Argonaute proteins at aglanceChristine Ender1 and GunterMeister1,2,*1Center for Integrated Protein Science Munich(CIPSM), Laboratory of RNA Biology, Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152Martinsried, Germany2University of Regensburg, Universitätsstraße 31,93053 Regensburg, Germany*Author for correspondence (gunter.meister@vkl.uni-regensburg.de)

Journal of Cell Science 123, 1819-1823 © 2010. Published by The Company of Biologists Ltddoi:10.1242/jcs.055210

Although a large portion of the human genomeis actively transcribed into RNA, less than 2%encodes proteins. Most transcripts are non-coding RNAs (ncRNAs), which have variouscellular functions. Small ncRNAs (or small

RNAs) – ncRNAs that are characteristically~20-35 nucleotides long – are required forthe regulation of gene expression in manydifferent organisms. Most small RNA speciesfall into one of the following three classes:microRNAs (miRNAs), short-interfering RNAs(siRNAs) and Piwi-interacting RNAs (piRNAs)(Carthew and Sontheimer, 2009). Althoughdifferent small RNA classes have differentbio genesis pathways and exert differentfunctions, all of them must associate with amember of the Argonaute protein family foractivity. This article and its accompanyingposter provide an overview of the differentclasses of small RNAs and the manner in whichthey interact with Argonaute protein familymembers during small-RNA-guided genesilencing. In addition, we highlight recentlyuncovered structural features of Argonauteproteins that shed light on their mechanism ofaction.

Biogenesis of miRNAs and siRNAsmiRNAsGenerally, miRNAs are transcribed by RNApolymerase II or III to form stem-loop-structuredprimary miRNA transcripts (pri-miRNAs). pri-miRNAs are processed in the nucleus by themicroprocessor complex, which containsthe RNAse III enzyme Drosha and its DiGeorgesyndrome critical region gene 8 (DGCR8)cofactor. The transcripts are cleaved at the stemof the hairpin to produce a stem-loop-structured miRNA precursor (pre-miRNA) of~70 nucleotides. After this first processing step,pre-miRNAs are exported into the cytoplasm byexportin-5, where they are further processedby the RNAse III enzyme Dicer and its TRBP(HIV transactivating response RNA-bindingprotein) partner. Dicer produces a small double-stranded RNA (dsRNA) intermediate of~22 nucleotides with 5 phosphates and2-nucleotide 3 overhangs. In subsequent

1819Cell Science at a Glance

(See poster insert)

© Journal of Cell Science 2010 (123, pp. 1819-1823)

Argonaute Proteins at a GlanceChristine Ender and Gunter Meister

Abbreviations: DGCR8, DiGeorge syndrome critical region gene 8; dsRNA, double-stranded RNA; endo-siRNA, siRNA derived from endogenous source; L1, linker 1; L2, linker 2; miRNA, microRNA; miRNP, miRNA-containing ribonucleoprotein particle; Mirtron, miRNA-intron; MILI, also known as PIWIL2 (Piwi-like homolog 2); MIWI, also known

as PIWIL1 (Piwi-like homolog 1); MIWI2, also known as PIWIL4 (Piwi-like homolog 4); piRNA, Piwi-interacting RNA; Pol II/III, RNA polymerase II or III; PRMT5, protein arginine methyltransferase 5; RISC, RNA-induced silencing complex; siRNA, small-interfering RNA; TDRD, Tudor-domain-containing protein; TRBP, HIV transactivating response RNA-binding protein.

Arginine methylation of Piwi proteins

Structure of Argonaute proteins Small-RNA biogenesis and mechanisms of action

CH3

CHN

sDMAmodification

= sDMA modification

MIWI2

MIWI2

?

MIWI2

MILI

TDRD

MIWI

PRMT5

Highestheterogeneity RNA binding Active site

3� OH-binding site

5� 3�1 10

oo

21

1� 10� 19�

p-TGAGGTAGTAGGTTGTATAGT

3�

Guide DNA

Backbone phosphorusatoms are in yellow

(Reproduced withpermission fromWang et al., 2008a)

Crystal structure of Thermus thermophilus Argonaute

Guide-DNA–target-RNA duplex used in crystal structure

Target RNA 5� UGCUCCAUCACUCAACAUAU

L1 L2

5� P-binding site

TDRD

TDRD

CH3

H3N COO

NH

NH

CH2

+

+ –

CH2

CH2

CH

TRBP

Exportin-5

TDRD

Mirtron

Microprocessor

Spliceosome

Processing

Splicing

miRNAprecursor

Dicer

Cofactor

Dicer

Ribosome

DGCR8Drosha

MILI

MILI

Cytoplasm

Nucleus

siRNAs

miRNAs

piRNAs

siRNA from exogenous sources

Endo-siRNAs

miRNAs miRNP

Secondary processing:ping-pong model

Trimming/cleavageof piRNA 3� ends

piRNA precursorsGeneration of piRNA5� ends by MIWI2

Generation of piRNA5� ends by MILI

Translationalrepression and/ordeadenylation

AGO

AGO

RISC

AGO

MIWI2

MIWI2

MIWI

PolII/III AGO

AGO

AAA

AGO

m7G

m7G

AAA

mRNA cleavage

MILIMILI

MILIMIWI

Transposon silencing

Transposon silencing

TDRD

piRNA precursors

Primary piRNA generation

GRGGRAARG

Sequence motifsfor symmetricaldimethylarginine(sDMA) modification,often in repeats

N terminus PAZ MID PIWIdsRNA from exogenous sources

Methylation of Piwiproteins enablestheir interaction withfunctionally importantTDRD proteins

MIWI2

MILIMIWI

MILI

TDRD

MIWI

MIWI2

MILI

Repetitive elements,pseudogenes, otherendo-siRNA loci

Repetitive elements,transposons, piRNAclusters

PrimarymiRNAtranscripts

Cofactor

Ba

(pW

Crystal structure of Thermus thermophilus Argona

L2

L1

N

PIWI

MIDPAZ

Jour

nal o

f Cel

l Sci

ence

1820

processing and unwinding steps, one strand ofthe dsRNA intermediate is incorporated into anArgonaute-protein-containing complex that isreferred to as an miRNA-containingribonucleoprotein particle (miRNP). Theopposite strand, the so-called miRNA* (miRNA‘star’) sequence, is thought to be degraded. Insome cases, however, miRNA* sequences canalso be functional (Packer et al., 2008). MaturemiRNAs guide Argonaute-containing complexesto target sites in mRNAs that are partiallycomplementary to the miRNA sequence, andinduce repression of gene expression at the levelof mRNA stability or translation (see poster).

In addition to this canonical miRNAbiogenesis pathway, some alternativemiRNA biogenesis pathways have recently beendiscovered. So-called mirtrons (miRNA-introns) are miRNAs found in introns. They areidentical to pre-miRNAs with respect to theirsize and features, but are generatedindependently of Drosha (Kim et al., 2009;Siomi and Siomi, 2009). Moreover, someclasses of small nucleolar RNAs (snoRNAs) canbe processed into small RNAs that act likemiRNAs (Ender et al., 2008; Scott et al., 2009;Taft et al., 2009).

siRNAsThere are many similarities between thepathways by which miRNAs and siRNAs areprocessed. In contrast to miRNAs, however,siRNAs are processed independently of Droshafrom long dsRNAs that are derived fromeither exogenous sources (to form exo-siRNAs) or endogenous sources (to formendo-siRNAs). Depending on the organism,exo-siRNAs can be produced throughthe cleavage of viral RNAs or byintroducing long, perfectly base-paired dsRNAinto the cytoplasm. Both Dicer and TRBP arerequired for the processing of siRNAs fromlong dsRNAs that are derived from exogenoussources. Endo-siRNAs have been reportedlyexpressed in plants and in animals such asCaenorhabditis elegans, flies and mice.Endo-siRNAs are derived from transposableelements, natural antisense transcripts, longintermolecularly paired hairpins andpseudogenes (Czech et al., 2008; Ghildiyalet al., 2008; Kawamura et al., 2008;Okamura et al., 2008).

After Dicer processing, siRNA duplexes areseparated and one strand is incorporated into theRNA-induced silencing complex (RISC). Thesingle-stranded RNA, often referred to asthe guide strand (the other strand is knownas the passenger strand), directs RISC toperfectly complementary sites in target mRNAmolecules; RISC then cleaves the targetmRNA (Kim et al., 2009).

The Argonaute protein familyTo perform their effector functions, small RNAsmust be incorporated into Argonaute-protein-containing complexes. Argonaute proteins arehighly specialized small-RNA-bindingmodules and are considered to be the keycomponents of RNA-silencing pathways.Argonaute proteins were named after an AGO-knockout phenotype in Arabidopsis thalianathat resembles the tentacles of the octopusArgonauta argo (Bohmert et al., 1998). On thebasis of sequence homology, Argonauteproteins can be divided into two subclasses.One resembles Arabidopsis AGO1 and isreferred to as the Ago subfamily; the otheris related to the Drosophila PIWI protein and isreferred to as the Piwi subfamily.

Members of the human Ago subfamily, whichconsists of AGO1, AGO2, AGO3 and AGO4,are ubiquitously expressed and associate withmiRNAs and siRNAs. Ago proteins areconserved throughout species and manyorganisms express multiple family members,ranging from one in Schizosaccharomycespombe, five in Drosophila, eight in humans, tenin Arabidopsis to twenty-seven in C. elegans(Tolia and Joshua-Tor, 2007). Argonauteproteins are also present in some species ofbudding yeast, including Saccharomycescastellii. It was recently found that S. castelliiexpresses siRNAs that are produced by a Dicerprotein that differs from the canonicalDicer proteins found in animals, plants and otherfungi (Drinnenberg et al., 2009). However, themodel organism Saccharomyces cerevisiaelacks Argonaute proteins and none of the knownsmall RNA pathways are conserved inS. cerevisiae. Argonaute proteins are also foundin some prokaryotes (Jinek and Doudna, 2009),but their function in these organisms remainsunclear.

The expression of Piwi subfamily members ismainly restricted to the germline, in which theyassociate with piRNAs. The human genomeencodes four Piwi proteins, named HIWI (alsoknown as PIWIL1), HILI (also known asPIWIL2), HIWI3 (also known as PIWIL3) andHIWI2 (also known as PIWIL4) (Petersand Meister, 2007). There are three Piwiproteins in mice, known as MIWI, MILI andMIWI2.

Structure and function of ArgonauteproteinsSmall RNAs regulate gene expression byguiding Argonaute proteins to complementarysites on target RNA molecules. Recent structuralstudies of bacterial and archaeal Argonauteproteins have shed light on the mechanism ofsilencing mediated by both Ago and Piwisubfamily proteins.

Argonaute proteins typically have amolecular weight of ~100 kDa and arecharacterized by a Piwi-Argonaute-Zwille(PAZ) domain and a PIWI domain.Crystallographic studies of archaeal andbacterial Argonaute proteins revealed that thePAZ domain, which is also common to Dicerenzymes, forms a specific binding pocket for the3-protruding end of the small RNA with whichit associates (Jinek and Doudna, 2009). Thestructure of the PIWI domain resembles that ofbacterial RNAse H, which has been shown tocleave the RNA strand of an RNA-DNA hybrid(Jinek and Doudna, 2009). More recently, it wasdiscovered that the catalytic activity of miRNAeffector complexes, also referred to as Sliceractivity, resides in the Argonaute protein itself.Interestingly, not all Argonaute proteins showendonucleolytic activity. In humans, onlyAGO2 has been shown to cleave thephosphodiester bond of a target RNA, at a siteopposite nucleotides 10 and 11 of the siRNA,although the conserved aspartic acid-asparticacid-histidine (DDH) motif (which is importantfor divalent metal ion binding and catalyticactivity) is also present in human AGO3 (Liuet al., 2004; Meister et al., 2004).

More recently, structural studies have beenextended to Thermus thermophilus Argonaute incomplex with a guide strand only or a guideDNA strand and a target RNA duplex. Thisanalysis revealed that the structure of thecomplex is divided into two lobes. One lobecontains the PAZ domain connected to theN-terminal domain through a linker region, L1.The second lobe consists of the middle (MID)domain (located between the PAZ and the PIWIdomains) and the PIWI domain. The 5phosphate of the small RNA to which Argonautebinds is positioned in a specific binding pocketin the MID domain (Jinek and Doudna, 2009).The contacts between the Argonaute protein andthe guide DNA or RNA molecule are dominatedby interactions with the sugar-phosphatebackbone of the small RNA or DNA; thus, thebases of the RNA or DNA guide strand are freefor base pairing with the complementary targetRNA. The structure indicates that thetarget mRNA base pairs with the guide DNAstrand, at least in the region of the seed sequence(which is especially important for targetrecognition), but does not touch the protein(Wang et al., 2008a; Wang, Y. et al., 2009; Wanget al., 2008b).

Although significant progress has beenmade regarding the structure of bacterial andarchaeal Argonaute proteins, no structures ofmammalian Argonaute proteins are available.As bacterial Argonaute proteins have a highaffinity for short DNA guide strands, it willbe interesting to see how mammalian

Journal of Cell Science 123 (11)

Jour

nal o

f Cel

l Sci

ence

1821

Argonaute proteins interact with short RNAguide strands.

miRNAs and siRNAs guide Ago proteins totheir target mRNA. A key determinant of theregulatory mechanism of RNA silencing isthe degree of complementarity between thesmall RNA and the target mRNA. Perfectcomplementarity promotes AGO2-mediatedendonucleolytic cleavage, whereas mismatchesin the central region of the small RNA lead torepression of gene expression at the level oftranslation or mRNA stability. However, themechanisms underlying translational repressionare not yet clear. Studies from severallaboratories have provided support for thesuggestion that miRNA-mediated repressionoccurs at early steps of translation. Usingdensity-gradient fractions, it was shownthat mRNAs repressed by miRNAs do notsediment in polysome fractions, but shift tothe free messenger ribonucleoprotein pool.Furthermore, it was shown that miRNA-mediated translational repression could onlytarget mRNAs containing a functional m7G cap(Filipowicz et al., 2008; Pillai et al., 2007). It hastherefore been suggested that miRNA-guidedtranslational repression is based on preventingthe circularization of the mRNA that is neededfor stimulation of translation. Contradicting thismodel are studies in which mRNA transcriptslacking a poly(A) tail can still be targeted bymiRNA-mediated repression (Carthew andSontheimer, 2009; Filipowicz et al., 2008; Pillaiet al., 2007). In contrast to the translationinitiation model of miRNA function, evidenceof miRNA-mediated effects during laterstages of translation has been reported. It hasbeen suggested that miRNA causes mRNAs toprematurely dissociate from or ‘drop off’ribosomes. Furthermore, an independent modelproposes that the nascent polypeptide chaintranslated from the mRNA target is degraded co-translationally (Carthew and Sontheimer, 2009;Filipowicz et al., 2008).

In addition to their capacity to mediatetranslational repression, it has beendemonstrated that miRNAs can guide thedestabilization of target mRNAs that containimperfectly complementary target sites (Baggaet al., 2005; Behm-Ansmant et al., 2006;Giraldez et al., 2006; Wu and Belasco, 2005).The mechanism of miRNA-mediated mRNAdecay requires proteins of the mRNA-degradation machinery and depends on amember of the Ago protein family anda member of the GW182 protein family(Behm-Ansmant et al., 2006; Eulalio et al.,2008b; Jakymiw et al., 2005; Liu et al., 2005;Meister et al., 2005). GW182 is characterized bythe presence of glycine and tryptophan repeats(GW repeats) and localizes to processing bodies

(P-bodies), cytoplasmic regions enriched forproteins involved in mRNA turnover (Eulalioet al., 2007). Insects have one GW182 protein,C. elegans has two (AIN1 and AIN2) andhumans have three paralogs (TNRC6A/GW182,TNRC6B and TNRC6C) (Eulalio et al., 2007).GW182 proteins associate with Ago proteinsthrough direct protein-protein interactions. Ithas been demonstrated that some GW motifsform Ago-interaction platforms that interactwith the MID domain of Ago proteins. SuchGW repeats are referred to as Ago ‘hooks’ (Tillet al., 2007). In Drosophila, depletion ofGW182 leads to increased levels of mRNAstargeted by miRNAs (Behm-Ansmant et al.,2006; Eulalio et al., 2008a). Moreover, tetheringof GW182 to a target mRNA repressestranslation of the mRNA independently ofDrosophila AGO1, demonstrating that GW182is an important effector protein functioningdownstream of Ago proteins (Behm-Ansmantet al., 2006). A recent study in Krebs-2 mouseascite cell extract (Fabian et al., 2009) and anearlier study in Drosophila (Behm-Ansmantet al., 2006) found that CAF1, a component ofthe CCR-NOT deadenylase complex that isrequired for the removal of the poly(A) tail ofmRNAs, is at least partially responsiblefor miRNA-mediated deadenylation of targetmRNAs. Furthermore, poly(A)-binding protein(PABP), which interacts with the poly(A) tail ofmRNAs and the eukaryotic translation initiationfactor 4G (eIF4G) subunit of the cap-bindingcomplex that circularizes the mRNA duringtranslational initiation, also interacts withGW182 proteins (Beilharz et al., 2009; Fabianet al., 2009). Consistently, it has been proposedthat GW182 proteins might compete with eIF4Gfor PABP binding and therefore prevent mRNAcircularization. Uncircularized mRNA mightnot be able to initiate translation efficiently andprotein expression is reduced (Beilharz et al.,2009; Fabian et al., 2009; Zekri et al., 2009).

In summary, Ago proteins are highlyspecialized small-RNA-binding proteins. SmallRNAs guide Ago proteins to complementarytarget mRNAs, where Ago proteins act togetherwith protein binding partners to interfere withtranslation or induce deadenylation of targetmRNAs.

Piwi proteins, piRNA function andtransposon silencingIn Drosophila, PIWI, Aubergine (AUB)and AGO3 constitute the Piwi subfamily.Mutations in the PIWI protein lead to defectsin oogenesis and depletion of germline cells,whereas AUB mutations disrupt gametogenesis.In mice, all Piwi proteins are important forspermatogenesis. The discovery of piRNAs, thesmall RNA partners to which Piwi proteins bind,

helped to further elucidate the function of theseproteins (Aravin and Hannon, 2008). Inmammals, piRNA expression changes duringstages of sperm development. During the pre-pachytene stage of meiosis, piRNAspredominantly correspond to repetitive andtransposon-rich sequences, and interact withmouse Piwi subfamily members MILI andMIWI2. piRNAs found during the pachytenestage of meiosis associate with Piwi subfamilymembers MILI and MIWI (Aravin and Hannon,2008). In mice, it has been demonstrated thatpiRNAs act together with their respective Piwiprotein partners to repress the expression ofmobile genetic elements in the germline.Such mobile elements can randomly integrateinto the genome and it is important that suchevents are repressed in the germline. Recently, ithas been found that Piwi proteins are methylatedby the arginine methyltransferase PRMT5 andpossibly by other methyltransferases. Thesepost-translational modifications enable Piwiproteins to interact with Tudor-domain-containing proteins (TDRDs) (Kirino et al.,2009; Reuter et al., 2009; Vagin et al., 2009).Not much is known about the function of TDRDproteins in gene silencing. It has been suggestedthat TDRD1 contributes to pre-pachytenepiRNA biogenesis and is important for silencingrepetitive elements.

In addition to piRNAs, the endo-siRNApathway also contributes to transposonrepression (Okamura and Lai, 2008). In the malegermline, mutations in components of the piRNApathway have a severe effect on fertility, whereasthis pathway appears to be dispensable in thefemale germline of mammals, which is enrichedin endo-siRNAs (Tam et al., 2008; Watanabeet al., 2008). It might therefore be possible that, inthe germline, the piRNA pathway and the endo-siRNA pathway cooperate with each other intransposon repression.

Although thousands of individual piRNAsequences have been identified, they derivefrom discrete genomic clusters (Aravin andHannon, 2008). Drosophila Piwi subfamilymembers PIWI and AUB bind to piRNAs thatare antisense to transposon RNAs, whereas thethird Piwi protein in flies, AGO3, typicallybinds the sense strands. AUB- and PIWI-associated piRNAs preferentially carry a uracilat their 5 end, whereas most AGO3-associatedpiRNAs have an adenine at nucleotide 10. Withthe discovery that the first ten nucleotides ofantisense piRNAs are often complementary tothe sense piRNAs, the ‘ping-pong’ model hasbeen proposed (Kim et al., 2009). In this model,AUB or PIWI proteins that are associated withantisense piRNAs cleave sense retrotransposontranscripts, thereby creating the 5 end of sensepiRNAs that then associate with AGO3. AGO3

Journal of Cell Science 123 (11)

Jour

nal o

f Cel

l Sci

ence

1822

subsequently cleaves antisense retrotransposontranscripts, generating the 5 end of antisensepiRNAs that subsequently bind to PIWI. It is notknown how the 3 end of the piRNA isgenerated. However, it is tempting to speculatethat exonucleases or endonucleases interact withPiwi proteins, and either trim or cleave the RNAto generate the correct piRNA 3 end. Throughthis continuous cycle, piRNAs are amplified andretrotransposon silencing can be maintained.However, the mechanism by which piRNAbiogenesis is initiated is not understood. It isknown that AUB and PIWI are maternallyinherited (Brennecke et al., 2008). It is possiblethat the maternally contributed piRNAs that areassociated with AUB and PIWI act as primarypiRNAs and initiate the ping-pong cycle in theembryo. The ping-pong model found inDrosophila might also be applicable to mousepiRNAs and the mouse Piwi proteins MILI andMIWI2.

Argonaute proteins in the nucleusIn addition to their role in small-RNA-mediatedsilencing at the mRNA level in the cytoplasm,Argonaute proteins are also thought to functionin the nucleus at the transcriptional level.Transcriptional gene silencing was firstdiscovered in plants, in which small RNAsderived from transgenes and viral RNAs werefound to guide methylation of homologousDNA sequences. Further studies showedthat DNA methylation of a specific transgenewas Dicer and Argonaute dependent, and linkedto histone H3 lysine 9 (H3K9) methylation. Incontrast to plants, small RNAs in S. pombe canonly induce histone methylation and are notcapable of guiding DNA-methylation events.The AGO1-containing effector complex inS. pombe is termed the RNA-inducedtranscriptional silencing (RITS) complex,which associates with nascent transcripts andthe DNA-dependent RNA polymerase. Ahistone methyltransferase leads to H3K9methylation and subsequent heterochromatinformation (Moazed, 2009).

In mammals, siRNAs that are directed to genepromoters can induce histone methylationdependent on AGO1 (and AGO2) (Janowskiet al., 2006; Kim et al., 2006). Furthermore, arole for promoter-directed human miRNAs infacilitating transcriptional gene silencing hasbeen described (Kim et al., 2008). Promoter-targeting RNAs have also been found to beinvolved in activating transcription (Janowskiet al., 2007; Schwartz et al., 2008). These resultsmight suggest that small-RNA-mediated DNAand histone modifications also occur inmammals. However, for a conclusive model ofhow Argonaute proteins function onmammalian chromatin, further experimental

work is needed. Further supporting the idea thatsmall-RNA pathways are functional in thenucleus, it has also recently been reported thatAgo proteins localize to the nucleus (Weinmannet al., 2009). However, the mechanistic detailsof small-RNA function in the nucleus ofmammalian cells remain unclear.

PerspectivesAlthough many aspects of Argonaute functionhave been characterized, there are still manyopen questions. Why do only some Argonauteproteins possess endonuclease activity, despitecontaining crucial conserved amino acids? Tworecent publications have reported thatArgonaute proteins might have differentcleavage preferences: whereas only humanAGO2 cleaves complementary target mRNAsthrough an RNAi-like mechanism, both AGO1and AGO2 can cleave the passenger strand of ansiRNA duplex (Steiner et al., 2009; Wang, B.et al., 2009). However, further work will benecessary to confirm these initial observations.It is also becoming increasingly apparent thatArgonaute proteins can be post-translationallymodified: modifications such as hydroxylation,phosphorylation and ubiquitylation influenceArgonaute stability and function in mammals(Qi et al., 2008; Rybak et al., 2009; Zeng et al.,2008). However, Argonaute modifications havenot yet been analyzed systematically. Futureresearch will not only unravel novel Argonautemodifications, but will also help to placeArgonaute proteins within complex cellularsignaling pathways. Such findings might alsohelp to understand the molecular basis ofvarious diseases in which gene expression isdisrupted, including cancer.

ReferencesAravin, A. A. and Hannon, G. J. (2008). Small RNAsilencing pathways in germ and stem cells. Cold SpringHarbor Symp. Quant. Biol. 73, 283-290.Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J.,Eachus, R. and Pasquinelli, A. E. (2005). Regulation bylet-7 and lin-4 miRNAs results in target mRNA degradation.Cell 122, 553-563.Behm-Ansmant, I., Rehwinkel, J., Doerks, T., Stark, A.,Bork, P. and Izaurralde, E. (2006). mRNA degradation bymiRNAs and GW182 requires both CCR4:NOTdeadenylase and DCP1:DCP2 decapping complexes. GenesDev. 20, 1885-1898.Beilharz, T. H., Humphreys, D. T., Clancy, J. L.,Thermann, R., Martin, D. I., Hentze, M. W. and Preiss,T. (2009). microRNA-mediated messenger RNAdeadenylation contributes to translational repression inmammalian cells. PLoS ONE 4, e6783.Bohmert, K., Camus, I., Bellini, C., Bouchez, D.,Caboche, M. and Benning, C. (1998). AGO1 defines anovel locus of Arabidopsis controlling leaf development.EMBO J. 17, 170-180.Brennecke, J., Malone, C. D., Aravin, A. A.,Sachidanandam, R., Stark, A. and Hannon, G. J. (2008).An epigenetic role for maternally inherited piRNAs intransposon silencing. Science 322, 1387-1392.Carthew, R. W. and Sontheimer, E. J. (2009). Origins andmechanisms of miRNAs and siRNAs. Cell 136, 642-655.Czech, B., Malone, C. D., Zhou, R., Stark, A.,Schlingeheyde, C., Dus, M., Perrimon, N., Kellis, M.,

Wohlschlegel, J. A., Sachidanandam, R. et al. (2008). Anendogenous small interfering RNA pathway in Drosophila.Nature 453, 798-802.Drinnenberg, I. A., Weinberg, D. E., Xie, K. T., Mower,J. P., Wolfe, K. H., Fink, G. R. and Bartel, D. P. (2009).RNAi in budding yeast. Science 326, 544-550.Ender, C., Krek, A., Friedlander, M. R., Beitzinger, M.,Weinmann, L., Chen, W., Pfeffer, S., Rajewsky, N. andMeister, G. (2008). A human snoRNA with microRNA-likefunctions. Mol. Cell 32, 519-528.Eulalio, A., Behm-Ansmant, I. and Izaurralde, E. (2007).P bodies: at the crossroads of post-transcriptional pathways.Nat. Rev. Mol. Cell Biol. 8, 9-22.Eulalio, A., Huntzinger, E. and Izaurralde, E. (2008a).Getting to the root of miRNA-mediated gene silencing. Cell132, 9-14.Eulalio, A., Huntzinger, E. and Izaurralde, E. (2008b).GW182 interaction with Argonaute is essential for miRNA-mediated translational repression and mRNA decay. Nat.Struct. Mol. Biol. 15, 346-353.Fabian, M. R., Mathonnet, G., Sundermeier, T., Mathys,H., Zipprich, J. T., Svitkin, Y. V., Rivas, F., Jinek, M.,Wohlschlegel, J., Doudna, J. A. et al. (2009). MammalianmiRNA RISC recruits CAF1 and PABP to affect PABP-dependent deadenylation. Mol. Cell 35, 868-880.Filipowicz, W., Bhattacharyya, S. N. and Sonenberg, N.(2008). Mechanisms of post-transcriptional regulation bymicroRNAs: are the answers in sight? Nat. Rev. Genet. 9,102-114.Ghildiyal, M., Seitz, H., Horwich, M. D., Li, C., Du, T.,Lee, S., Xu, J., Kittler, E. L., Zapp, M. L., Weng, Z. etal. (2008). Endogenous siRNAs derived from transposonsand mRNAs in Drosophila somatic cells. Science 320, 1077-1081.Giraldez, A. J., Mishima, Y., Rihel, J., Grocock, R. J.,Van Dongen, S., Inoue, K., Enright, A. J. and Schier, A.F. (2006). Zebrafish MiR-430 promotes deadenylation andclearance of maternal mRNAs. Science 312, 75-79.Jakymiw, A., Lian, S., Eystathioy, T., Li, S., Satoh, M.,Hamel, J. C., Fritzler, M. J. and Chan, E. K. (2005).Disruption of GW bodies impairs mammalian RNAinterference. Nat. Cell Biol. 7, 1267-1274.Janowski, B. A., Huffman, K. E., Schwartz, J. C., Ram,R., Nordsell, R., Shames, D. S., Minna, J. D. and Corey,D. R. (2006). Involvement of AGO1 and AGO2 inmammalian transcriptional silencing. Nat. Struct. Mol. Biol.13, 787-792.Janowski, B. A., Younger, S. T., Hardy, D. B., Ram, R.,Huffman, K. E. and Corey, D. R. (2007). Activating geneexpression in mammalian cells with promoter-targetedduplex RNAs. Nat. Chem. Biol. 3, 166-173.Jinek, M. and Doudna, J. A. (2009). A three-dimensionalview of the molecular machinery of RNA interference.Nature 457, 405-412.Kawamura, Y., Saito, K., Kin, T., Ono, Y., Asai, K.,Sunohara, T., Okada, T. N., Siomi, M. C. and Siomi, H.(2008). Drosophila endogenous small RNAs bind toArgonaute 2 in somatic cells. Nature 453, 793-797.Kim, D. H., Villeneuve, L. M., Morris, K. V. and Rossi,J. J. (2006). Argonaute-1 directs siRNA-mediatedtranscriptional gene silencing in human cells. Nat. Struct.Mol. Biol. 13, 793-797.Kim, D. H., Saetrom, P., Snove, O., Jr and Rossi, J. J.(2008). MicroRNA-directed transcriptional gene silencingin mammalian cells. Proc. Natl. Acad. Sci. USA 105, 16230-16235.Kim, V. N., Han, J. and Siomi, M. C. (2009). Biogenesisof small RNAs in animals. Nat. Rev. Mol. Cell Biol. 10, 126-139.Kirino, Y., Kim, N., de Planell-Saguer, M., Khandros, E.,Chiorean, S., Klein, P. S., Rigoutsos, I., Jongens, T. A.and Mourelatos, Z. (2009). Arginine methylation of Piwiproteins catalysed by dPRMT5 is required for Ago3 andAub stability. Nat. Cell Biol. 11, 652-658.Liu, J., Carmell, M. A., Rivas, F. V., Marsden, C. G.,Thomson, J. M., Song, J. J., Hammond, S. M., Joshua-Tor, L. and Hannon, G. J. (2004). Argonaute2 is thecatalytic engine of mammalian RNAi. Science 305, 1437-1441.Liu, J., Rivas, F. V., Wohlschlegel, J., Yates, J. R., 3rd,Parker, R. and Hannon, G. J. (2005). A role for the P-body component GW182 in microRNA function. Nat. CellBiol. 7, 1161-1166.

Journal of Cell Science 123 (11)

Jour

nal o

f Cel

l Sci

ence

1823

Meister, G., Landthaler, M., Patkaniowska, A., Dorsett,Y., Teng, G. and Tuschl, T. (2004). Human Argonaute2mediates RNA cleavage targeted by miRNAs and siRNAs.Mol. Cell 15, 185-197.Meister, G., Landthaler, M., Peters, L., Chen, P. Y.,Urlaub, H., Luhrmann, R. and Tuschl, T. (2005).Identification of novel argonaute-associated proteins. Curr.Biol. 15, 2149-2155.Moazed, D. (2009). Small RNAs in transcriptional genesilencing and genome defence. Nature 457, 413-420.Okamura, K. and Lai, E. C. (2008). Endogenous smallinterfering RNAs in animals. Nat. Rev. Mol. Cell Biol. 9,673-678.Okamura, K., Chung, W. J., Ruby, J. G., Guo, H., Bartel,D. P. and Lai, E. C. (2008). The Drosophila hairpin RNApathway generates endogenous short interfering RNAs.Nature 453, 803-806.Packer, A. N., Xing, Y., Harper, S. Q., Jones, L. andDavidson, B. L. (2008). The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and isdownregulated in Huntington’s disease. J. Neurosci. 28,14341-14346.Peters, L. and Meister, G. (2007). Argonaute proteins:mediators of RNA silencing. Mol. Cell 26, 611-623.Pillai, R. S., Bhattacharyya, S. N. and Filipowicz, W.(2007). Repression of protein synthesis by miRNAs: howmany mechanisms? Trends Cell Biol. 17, 118-126.Qi, H. H., Ongusaha, P. P., Myllyharju, J., Cheng, D.,Pakkanen, O., Shi, Y., Lee, S. W. and Peng, J. (2008).Prolyl 4-hydroxylation regulates Argonaute 2 stability.Nature 455, 421-424.Reuter, M., Chuma, S., Tanaka, T., Franz, T., Stark, A.and Pillai, R. S. (2009). Loss of the Mili-interacting Tudordomain-containing protein-1 activates transposons andalters the Mili-associated small RNA profile. Nat. Struct.Mol. Biol. 16, 639-646.Rybak, A., Fuchs, H., Hadian, K., Smirnova, L.,Wulczyn, E. A., Michel, G., Nitsch, R., Krappmann, D.and Wulczyn, F. G. (2009). The let-7 target gene mouse

lin-41 is a stem cell specific E3 ubiquitin ligase for themiRNA pathway protein Ago2. Nat. Cell Biol. 11, 1411-1220.Schwartz, J. C., Younger, S. T., Nguyen, N. B., Hardy, D.B., Monia, B. P., Corey, D. R. and Janowski, B. A. (2008).Antisense transcripts are targets for activating small RNAs.Nat. Struct. Mol. Biol. 15, 842-848.Scott, M. S., Avolio, F., Ono, M., Lamond, A. I. andBarton, G. J. (2009). Human miRNA precursors with boxH/ACA snoRNA features. PLoS Comput. Biol. 5, e1000507.Siomi, H. and Siomi, M. C. (2009). On the road to readingthe RNA-interference code. Nature 457, 396-404.Steiner, F. A., Okihara, K. L., Hoogstrate, S. W., Sijen,T. and Ketting, R. F. (2009). RDE-1 slicer activity isrequired only for passenger-strand cleavage during RNAi inCaenorhabditis elegans. Nat. Struct. Mol. Biol. 16, 207-211.Taft, R. J., Glazov, E. A., Lassmann, T., Hayashizaki, Y.,Carninci, P. and Mattick, J. S. (2009). Small RNAsderived from snoRNAs. RNA 15, 1233-1240.Tam, O. H., Aravin, A. A., Stein, P., Girard, A.,Murchison, E. P., Cheloufi, S., Hodges, E., Anger, M.,Sachidanandam, R., Schultz, R. M. et al. (2008).Pseudogene-derived small interfering RNAs regulate geneexpression in mouse oocytes. Nature 453, 534-538.Till, S., Lejeune, E., Thermann, R., Bortfeld, M.,Hothorn, M., Enderle, D., Heinrich, C., Hentze, M. W.and Ladurner, A. G. (2007). A conserved motif inArgonaute-interacting proteins mediates functionalinteractions through the Argonaute PIWI domain. Nat.Struct. Mol. Biol. 14, 897-903.Tolia, N. H. and Joshua-Tor, L. (2007). Slicer and theargonautes. Nat. Chem. Biol. 3, 36-43.Vagin, V. V., Wohlschlegel, J., Qu, J., Jonsson, Z., Huang,X., Chuma, S., Girard, A., Sachidanandam, R., Hannon,G. J. and Aravin, A. A. (2009). Proteomic analysis ofmurine Piwi proteins reveals a role for arginine methylationin specifying interaction with Tudor family members. GenesDev. 23, 1749-1762.

Wang, B., Li, S., Qi, H. H., Chowdhury, D., Shi, Y. andNovina, C. D. (2009). Distinct passenger strand and mRNAcleavage activities of human Argonaute proteins. Nat.Struct. Mol. Biol. 16, 1259-1266.Wang, Y., Juranek, S., Li, H., Sheng, G., Tuschl, T. andPatel, D. J. (2008a). Structure of an argonaute silencingcomplex with a seed-containing guide DNA and target RNAduplex. Nature 456, 921-926.Wang, Y., Sheng, G., Juranek, S., Tuschl, T. and Patel,D. J. (2008b). Structure of the guide-strand-containingargonaute silencing complex. Nature 456, 209-213.Wang, Y., Juranek, S., Li, H., Sheng, G., Wardle, G. S.,Tuschl, T. and Patel, D. J. (2009). Nucleation, propagationand cleavage of target RNAs in Ago silencing complexes.Nature 461, 754-761.Watanabe, T., Totoki, Y., Toyoda, A., Kaneda, M.,Kuramochi-Miyagawa, S., Obata, Y., Chiba, H.,Kohara, Y., Kono, T., Nakano, T. et al. (2008).Endogenous siRNAs from naturally formed dsRNAsregulate transcripts in mouse oocytes. Nature 453, 539-543.Weinmann, L., Hock, J., Ivacevic, T., Ohrt, T., Mutze, J.,Schwille, P., Kremmer, E., Benes, V., Urlaub, H. andMeister, G. (2009). Importin 8 is a gene silencing factor thattargets argonaute proteins to distinct mRNAs. Cell 136, 496-507.Wu, L. and Belasco, J. G. (2005). Micro-RNA regulationof the mammalian lin-28 gene during neuronaldifferentiation of embryonal carcinoma cells. Mol. Cell.Biol. 25, 9198-9208.Zekri, L., Huntzinger, E., Heimstadt, S. and Izaurralde,E. (2009). The silencing domain of GW182 interacts withPABPC1 to promote translational repression anddegradation of microRNA targets and is required for targetrelease. Mol. Cell. Biol. 29, 6220-6231.Zeng, Y., Sankala, H., Zhang, X. and Graves, P. (2008).Phosphorylation of Argonaute2 at serine 387 facilitates itslocalization to processing bodies. Biochem. J. 413, 429-436.

Journal of Cell Science 123 (11)

Jour

nal o

f Cel

l Sci

ence