are you ready for the genomic age ? an introduction to human genomics
DESCRIPTION
Are you ready for the genomic age ? An introduction to human genomics. Jacques Fellay EPFL School of Life Sciences Swiss Institute of Bioinformatics Lausanne, Switzerland. What is the genome?. “It's a shop manual , with an incredibly detailed blueprint for building every human cell. - PowerPoint PPT PresentationTRANSCRIPT
Are you ready for the genomic age? An introduction to human genomics
Jacques FellayEPFL School of Life SciencesSwiss Institute of BioinformaticsLausanne, Switzerland
What is the genome?
“It's a shop manual, with an incredibly detailed blueprint for building every human cell.It's a history book - a narrative of the journey of our species through time.It's a transformative textbook of medicine, with insights that will give health care providers new powers to treat, prevent and cure disease.”
Francis Collins
Glossary
• Genome: the complete genetic constitution of an organism, encoded in nucleic acids
• Gene: discrete DNA sequence encoding a protein
3 billions base pairs (ATGC)20’000 protein-coding genes
99.6% inter-individual identity (yet 4 millions differences)99% identical to chimpanzee genome (yet 6% different genes)
The human genome
2001: A Species Odyssey
Exploring the human genome
Sanger sequencing,targeted genotyping
Genome-wide genotyping (GWAS)
Exome sequencing
Genome sequencing
2002 2008
International HapMap Project
Identification of common genetic variation in 270 individuals from 4 populations
• CEU: CEPH (Utah residents with ancestry from northern and western Europe) (30 trios)
• CHB: Han Chinese in Beijing, China (45 individuals)• JPT: Japanese in Tokyo, Japan (45 individuals)• YRI: Yoruba in Ibadan, Nigeria (30 trios)
1000 Genomes Project
Whole genome sequencing and complete description of human genetic diversity in >1000 individuals from
multiple world populations
www.1000genomes.org
Short video – Sequencing the genome
http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel
We are all different…
4 million DNA variants / individual
Single nucleotide variants
Multi-nucleotide variants • Small insertions/deletions (indels)• Large copy number variants (CNVs)• Inversions• Translocations • Aneuploidy
Glossary
• SNV = single nucleotide variant: DNA sequence variation in which a single nucleotide — A, T, C or G — differs between members of the same species
• SNP = single nucleotide polymorphism:SNV occurring commonly within a population (> 1%)
Glossary
• Allele: One of a number of alternative forms of the same genetic locus (for example a SNP)
About 2% of people have two copies of the APOE4 allele and are very likely to succumb to Alzheimer’s disease
About 1% of us have two copies of a small deletion in CCR5 and are largely immune to infection by the HIV virus
And about 7% do not make any functional CYP2D6 enzyme and therefore codeine provides no pain relief
Glossary
• Linkage Disequilibrium (LD): Non-random association of alleles that descend from single, ancestral chromosomes (i.e. usually close to each other)
• Haplotype: Combination of alleles at adjacent locations on a chromosome that are inherited together
How to read the genome?
Genotyping Sequencing
Glossary
• Genotyping:Process of determining genetic differences between individuals by using a set of markers
• Sequencing:Process of determining the full nucleotide order of a DNA sequence
Genotyping
Genome-wide chips:500K to >1 mio single nucleotide polymorphisms (SNPs)
SNP output
0 2000 4000 6000 8000 10000 12000 14000 16000 18000 20000Intensity (A)
rs1372493
-2000
0
2000
4000
6000
8000
10000
12000
14000
16000
Inte
nsity
(B)
0 0.20 0.40 0.60 0.80 1Norm Theta
rs1372493
-0.20
0
0.20
0.40
0.60
0.80
1
1.20
1.40
1.60
Nor
m R
2317 834 74
Homozygous 1
Heterozygous
Homozygous 2
Genome-wide genotyping
Sequencing
>5%<<<<<1%
Allele frequency of variant
+++ +++
Clinical impact
High-throughput Sequencing (NGS)
– Huge amount of data (terabytes)– Analysis computationally intensive– Dedicated IT infrastructure
• Pipeline
Library construction and sequencing
Sequencing quality controlFASTQ files
FastQ format – single read
@G:1:1:11:1079#0/1
TGATTGATTCCATTCCATTCCATTCCATTTCATTCCATTGCAATCCCTTCCAATCCATTCCATTCCATTCCATTC
+G:1:1:11:1079#0/1`Xa^YO\_^a_`__`a__^a^a^_a``^_\`\\]``[XUGXXXXXWUTWWVWUSTXXPUWYYRVWYYYXZYXYWZ
A complete, high-coverage genome will have over 1 billion reads
• Pipeline
Library construction and sequencing
Sequencing quality controlFASTQ files
Read mappingSort, index, remove duplicates
Mapping quality controlBAM files
• Pipeline
• Pipeline
Library construction and sequencing
Sequencing quality controlFASTQ files
Read mappingSort, index, remove duplicates
Mapping quality controlBAM files
Variant Calling
Variant calling quality controlVCF files
• Pipeline
http://www.ncbi.nlm.nih.gov/core/assets/variation/images/popfreq_example.jpg
Identification of potentially causal variants
Individualized care and counseling
• Pipeline
Library construction and sequencing
Sequencing quality controlFASTQ files
Read mappingSort, index, remove duplicates
Mapping quality controlBAM files
Variant Calling
Variant calling quality controlVCF files
Summary of a single human genome
SNVs 3.5 millionPremature stop 80Stop loss 10Non-synonymousSynonymous
11,00011,000
Essential splice site 25
indels 300,000Frameshift 80In-frame 200
Whole genome vs. exome sequencing
Exome-Coding regions-Cheaper/Faster-Uneven capture of both alleles-Incomplete capture of target region-Bias towards known biology
Genome-Complete sequence
-Expensive/Throughput-IT issues
Clinical sequencing?“Sequencing of the genome or exome for clinical applications has now entered medical practice. Several thousand tests have already been ordered for patients, with the goal of establishing diagnoses for rare, clinically unrecognizable, or puzzling disorders that are suspected to be genetic in origin.”
Leslie G. Biesecker and Robert C. Green, NEJM, 19 June 2014
Clinical sequencing?
TODAY
• Rare functional variants (Mendelian diseases)• Pharmacogenetic variants (150 gene-drug
pairs in the FDA “Table of Pharmacogenomic Biomarkers in Drug Labels”, but only 40 genes involved)
• Oncogenomics
IL28B genotype and response to anti-hepatitis C treatment
Ge, Fellay et al. Nature 2009
Clinical sequencing?
TOMORROW
• Neonatal sequencing• Maternal blood sequencing• DTC genomics brought to doctors
Clinical sequencing?
LATER
• Complex trait genomics (genome data in every health record) – will depend on in-depth understanding of functional genomic variation
Eric Green et al., Charting a course for genomic medicine from base pairs to bedside, Nature 2011
A revolution in the making
Perspective
• Genomic-based medicine is around the corner• Considerable space for new (personal) genomic
market in health, nutrition, well-being…• Genomic-based medicine is only the beginning
of “big-data-based” personalized healthcare
Perspective
None of this can happen without trust