ofribosome recycling, we made use of E. coli LJ14 which is known tobe rescued for its growth at the non-permissive temperature byexpression of a functional RRF-EFG combination, such as MtuRRFand MtuEFG.6 However, the simultaneous expression of MsmEFG2and MsmRRF did not rescue the growth of E. coli LJ14 either (datanot shown). We then examined if purified MsmEFG2 could (inconcert with MsmRRF) recycle the M. smegmatis post-terminationcomplexes in an in vitro ribosome recycling assay. In this assay also,unlike the MsmEFG, MsmEFG2 failed to reveal any detectableribosome recycling in conjunction with MsmRRF (Fig. S2).

Fig. 5. Expression analysis of MsmEFG2 in M. smegmatis mc2155. Cultures of M. smegmatis mOD600 as follows. Lane 2, 0.3; lane 3, 0.55; lane 4, 1.0; lane 5, to saturation (w36 h); lane 6,prepared, and total proteins (50 mg) were separated by SDS-PAGE and analyzed by immunobband corresponding to MsmEFG2. Marker (lane 1) corresponds to MsmEFG2 (w75 ng).


3.3. Binding of MsmEFG2 to guanine nucleotides

EFG is a ribosome-dependent GTPase. Sequence alignmentreveals that, like EFG, Msm- and Mtu-EFG2 proteins possess theconserved motifs in the G-domain (motifs G1, G3 and G4; Fig. 1)that impart specificity to guanine nucleotides over other nucleo-tides.1 Hence, the ability of MsmEFG2 to bind guanine nucleotideswas examined by using a qualitative analysis of GTP crosslinking. Asshown in Fig. 3, MsmEFG2, as well as the EcoEFG and MsmEFG, bindto [a-32P]GTP, which can be competed out by increasing amounts ofGTP (panel A), GDP (panel B) and pppGpp (panel D), but not ATP(panel C). When equal amounts of EcoRRF (which lacks the GTP-binding motifs) were taken, no binding of [a-32P]GTP was detected(Fig. 3, panels AD, lanes 13) suggesting that the binding of[a-32P]GTP to MsmEFG2, MsmEFG, and EcoEFG is a specific propertyof these proteins. Moreover, similar to the Msm- and Eco-EFGproteins, efficient dilution of the [a-32P]GTP binding to MsmEFG2occurred only at 10-fold molar excess (with respect to the protein)of non-radioactive GTP, GDP or pppGpp (panels A, B and D) whichruled out a possibility that minor contamination of EcoEFG in theMsmEFG2 could be responsible for the [a-32P]GTP binding to it.

3.4. MsmEFG2 does not show a ribosome-dependentGTPase activity

As shown in Fig. 3, MsmEFG2 binds guanine nucleotides. As thenext step, its GTPase activity was assessed (Fig. 4). Like MsmEFG(lanes 3 and 4), MsmEFG2 also lacked an intrinsic GTPase activity

c2155 were grown in LBT (lanes 25) or 7H9 (lanes 69) media. Cultures were grown to0.3; lane 7, 0.65; lane 8, 1.0; and lane 9, to saturation (w36 h). Cell-free extracts werelotting using anti-MsmEFG2 rabbit antiserum. Asterisks in lanes 2, 5 and 9 indicate the


A B

MsmEFG2-IP2

KnockoutsWT4321M1.4 kb

Wild-type MsmfusA2

BamHI(987)

BamHI(1413)

MsmEFG2dn-rp

BamHI(2251)

2.2 kb1.4 kb

fusA2::kan Kan (1.264kb)

bk2.2 654321Lanes:

MsmEFG2-IP2 MsmEFG2dn-rp

Probe

BclI(437)

BclI(2045)

PvuI(1340) PvuI (2087) Probe

BclI(437)

BclI(2883)

PvuI(1684)

PvuI (2925)

MsmfusA2

(ii) fusA2::kan

BamHI(987)

BamHI(1413)

BamHI(987)

BamHI(2251)

(i) Wild-type

BclI PvuI

4321KnockoutsWT

1.3 kb

WT 4321Knockouts

2.45 kb

1.6 kb0.747 kb

654321Lanes: 7654321Lanes:

Kan (1.264kb)

C

D E

Fig. 6. Analysis of fusA2 gene disruption in M. smegmatis mc2155. (A) Schematic representation of the fusA2 (wild-type) and fusA2::kan loci. KanR marker was inserted between thetwo BamH1 sites that results in replacement of 0.426 kb region of fusA2 open reading frame with 1.264 kb KanR cassette. The expected sizes of the PCR amplicons using the flankingprimers from the wild-type and knockout loci are indicated. (B) Agarose gel electrophoresis of the colony PCR products obtained from the M. smegmatis mc2155 (wild-type for fusA2,lane 6) and four putative MsmfusA2::kan isolates (lanes 25). Sizes of the PCR amplicons (w1.4 kb and 2.2 kb for fusA2 and fusA2::kan loci) are indicated. HindII/HindIII digest of lDNA was used as a molecular size marker (M, lane 1). (C) A schematic representation of the fusA2 (panel i) and fusA2::kan loci (panel ii) along with the various restrictionendonuclease sites and the location of the fusA2-specific radiolabeled probe are shown. (D and E) The genomic blots of the fragments obtained with BclI (D) or PvuI (E) digestionsare shown. The wild-type controls (WT) as well as the MsmfusA2::kan isolates (knockouts 14) are indicated. Lanes 1 and 2 in (E) refer to PvuI digests of control plasmidspTrcMsmEFG2 and pPRMsmEFG2::kan, respectively. The sizes of the hybridizing bands are as indicated.


ARTICLE IN PRESS

(lanes 58). And, while the GTPase activity of MsmEFG was stim-ulated (compare lane 2 with lanes 9 and 10) in the presence of theMsm polysomes, MsmEFG2 did not show such an activity (comparelane 2 with lanes 1114). In another method, we carried out theassays with puromycin treated polysome preparation (lanes 16 and17) or the polysomes prepared from late stationary phase cultures(where ribosomes may be modified by the action of variousfactors)3436 of M. smegmatis mc2155 (Fig. S3). However, even underthese conditions, MsmEFG2 did not show any GTPase activity(Fig. 4, lane 17; and Fig. S3). The GTPase activity of MsmEFG wasunaltered by puromycin treatment of the polysomes (Fig. 4, lane 16)or between the polysomes prepared from the different growthphases of the culture (Fig. S3). Thus, despite retaining the ability tobind guanine nucleotides, MsmEFG2 lacks a ribosome-dependentGTPase activity. These observations are in contrast to the properties


of TthEFG2 which shows both an intrinsic as well as a ribosome-dependent GTPase activity.10

3.5. Expression analysis of MsmEFG2 in M. smegmatis mc2155

While the fusA2 gene is known to be expressed in M. tubercu-losis,11 it is a pseudogene in M. leprae. Hence, it was of interest toexamine if MsmEFG2 is at all expressed in M. smegmatis. To inves-tigate this, M. smegmatis mc2155 cultures were grown in either LBTor 7H9 media and harvested at different stages of growth: early log(0.3 OD600), mid-log (w0.6 OD600), 1 OD600 (early stationary phase,w1314 h post-inoculation) and late stationary phase (36 h post-inoculation). Cell-free extracts prepared from these cells wereanalyzed for the expression of MsmEFG2 using antibodies gener-ated against MsmEFG2. As can be seen from Fig. 5, MsmEFG2 is


7H9

1.00

1.25

1.50

1-3

1.00

1.25

1.501

2

WT

fusA2::kan (2)

fusA2::kan (4)

OD

600

0 4 8 12 16 20 24 28 32 36 40 44 480.00

0.25

0.50

0.751

2

30.00

0.25

0.50

0.75

WT

fusA2::kan (4)

OD

600

1

2

Time (h)

0 4 8 12 16 20 24 28 32 36 40 44 48Time (h)

1

2

34

1

2

34

lo

g10 (C

.f.u

.m

l-1)

WT

L5att::pDK20

fusA2::kan (2)

fusA2::kan (4)

0 1 2 3 4 5 6

1.01009

1.01010

1.01008

1.01007

Time (Days)WT fusA2::kan

LBT

A B

C D

Fig. 7. Growth of M. smegmatis mc2155 and its fusA2::kan derivatives at 37 C. Saturated cultures grown in either LBT (A) or 7H9 (B) media were diluted 1000-fold in the respectivemedia, and growth was monitored at 3 h intervals in a Bioscreen C kinetic growth reader. All strains were taken in replicates of five; values of the mean SEM are plotted. Twoindependent isolates of mc2155 fusA2::kan (knockout isolate 2 and 4; curves 2 and 3) were analyzed in (A) whereas a single knockout strain (isolate 4) was analyzed for growth in7H9 medium (B) along with the M. smegmatis mc2155 (WT) control. (C) Saturated cultures of the various strains grown in LBT medium at 37 C were used for inoculation (using 1%inoculum) of fresh cultures in LBT medium. Aliquots were withdrawn at regular intervals and viable counts were determined by dilution plating. Two independent knockout isolates(2 and 4) were used along with the M. smegmatis mc2155 (WT) and M. smegmatis mc2155 (L5att::pDK20) controls. (D) Pellicle formation in M. smegmatis mc2155 and its fusA2::kanderivative. Saturated cultures of the strains were diluted 1:100 in LB medium (without Tween-80), and allowed to stand for 3 days at 37 C.

1.01009

1.01008

WT

fusA2::kan

lo

g10 (C

.f.u

.m

l-1)

Initial Final1000000

1.01007

Fig. 8. Survival of M. smegmatis mc2155 (WT) and its fusA2::kan derivative duringgrowth in hypoxia. Saturated cultures of M. smegmatis mc2155 and its fusA2::kanderivative grown in DBT medium (containing ADC) were used for inoculation of freshcultures, which were grown till OD600 of w0.60.8. These starter cultures were thendiluted 1:100 in fresh DBT medium (containing ADC) taken in a sealed tube with headspace air volume:liquid medium ratio of 0.5, and allowed to grow for 10 days. Theviable counts of the starter cultures (initial) and after 10 days of growth under gradualhypoxia (final) were determined by dilution plating, and plotted as log10 values. Thestrains were taken in triplicates; the bars represent values of the mean S.D.


ARTICLE IN PRESS

expressed prominently in the late stationary phase in LBT medium(lane 5), and to a much lesser extent in 7H9 medium (lane 9).Detectable presence of MsmEFG2 in the early log phase (0.3 OD600)in LBT (lane 2) but not in 7H9 medium (lane 6) could be due to carryover of the EFG2 in the cells of the saturated culture used asinoculum. Thus, while the expression of EFG2 varies with thegrowth medium used, it can be seen that its expression is up-regulated during the late stationary phase (lanes 5 and 9). Such anexpression pattern of MsmEFG2 is similar to the expression patternof MtuEFG2 predicted from a microarray-based study.12

3.6. Generation of M. smegmatis mc2155 fusA2::kan strain

To analyze the in vivo significance of EFG2, fusA2 in M. smegmatiswas disrupted by insertion of a 1.264 kb kan cassette. To select forfusA2::kan strain, the standard procedure17 was slightly modifiedby introducing an additional step of screening the putativerecombinants for GenS. It was observed that most of the spuriousrecombinants (probably arising due to single cross-over events asopposed to the required double cross-over events) were GenR (dueto retention of pPR27), and hence, inclusion of this step greatlyfacilitated the elimination of false positives. The GenS colonies werefurther analyzed for the fusA2::kan locus by PCR using an internalforward primer (MsmEFG2-IP2) and a downstream reverse primer(MsmEFG2 dn-rp; homologous to a region of the genome which isabsent in the pPR27 knockout construct). As expected, the parent(M. smegmatis mc2155) and the knockout isolates showed ampli-cons of sizes 1.4 kb for fusA2 wild-type locus and 2.2 kb for thefusA2::kan knockout locus, respectively (Fig. 6, panels A and B).Furthermore, the genomic blot analyses (Fig. 6, panels CE) alsoshowed the bands of expected sizes in the BclI digests (1.6 kb for


fusA2 and 2.45 kb for fusA2::kan loci; Fig. 6 panels C and D) as wellas PvuI digests (0.747 kb for fusA2 and w1.3 kb for fusA2::kan loci;Fig. 6, panels C and E) of genomic DNA from M. smegmatis mc2155strain and its fusA2::kan derivative. The observation that fusA2 canbe disrupted in M. smegmatis reveals that EFG2 is not essential in M.smegmatis, at least under the laboratory conditions.


100 1007H9 LBT LBT

60

80 1

WT160

80 1

WT1 60

80

100

1

0

20

40 40 40

150100500

Relative %

o

f each

strain

2

2 fusA2::kan

0150100500

Relative %

o

f each

strain

2

2 fusA2::kan

0

20

100500 150

Relative %

o

f each

strain

2

WTL5att::pDK20

12

Time (h) Time (h) Time (h)

20

A B C

Fig. 9. Growth competition assays. M. smegmatis mc2155 (WT) was competed against either M. smegmatis mc2155 fusA2::kan (panels A and B) or M. smegmatis mc2155 L5att::pDK20(panel C) in LBT (panels A and C) or 7H9 (panel B) media. Equal volumes of respective saturated cultures were mixed, and 1% of the mixture used as inoculum to grow cultures fora period of 7 days. The proportion of WT and the derived strains was determined in the aliquots drawn every 24 h as described in the Materials and methods over the 7 days. Thecompetition assay was repeated 3 times with very similar results; a representative assay is shown.


ARTICLE IN PRESS

3.7. Growth kinetics of M. smegmatis mc2155 fusA2::kan, viabilityin late stationary phase cultures and pellicle formation

The growth of M. smegmatis mc2155 and its fusA2::kan deriva-tive was monitored both by measurement of OD600 (Fig. 7, panels Aand B), as well as by total viable count determination method(Fig. 7C). It was observed that disruption of fusA2 locus does notimpact the growth kinetics of M. smegmatis mc2155 in either LBT(Fig. 7A) or 7H9 (Fig. 7B) media. To further confirm the same, onecolony each of M. smegmatis mc2155; the vector control,L5att::pDK20 (M. smegmatis mc2155 harboring pDK20 plasmidintegrated at the L5att site) and two independent isolates offusA2::kan were grown in LBT media and the viable counts weredetermined over a period of 6 days (Fig. 7C). Both the parent strain(WT) and the fusA2::kan derivatives produced similar viable counts.Thus, despite the fact that MsmEFG2 is up-regulated duringstationary phase (Fig. 5), the disruption of EFG2 gene does not affectthe survival of M. smegmatis, for at least up to 6 days into thestationary phase.

Another property of mycobacteria is their ability to form a surfacepellicle in standing liquid media when grown in the absence ofdetergent, because of their high lipid content. Such pellicles haverecently been recognized as a biofilm that assembles at the airliquid interface and has been shown to be important for alteredphysiological properties of the bacterium.37 Thus, we tested whetherdisruption of EFG2 gene affects pellicle formation in M. smegmatis.Our experiments showed that disruption of the fusA2 gene does notaffect the pellicle forming ability of the bacterium (Fig. 7D).

3.8. Survival of M. smegmatis mc2155 fusA2::kan strain underhypoxic conditions

Adaptation to low oxygen conditions may play an importantrole in the persistence of M. tuberculosis in the host. To investigatethe physiological response of M. tuberculosis to hypoxic condi-tions, the Waynes model of growth was developed38 and has alsobeen used to analyze the response of M. smegmatis to hypoxicstress.23 The viable counts of the starter cultures (used for seedingthe culture in the sealed tube) and the cultures subjected to 10days of hypoxia were plotted as initial and final counts, respec-tively (Fig. 8). As can be seen, the initial viable counts of both theM. smegmatis mc2155 cultures as well as its fusA2::kan derivativeare roughly equivalent (w1.1108 c.f.u ml1 for M. smegmatismc2155 and w1.6108 c.f.u ml1 for its fusA2::kan derivative).Since the starter cultures were diluted 1:100, the initial viablecounts (of the cultures that were subjected to hypoxic conditions)


were in the range of 106 c.f.u ml1, which increased (after growthfor 10 days under hypoxic conditions) by about 10-fold tow107 c.f.u ml1 in both M. smegmatis mc2155 and its fusA2::kanderivative. Although, the disruption of fusA2 gene (fusA2::kan)seems to compromise the survival of the knockout strain, thedifference is somewhat unremarkable.

3.9. Growth competition assays

To address whether disruption of the EFG2 gene affects therelative fitness of M. smegmatis, a growth competition assay wascarried out between M. smegmatis mc2155 and its fusA2::kanderivative39,40 in the absence of any antibiotics. As the fusA2::kanstrain (but not the M. smegmatis mc2155) is KanR, the isolatedcolonies appearing on the LBT agar plate in the absence of antibi-otics (as obtained by streaking of the mixed culture at various timepoints) could be distinguished for their genotypes by subsequentgrowth analysis on Kan plates. It can be seen that in both the LBT(Fig. 9A) and the 7H9 (Fig. 9B) media, the M. smegmatis mc2155strain (wild-type fusA2 locus) out-competes the M. smegmatisfusA2::kan strain, though the kinetics of the competition varyslightly between the two media. However, since the two strainsalso differ with respect to KanR marker, a control competition wascarried out between M. smegmatis mc2155 and M. smegmatismc2155 L5att::pDK20 (which is also KanR). In this control compe-tition, both strains were sustained equally well (Fig. 9C), implyingthat the fitness disadvantage of the fusA2::kan strain is indeeda consequence of EFG2 gene disruption and not due to the burdenof KanR marker in the genome.

4. Discussion

Several organisms such as T. thermophilus, P. aeruginosa,T. tengcongensis, as well as species of mycobacteria includingM. tuberculosis, M. avium paratuberculosis and M. smegmatis,contain a second EFG-like locus denoted as fusA2. A multiplesequence alignment of EFG2 with EFG from the representativeorganisms reveals that several residues and motifs of functionalimportance found in EFG are also conserved in EFG2 (Fig. 1). Theconservation of the Walker A and Walker B motifs, as well as the [N/T]KXD motif, that confer specificity to guanine over other nucleo-tides, in MsmEFG2 is consistent with the observation that MsmEFG2binds GTP, GDP and pppGpp, but not ATP (Fig. 3). However, despiteretaining the ability to bind guanine nucleotides, MsmEFG2 wasfound to lack a ribosome-dependent GTPase activity. These prop-erties are consistent with the observation that MsmEFG2 could not



ARTICLE IN PRESS

sustain translocation or ribosome recycling activities (Figs. 2 andS2). In contrast, EFG2 from T. thermophilus retains an EFG-likefunction and possesses GTPase and translocation activities.10 Tofurther investigate EFG2 as a possible backup for EFG in vivo, weintroduced in M. smegmatis a construct wherein a part of fusA openreading frame was cloned downstream of a heat induciblepromoter (hsp60) to produce an antisense RNA to EFG mRNA(supporting online material). We observed that while the M. smeg-matis strain harboring vector alone grew at 39 C, the strainharboring the antisense construct failed to grow; although at 37 C,it showed growth albeit less than the vector alone control (Fig. S4).This observation suggests that EFG is essential in M. smegmatis andthat its functions cannot be substituted for by EFG2. A comparisonof the primary sequences of TthEFG2 and MsmEFG2 reveals thatMsmEFG2 contains an insert of w27 residues in domain II (Fig. 1),which is not found in TthEFG2 or in EFG from various organisms.The presence of the insert in domain II may be one of the factorsresponsible for the lack of GTPase activity of MsmEFG2.

Interestingly, despite the fact that MsmEFG2 is inactive in GTPhydrolysis, it is expressed in M. smegmatis mc2155 in a growth-phase dependent manner; the expression of MsmEFG2 was foundto be up-regulated in late stationary phase. Such an expressionpattern of MsmEFG2 is consistent with that of MtuEFG2, which wasalso found to be up-regulated during nutrient starvation.12 Theseobservations suggest a biological function of MsmEFG2. Althoughwe could not detect an EFG-like function of MsmEFG2 using in vitroand in vivo assays, we should say that our analyses do not rule outEFG2 activity on a specific conformation of the ribosome absent inour preparations. Furthermore, at this point it cannot be ruled outthat a mycobacterium-specific cellular factor or a post-translationalmodification of MsmEFG2 may play a role in the physiologicalfunction of MsmEFG2. On account of its homology with the primarysequence and domain structure of EFG, a possible way MsmEFG2could impact the physiology of the bacteria would be to interferewith the function of MsmEFG. In addition, it is tempting to specu-late that the expression or biological function of MsmEFG2 may alsobe governed by (p)ppGpp which mediates the stringent responseand is induced during nutrient starvation conditions, a hallmark ofthe stationary phase. Earlier studies have shown that the activity oftranslation GTPases (EF-Tu, EFG and IF2) is inhibited by(p)ppGpp.41,42 Given that MsmEFG2 binds pppGpp (Fig. 3D), it ispossible that (p)ppGpp may modulate the activity of MsmEFG2 invivo.

To further investigate the biological role of MsmEFG2, the EFG2gene was disrupted in M. smegmatis mc2155. We did not observea significant impact of the disruption of EFG2 gene on the growthkinetics of M. smegmatis mc2155 in log phase or the stationaryphase. On the other hand, analysis of growth and survival underhypoxic conditions revealed that the fusA2::kan was marginallycompromised when compared with the parent strain (wild-type forfusA2). Interestingly, the disruption of fusA2 gene was found toconfer a fitness disadvantage to the strain. The fitness advantageconferred by the presence of EFG2 is likely to be important in thenatural environment where each bacterium amidst other bacteriais forced to constantly compete for nutrients and oxygen. Takentogether, these observations suggest that MsmEFG2 plays a role inthe biology of M. smegmatis, though its exact function remains to beelucidated.

Acknowledgements

We thank our laboratory colleagues for suggestions and criticalreading of the manuscript. This work was supported by grants fromthe Department of Biotechnology (DBT) and the Department ofScience and Technology (DST), New Delhi. AS and RG were


supported by senior research fellowships of the University GrantsCommission, and the Council of Scientific and Industrial Research,New Delhi, respectively.

Appendix. Supplementary material

Supplementary data associated with this article can be found inthe online version, at doi:10.1016/j.tube.2009.06.003.

References

1. Bourne HR, Sanders DA, McCormick F. The GTPase superfamily: conservedstructure and molecular mechanism. Nature 1991;349:11727.

2. Leipe DD, Wolf YI, Koonin EV, Aravind L. Classification and evolution of P-loopGTPases and related ATPases. J Mol Biol 2002;317:4172.

3. Rodnina MV, Savelsbergh A, Katunin VI, Wintermeyer W. Hydrolysis of GTP byelongation factor G drives tRNA movement on the ribosome. Nature1997;385:3741.

4. Katunin VI, Savelsbergh A, Rodnina MV, Wintermeyer W. Coupling of GTPhydrolysis by elongation factor G to translocation and factor recycling on theribosome. Biochemistry 2002;41:1280612.

5. Savelsbergh A, Katunin VI, Mohr D, Peske F, Rodnina MV, Wintermeyer W. Anelongation factor G-induced ribosome rearrangement precedes tRNAmRNAtranslocation. Mol Cell 2003;11:151723.

6. Rao AR, Varshney U. Specific interaction between the ribosome recycling factorand the elongation factor G from Mycobacterium tuberculosis mediates pep-tidyl-tRNA release and ribosome recycling in Escherichia coli. EMBO J2001;20:297786.

7. Ito K, Fujiwara T, Toyoda T, Nakamura Y. Elongation factor G participates inribosome disassembly by interacting with ribosome recycling factor at theirtRNA-mimicry domains. Mol Cell 2002;9:126372.

8. Guo P, Zhang L, Zhang H, Feng Y, Jing G. Domain II plays a crucial role in thefunction of ribosome recycling factor. Biochem J 2006;393:76777.

9. Hou Y, Lin YP, Sharer JD, March PE. In vivo selection of conditional-lethalmutations in the gene encoding elongation factor G of Escherichia coli. J Bac-teriol 1994;176:1239.

10. Connell SR, Takemoto C, Wilson DN, Wang H, Murayama K, Terada T, et al.Structural basis for interaction of the ribosome with the switch regions of GTP-bound elongation factors. Mol Cell 2007;25:75164.

11. Rosenkrands I, King A, Weldingh K, Moniatte M, Moertz E, Andersen P. Towardsthe proteome of Mycobacterium tuberculosis. Electrophoresis 2000;21:374056.

12. Betts JC, Lukey PT, Robb LC, McAdam RA, Duncan K. Evaluation of a nutrientstarvation model of Mycobacterium tuberculosis persistence by gene and proteinexpression profiling. Mol Microbiol 2002;43:71731.

13. Nyka W. Studies on the effect of starvation on mycobacteria. Infect Immun1974;9:84350.

14. Singh NS, Das G, Seshadri A, Sangeetha R, Varshney U. Evidence for a role ofinitiation factor 3 in recycling of ribosomal complexes stalled on mRNAs inEscherichia col. Nucleic Acids Res 2005;33:5591601.

15. Terasaki M, Suzuki T, Hanada T, Watanabe K. Functional compatibility ofelongation factors between mammalian mitochondrial and bacterial ribo-somes: characterization of GTPase activity and translation elongation byhybrid ribosomes bearing heterologous L7/12 proteins. J Mol Biol 2004;336:33142.

16. Bradford MM. A rapid and sensitive method for the quantitation of microgramquantities of protein utilizing the principle of proteindye binding. Anal Bio-chem 1976;72:24854.

17. Pelicic V, Jackson M, Reyrat JM, Jacobs Jr WR, Gicquel B, Guilhot C. Efficientallelic exchange and transposon mutagenesis in Mycobacterium tuberculosis.Proc Natl Acad Sci U S A 1997;94:1095560.

18. Hatfull GF, Jacobs Jr WB. Molecular genetics of mycobacteria. Washington D.C:American Society for Microbiology; 2002. 313320.

19. Reed KC, Mann DA. Rapid transfer of DNA from agarose gels to nylonmembranes. Nucleic Acids Res 1985;13:720721.

20. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nded. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989. p. 9.319.57.

21. Vasanthakrishna M, Kumar NV, Varshney U. Characterization of the initiatortRNA gene locus and identification of a strong promoter from Mycobacteriumtuberculosis. Microbiology 1997;143(Pt 11):35918.

22. Chen JM, German GJ, Alexander DC, Ren H, Tan T, Liu J. Roles of Lsr2 in colonymorphology and biofilm formation of Mycobacterium smegmatis. J Bacteriol2006;188:63341.

23. Dick T, Lee BH, Murugasu-Oei B. Oxygen depletion induced dormancy inMycobacterium smegmatis. FEMS Microbiol Lett 1998;163:15964.

24. Avarsson A. Structure-based sequence alignment of elongation factors Tu and Gwith related GTPases involved in translation. J Mol Evol 1995;41:1096104.

25. Vetter IR, Wittinghofer A. The guanine nucleotide-binding switch in threedimensions. Science 2001;294:1299304.

26. Cammarano P, Creti R, Sanangelantoni AM, Palm P. The archaea monophylyissue: a phylogeny of translational elongation factor G(2) sequences inferred


http://doi:10.1016/j.tube.2009.06.003


ARTICLE IN PRESS

from an optimized selection of alignment positions. J Mol Evol 1999;49:52437.

27. Krab IM, Parmeggiani A. Mutagenesis of three residues, isoleucine-60, threo-nine-61, and aspartic acid-80, implicated in the GTPase activity of Escherichiacoli elongation factor Tu. Biochemistry 1999;38:1303541.

28. Nechifor R, Murataliev M, Wilson KS. Functional interactions between the G0

subdomain of bacterial translation factor EF-G and ribosomal protein L7/L12.J Biol Chem 2007;282:369987005.

29. Nechifor R, Wilson KS. Crosslinking of translation factor EF-G to proteins ofthe bacterial ribosome before and after translocation. J Mol Biol 2007;368:141225.

30. Avarsson A, Brazhnikov E, Garber M, Zheltonosova J, Chirgadze Y,al-Karadaghi S, et al. Three-dimensional structure of the ribosomal translocase:elongation factor G from Thermus thermophilus. EMBO J 1994;13:366977.

31. Czworkowski J, Wang J, Steitz TA, Moore PB. The crystal structure of elongationfactor G complexed with GDP, at 2.7 resolution. EMBO J 1994;13:36618.

32. Savelsbergh A, Matassova NB, Rodnina MV, Wintermeyer W. Role of domains 4and 5 in elongation factor G functions on the ribosome. J Mol Biol2000;300:95161.

33. De Vendittis E, Amatruda MR, Masullo M, Bocchini V. Cloning and sequencingof the gene encoding thermostable elongation factor 2 in Sulfolobus solfataricus.Gene 1993;136:418.

34. Wada A, Yamazaki Y, Fujita N, Ishihama A. Structure and probable geneticlocation of a ribosome modulation factor associated with 100S ribosomes instationary-phase Escherichia coli cells. Proc Natl Acad Sci U S A 1990;87:265761.

35. Wada A. Growth phase coupled modulation of Escherichia coli ribosomes. GenesCells 1998;3:2038.

36. Maki Y, Yoshida H, Wada A. Two proteins, YfiA and YhbH, associated withresting ribosomes in stationary phase Escherichia coli. Genes Cells 2000;5:96574.

37. Branda SS, Vik S, Friedman L, Kolter R. Biofilms: the matrix revisited. TrendsMicrobiol 2005;13:206.


38. Wayne LG, Hayes LG. An in vitro model for sequential study of shiftdown ofMycobacterium tuberculosis through two stages of nonreplicating persistence.Infect Immun 1996;64:20629.

39. Dahl JL, Arora K, Boshoff HI, Whiteford DC, Pacheco SA, Walsh OJ, et al. The relAhomolog of Mycobacterium smegmatis affects cell appearance, viability, andgene expression. J Bacteriol 2005;187:243947.

40. Smeulders MJ, Keer J, Speight RA, Williams HD. Adaptation of Mycobacteriumsmegmatis to stationary phase. J Bacteriol 1999;181:27083.

41. Cashel M, Gentry DR, Hernandez VH, Vinella D. The stringent response. In:Neidhardt FC, editor. Escherichia coli and Salmonella: cellular and molecularbiology. 2nd ed. Washington, DC: ASM Press; 1996. p. 145896.

42. Milon P, Tischenko E, Tomsic J, Caserta E, Folkers G, La Teana A, et al. Thenucleotide-binding site of bacterial translation initiation factor 2 (IF2) asa metabolic sensor. Proc Natl Acad Sci U S A 2006;103:139627.

43. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs Jr WR. Isolation and char-acterization of efficient plasmid transformation mutants of Mycobacteriumsmegmatis. Mol Microbiol 1990;4:19119.

44. Janosi L, Mottagui-Tabar S, Isaksson LA, Sekine Y, Ohtsubo E, Zhang S, et al.Evidence for in vivo ribosome recycling, the fourth step in protein biosynthesis.EMBO J 1998;17:114151.

45. Studier FW, Moffatt BA. Use of bacteriophage T7 RNA polymerase to directselective high-level expression of cloned genes. J Mol Biol 1986;189:11330.

46. Rao AR. Studies on ribosome recycling using mycobacterial ribosome recyclingfactor and elongation factor G. Ph.D. thesis. Indian Institute of Science, Ban-galore, India; 2002.

47. Rao AR, Varshney U. Characterization of Mycobacterium tuberculosis ribosomerecycling factor (RRF) and a mutant lacking six amino acids from the C-terminalend reveals that the C-terminal residues are important for its occupancy on theribosome. Microbiology 2002;148:391320.

48. DasGupta SK, Jain S, Kaushal D, Tyagi AK. Expression systems for study ofmycobacterial gene regulation and development of recombinant BCG vaccines.Biochem Biophys Res Commun 1998;246:797804.


Analysis of the fusA2 locus encoding EFG2 in Mycobacterium smegmatisIntroductionMaterials and methodsBacterial strains, culture conditions and reagentsCloning and purification of EFG2 from M. smegmatisCrosslinking of [alpha-32P]GTP with MsmEFG2Isolation of polysomes from log phase or stationary phase cultures of E. coli and M. smegmatisGTPase assaysGeneration of polyclonal antibody to MsmEFG2Expression analysis of MsmEFG2 in M. smegmatis mc2155Disruption of the fusA2 gene in M. smegmatis mc2155Genomic blot analysisViability of M. smegmatis mc2155 fusA2::kan in late stationary phase culturesPellicle formationIn vitro hypoxiaGrowth competition assays

ResultsComparison of primary sequences of EFG and EFG2Is MsmEFG2 a functional backup for EFG?Binding of MsmEFG2 to guanine nucleotidesMsmEFG2 does not show a ribosome-dependent GTPase activityExpression analysis of MsmEFG2 in M. smegmatis mc2155Generation of M. smegmatis mc2155 fusA2::kan strainGrowth kinetics of M. smegmatis mc2155 fusA2::kan, viability in late stationary phase cultures and pellicle formationSurvival of M. smegmatis mc2155 fusA2::kan strain under hypoxic conditionsGrowth competition assays

DiscussionAcknowledgementsSupplementary materialReferences

article in press - mcbl.iisc.ernet.in · fusa-like locus, fusa2 which encodes efg2. a comparison of...

Documents