apoptosis induction by polygonum minus is related to antioxidant capacity, alterations in expression...

8/16/2019 Apoptosis Induction by Polygonum minus Is Related to Antioxidant Capacity, Alterations in Expression of Apoptotic…

1/13

Research Article Apoptosis Induction by Polygonum minus IsRelated to Antioxidant Capacity, Alterations inExpression of Apoptotic-Related Genes, and S-Phase Cell Cycle

Arrest in HepG2 Cell Line

Mohd Alfazari Mohd Ghazali,1,2,3 Ghanya Al-Naqeb,4

Kesavanarayanan Krishnan Selvarajan,1,2 Mizaton Hazizul Hasan,1,2 and Aishah Adam1,2

Pharmacology and oxicology Research Laboratory, Faculty of Pharmacy, University echnology MARA (UiM), Bandar Puncak Alam, Selangor Darul Ehsan, Malaysia

Group on Affinity, Efficacy and Safety Studies (OASES), Brain and Neuroscience Communities of Research,University echnology MARA (UiM), Shah Alam, Selangor Darul Ehsan, Malaysia

School of Pharmaceutical Sciences, University Science of Malaysia (USM), Minden, Penang, Malaysia Department of Food Sciences and echnology, Faculty of Agriculture, University of Sana’a, Sana’a, Yemen

Correspondence should be addressed to Aishah Adam; aishah [email protected]

Received February ; Accepted April ; Published May

Academic Editor: Joohun Ha

Copyright © Mohd Alazari Mohd Ghazali et al. Tis is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work isproperly cited.

Polygonum minus (Polygonaceae) is a medicinal herb distributed throughout eastern Asia. Te present study investigatedantiprolierative effect o P. minus and its possible mechanisms. Four extracts (petroleum ether, methanol, ethyl acetate, and water)were prepared by cold maceration. Extracts were subjected to phytochemical screening, antioxidant, and antiprolierative assays;the most bioactive was ractionated using vacuum liquid chromatography into seven ractions (F–F). Antioxidant activity wasmeasured via total phenolic content (PC), ,-diphenyl--picrylhydrazyl (DPPH), and erric reducing antioxidant power (FRAP)assays. Antiprolierative activity was evaluated using -(,-dimethylthiazol--yl)-,-diphenyltetrazolium bromide (M) assay.Most active raction was tested or apoptosis induction and cell cycle arrest in HepG cells using ow cytometry and conocalmicroscopy. Apoptotic-related gene expression was studied by R-PCR. Ethyl acetate extract was bioactive in initial assays. Itsraction, F, exhibited highest antioxidant capacity (PC; 113.16 ± 6. mg GAE/g extract, DPPH; EC

50: 30.5 ± 3.2 g/mL, FRAP;

1169 ± 20.3 mol Fe (II)/mg extract) and selective antiprolierative effect (IC50

: 25.75 ± 1.5 g/mL). F induced apoptosis inconcentration- and time-dependent manner and caused cell cycle arrest at S-phase. Upregulation o proapoptotic genes (Bax , p,

and caspase-) and downregulation o antiapoptotic gene, Bcl-, were observed. In conclusion, F was antiprolierative to HepGcells by inducing apoptosis, cell cycle arrest, and via antioxidative effects.

1. Introduction

Apoptosis plays an important role in cancer developmentand is a target or enhancing understanding o cancer andin development o anticancer treatment. Apoptosis is ahighly regulated process characterized by cleavage o pro-teins and activation o caspases in viable cells resulting in

DNA ragmentation, chromatin condensation, membraneblebbing, and cell shrinkage []. Tis process is essentialor homeostatic mechanism to maintain cellular integrity by removing unwanted, redundant, and damaged cells by noninammatory ways. However, in many cancer cells,apoptosis is dysregulated due to multiple genetic aberrationsand cellular stress, conerring resistance to death in these

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014, Article ID 539607, 13 pageshttp://dx.doi.org/10.1155/2014/539607

http://dx.doi.org/10.1155/2014/539607http://dx.doi.org/10.1155/2014/539607


2/13

BioMed Research International

cells which then stay longer in circulation. In the last twodecades, extensive studies aimed at improving understandingo intrinsic signaling pathways that control execution o apoptosis in cancer cells were undertaken. Tese include theuse o antiapoptotic proteins and stimulation o proapoptoticproteins as part o treatment strategy or cancer []. Car-

cinogenesis is also related to excessive ree radical ormation.Many studies have shown that reactive oxygen species (ROS),reactive nitrogen species (RNS), and other metabolism by-products can cause DNA mutation leading to initiation andprogression o cancer. Endogenous and exogenous antioxi-dants can antagonize the promotion phase o carcinogenesisin many types o malignancies through detoxication o theseree radicals []. Antioxidants rom plants with apoptosis-inducing capabilities have drawn a lot o interest in cancerresearch due to cost effectiveness as they are abundant innature and supposedly have ewer side effects than syntheticantioxidants. Much work has been conducted on herbs withantioxidant and anticancer effects [].

Polygonum minus, amily Polygonaceae, is locally knownas “kesum” in Malaysia. It is extensively used in certaintypes o Malay dishes such as “laksa” or “asam pedas.” Itis used traditionally to treat rheumatism, indigestion, andkidney stones and to control hair dandruff. Researchers havelinked the pharmacological effects o this plant to its highantioxidant capacity. Aqueous, methanolic, and ethanolicextracts o this plant showed high antioxidant activity whichwas contributed mostly by its phenolic compounds [–].Fractions rom ethanolic and aqueous extract demonstratedgastroprotective effect by inhibiting ulcer lesions in stomachwall o ethanol-induced gastric ulcer in rats [, ]. Antimi-crobial activities against several strains o bacteria wereshown and moderate antiprolierative effect was observedin human cervical carcinoma (HeLa) cell line with IC50o approximately g/mL with ethanolic extract []. Nocytotoxicity was seen in normal human lung broblast cellline (HsLu) that was exposed to aqueous and ethanolicextracts []. Determination o acute and subacute oral toxic-ities o aqueous extract in Wistar rats at the highest dose gaveno signicant changes in ood and water intake, behavior,blood chemistry, hematology parameters, and neurologicalassessment [].

Te present study was undertaken to assess the antipro-lierative activity and antioxidant capacity o P. minus and toexamine mechanism(s) o action o the most active raction.Tis involved identication o the most bioactive crude

extract in terms o high antioxidant activity and potentantiprolierative activity. Tis crude extract was urther sub-

jected to chromatographic ractionation and retested. Teraction with smallest IC

50 in antiprolierative assay using

HepG cells was assessed or apoptosis induction by lookingat cell cycle arrest and expression o several apoptotic-relatedgenes.

2. Materials

.. Chemicals. Petroleum ether, methanol, hexane, andethyl acetate were purchased rom Fisher Scientic, USA.Silica gel PF

254 was procured rom Merck, Germany.

Folin-Ciocalteu reagent, ,-diphenyl--picrylhydrazyl, Mpowder, ,,-tris(-pyridyl)-s-triazine, sodium carbonate,copper sulate, sodium chloride, sodium potassium tartrate,phosphate buffered saline pH . (PBS), and gallic acidwere acquired rom Sigma, USA. Annexin-V and propidiumiodide (PI) were obtained rom Becton Dickinson, USA.

otal RNA Isolation kit and UNEL assay kit were boughtrom Promega, USA. All primers were synthesized by Beacondesigner, Premier Biosof International.

.. Plant Material. Plant material was procured in SeriKembangan, Selangor, Malaysia. Plant was identied by DrShamsul Khamis, Institute o Bioscience, University PutraMalaysia, and a voucher specimen SK / was depositedat the herbarium o Atta-ur-Rahman Research Institute o Natural Products (AURiND UiM).

3. Methods

.. Study Design. Te ow chart o the study is shown inFigure .

.. Extraction and Fractionation. Leaves were manually picked rom stems. Fresh leaves o P. minus were dried atroom temperature or h and subjected to ∘C oven or aweek to dry completely. Dried leaveswere choppednely intopowder orm using a commercial grinder or min. Plantpowder was soaked in several organic solvents petroleumether, methanol (MeOH), ethyl acetate (EtOAc), and wateror up to h in a ratio o : w/v as per methodsdescribed earlier []. Te extract was ltered using lterpaper Whatman number beore being dried at reduced

pressure in rotary evaporator (Büchi, Switzerland) to give agreen colored extract. Vacuum liquid chromatography (VLC)method was employed to separate the most bioactive crudeextract. Silica gel PF

254 was packed into the VLC column

(10 cm × 10 cm) and washed with hexane until ully packed.Te crude extract ( g) was dissolved in ethyl acetate andpreabsorbed onto silica gel . Te column was then elutedvia gradient elution with a combination o hexane and ethylacetate in a ratio . : .. Te yield was collected into smallbottles and pooled based on thin layer chromatography (LC) pattern.

.. Phytochemical Screening. Extract ( mg) was dissolvedin mL o MeOH andltered.Filtrate ( mL) was transerredinto two test tubes and a ew drops o concentrated HCl wereadded. o test or avonoids, the rst tube was shaken or min, and a piece o magnesium powder was then added.A positive result was indicated by a change in color o thesample to red. Te second tube was shaken or min anda ew drops o Mayer’s reagent were added. Formation o ayellow-cream precipitate showed presence o alkaloids. odetect presence o saponins in extract, mg o extract wasmixed with mL distilled water (dH

2O) in a test tube which

was then shaken vigorously. Formation o a stable roth or atleast min indicated presence o saponins.


3/13


Annexin-VFITC/PI

Cell cycle analysis P53

Tunnel assay Caspase-3

Air dried P. minus leaves

Cold maceration 24–72 h

(solvents: pet. ether; methanol; ethyl acetate; water)

Pet. ether extract Methanol extract Ethyl acetate extract Water extract

Phytochemical screening, antiproliferative assay (MTT), and antioxidant assay (TPC, FRAP, and DPPH)

Ethyl acetate (bioactive extract)

Vacuum liquid chromatography

F1 F2 F3 F4 F5 F6 F7

Seven fractions

MTT, TPC, FRAP, and DPPH

F7 (bioactive fraction)

Apoptosis Apoptotic mechanism

BCl2 and Bax

F : Flowchart o study.

.. Determination of Antioxidant Capacity

... otal Phenolic Content Assay. otal phenolic content(PC) was measured using procedures described earlier[]. Gallic acid was used as standard against which PC

o every raction was compared. Sodium carbonate, coppersulate, and sodium potassium tartrate in the ratio o : : was mixed well and prepared resh beore experiment. Temixture was pipetted into tubes containing test sample orstandard and lef or min. Afer this time, a mixture o Folin-Ciocalteu reagent and water ( : ) was added whilst

vortexing. Te mixture was allowed to stand at roomtemperature or min in the dark. Absorbance was readspectrophotometrically at nm.

... DPPH Scavenging Assay. Principle o this assay is todetect ability o test sample to reduce DPPH ree radicals.Method o [] was used. DPPH was dissolved in ethanol %

and mixed with HEPES buffer and .% NaCl in mL dH2

Oand adjusted to pH .. est sample was dissolved in MeOH.Sample ( L) was added to L o ice cold DPPH solutionand allowed to stand at room temperature or min. estsample was then transerred to clear and transparent -

well plates and was read using a microplate reader (Sunrise,ecan, Switzerland) at nm. Percent scavenging effect wascalculated using the ormula:

% scavenging effect = (Ac − As/Ac) × 100, ()

where Ac is absorbance o control and As is absorbance o sample.

... Ferric Reducing Antioxidant Power (FRAP) Assay.Antioxidant activity was measured using a modied FRAPassay method []. FRAP values were obtained by comparingthe absorbance change at nm in test reaction mixtureswith those containing errous ions in known concentration.


4/13


Sodium acetate ( mM), pH . in L dH2O, mM o

,,-tris(-pyridyl)-s-triazine (PZ) in mL o mMHCL, and mM erric chloride were combined in a ratioo : : (v/v/v) resh prior to experiment. est samples( L) were mixed with mL o FRAP reagent and allowedto stand at room temperature or min beore reading the

absorbance spectrophotometrically at nm. Te FRAP value was expressed as mol Fe (II)/mg dry weight o extract.FeSO

4 ( mM) was used to construct a standard curve.

.. Antiproliferative Activity

... M Assay. M assay was perormed as previously described []. Crude extract was dissolved in % dimethylsuloxide (DMSO) andpreparedreshprior to assay. Cells (2×

104/well) were plated in -well plate and incubated at ∘Cor h. Next day, cells were treated with the crude extractin DMSO (


5/13


: Antioxidant activities o our crude extracts o P. minus.

Crude extract PC

(mg GAE/g extract)DPPH scavenging

activity (EC) (g/mL)FRAP value (mol Fe (II)/mg

dry weight extract)

Pet. Ether . ± .a . ± .a . ± .a

MeOH . ± .b ± .b . ± .b

EtOAc ± .

c

. ± .

c

. ± .

c

Water . ± .b . ± .b . ± .b

Values are mean ± S.D ( = 3). Values with different alphabets in the same column are signicantly different ( < 0.05, ANOVA and Bonerroni test). GAE:gallic acid equivalents.

: Antioxidant activities o ractions isolated rom EtOAc crude extract o P. minus.

EtOAc ractions PC

(mg GAE/g extract)DPPH scavenging

activity (EC) (g/mL)FRAP value (mol Fe (II)/mg

dry weight extract)

F ND > mg/mL ND

F . ± .a ± .a . ± .a

F . ± .a . ± .b . ± .b

F . ± .b . ± .c . ± .c

F . ± .c

. ± .d

. ± .d

F ± .d . ± .e . ± .e

F . ± .e . ± . . ± .

rolox ± .d ND ND

Chlorogenic acid ND . ± .g ND

Ascorbic acid ND ND . ± .g

Values are mean ± S.D ( = 3). Values with different alphabets in the same column are signicantly different (P < ., ANOVA and B onerroni test). GAE:gallic acid equivalents. ND: not determined.

: Qualitative analysis o phytochemicals o P. minus.

Phytochemical test Extract o P. minus

Pet. ether EtOAc MeOH WaterFlavonoids − +++ + +

Alkaloids − +++ − −

Saponins ++ ++ − +++

Remarks: +++: high intensity; ++: moderate intensity; +: less intensity; −:absent.

.. Phytochemical Screening. PC o the our crude extractswas determined rom a linear gallic acid standard curve ( =

0.005 + 0.132, 2 = 0.982) (able ). Tere was a signicantdifference ( < 0.05) in PC among the extracts with EtOAcextract exhibiting the highest PC. Tis indicates that EtOAc

was the best solvent to extract phenolic components rom thisplant. Similar ndings were reported by [–]. Qualitativeanalysis o P. minus crude extracts also pointed to highamounts o avonoids, a polyphenol group, in EtOAc extract(able ). Subsequent ractionation o EtOAc crude extractyielded ractions (able ). O these, F had the highestPC value, higher even than that o rolox, a vitamin Eanalogue. Fractionation using solvent elution rom nonpolarsolvent (hexane) to more polar solvent (EtOAc) yieldedractions with different chemical constituents. PC contento each o these ractions was signicantly smaller than thato crude extract suggesting that the phenolic componentswere separated based on their polarity. Sum o PC o these

ractions was larger than that o EtOAc crude extract pointingto possible interactions between chemicals in crude extractswhich resulted in attenuation o itsreducing power which was

the main principle o the PC assay [].DPPH assay results were presented as concentration o

extract which scavenged % o DPPH radicals (EC50

).EtOAc extract showed lowest EC

50 o 120.3 ± 2.7 g/mL

in DPPH assay (able ). MeOH and water crude extractsshowed large EC

50 values while petroleum ether extract

showed the weakest DPPH scavenging activity. O the rac-tions, EC

50 or DPPH scavenging by F was the lowest at

30.5 ± 3.2 g/mL (able ). EC50

or F was only . timesthat o chlorogenic acid which had an EC

50 o 20±2.8g/mL.

Results rom DPPH assay showed scavenging activity o theractions in descending order as F7 > F6 > F5 > F4 >F3 > F2 > F1. DPPH assay results correlated well with PC

( = 0.904, < 0.01). Purication and concentration o polyphenolic compounds must have occurred with increasein polarity o extraction solvents that were used during theractionation procedures as previously reported [, ].

FRAP assay determines the reducing power o test com-pounds. Te assay depends on reduction o erric tripyridyl-triazine complex (Fe (III)-PZ) to errous tripyridyltriazine(Fe (II)-PZ) by a reductant at low pH. FRAP value orEtOAc extract was the highest amongst the crude extracts at2435.21 ± 28.9 mol Fe (II)/mg dry weight extract (able ).Afer ractionation, FRAP values o F to F were in therange o 147.53 ± 8.4 to 1169.1 ± 20.3 mol Fe (II)/mg dry weight extract (able ). Sum o FRAP values o F to F was


6/13


: IC values o P. minus extracts on different cell lines afer h o incubation.

Crude extract HepG WRL HeLA HC MCF- Chang

IC (g/mL)

Pet. ether >a . ± .c . ± .b . ± .d >a >a

EtOAc . ± .b . ± .b . ± .c . ± .b >a . ± .b

MeOH >a

>a

± .d

. ± .c

>a

>a

Water >a >a >a >a >a >a

HepG cells ( × /well) were incubated with crude extracts o P. minus or h at ∘C. Results are mean ± S.D ( = 3). Values with different alphabets inthe same column are signicantly different (P < ., ANOVA and Bonerroni test).

mol Fe (II)/mg dry weight extract. Tis was not muchdifferent rom FRAP value o crude EtOAc extract. Eacho ractions to possibly contributed to total antioxidantcapacity shown by the crude EtOAc extract. ripathi etal. showed that antioxidant compounds in an extract show synergistic effect in their investigations on effect o crudeor total extract and their ractions in inammation iNOSsignaling cascade []. FRAP values o P. minus ractionswere linearly correlated to PC (FRAP versus PC, =0.83, < 0.05). Since EtOAc typically extracts polyphenoliccompounds [], F most probably contains polyphenolswith high antioxidant capacity since polyphenols act aselectron donors to stabilize ree radicals []. Plant extractsthat contained high concentrations o phenolics demonstratehigh antioxidant effects in vitro []. Vitamin E, tocotrienols,tocopherols, and ascorbic acid may also contribute to antiox-idant capacity as well as to the synergistic effect among thecompounds []. EtOAc crude extract by qualitative analysisshowed presence o high amounts o avonoids which wouldact as reductants in PC and FRAP assays and as scavengersin DPPH assay. Since saponins do not contribute to FRAP

values [], water extract o P. minus which showed highcontent o saponins in qualitative assay had low FRAP valuewhen compared to EtOAc extract.

.. Antiproliferative Activity. Antiprolierative effects o P.minus crude extracts on selected cancer and normal cell lineswere determined (able ). O the crude extracts, EtOAcextract had the lowest IC

50 o 32.25 ± 3.72 g/mL towards

HepG with little cytotoxicity towards normal embryonicliver cells (WRL) or normal Chang liver cells. IC

50 values

o EtOAc crude extract towards these latter two normal livercell lines were 122.38 ± 20.84 and 285.72 ± 59.8g/mL,respectively. Colon cancer cells (HC ) and mammary

cancer cells (MCF-) were not much affected by EtOAcextract although there were moderate effects against cer-

vical cancer cell line (HeLA). MeOH extract o P. minusalso showed moderate antiprolierative effects against HC although it was ineffective against the other cell lines.Petroleum ether extract was cytotoxic in WRL with IC

50 o

56.23±3.2 g/mL but hasno antiprolierative effects in cancercell lines. Crude water extract had no antiprolierative effecton cancer cell lines and no cytotoxicity in normal cell lines(IC

50 > 250 g/mL in all cases). Tis nding o water extract

being noncytotoxic is important as it provides evidence thatthe herb is sae when added to certain Malay oods duringtheir preparation.

: IC values o different ractions rom EtOAc extract o P.minus on HepG cell line.

Fractions IC (g/mL)

F ND

F . ± .a

F . ± .b

F . ± .a

F . ± .b

F . ± .a

F . ± .c

HepG cells ( × /well) were incubated with P. minus ractions or hat ∘C. Results are mean ± S.D. ( = 3). Values with different alphabetsare signicantly different (P < ., ANOVA and Bonerroni test). ND: notdetermined.

Our data show that EtOAc crude extract has selectiveantiprolierative effect on HepG with little cytotoxicity onnormal liver cells. Tis is important as selectivity o extracttowards cancer cells without effect on normal cells is crucialto ensure that nontarget cells are not affected by treatment soas to gain optimal therapeutic effects with minimal adverseeffects. Similar views are abundant in the literature [, ].Te bioactive compounds in EtOAc crude extract inhibitedprolieration o HepG cells. Tis extract was thus raction-ated or urther biological investigations on P. minus. Frac-tions o EtOAc extract displayed better antiprolierative activ-ity than the crude extract (able ). F exhibited the smallestIC

50 o 25.75 ± 1.5g/mL towards HepG cells compared

to the other ractions. F also showed the highest antioxi-dant capacity in PC, FRAP, and DPPH assays. Qualitativeanalysis o EtOAc crude extract rom which F was obtained

showed it to be high in avonoids, alkaloids, and saponins;these groups o compounds most probably contributed toantiprolierative effects o F. In many reports, avonoidswere shown to selectively kill cancer cells which requently have higher levels o ROS than normal cells []. Consistently elevated levels o ROS activate an adaptive stress responsewhich enables cancer cells to survive in high ROS ambienceto maintain cellular viability []. Flavonoids are knownas effective scavengers o ROS and are able to modulateproteins that are involved in cell prolieration mainly throughregulation o the cell cycle []. In addition, avonoids wereable to induce apoptotic death in many cancer cells andact as antiangiogenic agents []. As example, luteolin, a


7/13


a

a a

b

c

b

c

cc

c

e

a

0

5

10

15

20

25

30

35

24 48 72

E a r l y a p o p t o s i s ( % )

Time (hour)

Untreated control

18g/mL

32g/mL

100g/mL

F : Early apoptosis in HepG cells exposed to EtOAc crudeextract o P. minus. HepG cells (1 × 106/well) were incubated withEtOAc crudeextract o P. minus (– g/mL)or differentperiods(,, and h) at∘C. Apoptosis was detected by ow cytometry using annexin-V and FIC. Results are mean ± S.D. ( = 3).Values with different alphabets are signicantly different ( < 0.05,ANOVA and Bonerroni test).

common avonoid in plants, was ound to arrest the cellcycle at G

1 phase in human gastric, prostate, and melanoma

cancer cells and was an apoptotic inducer at both intrinsicand extrinsic pathways. Luteolin exhibited antiangiogenesiseffect by suppressing vascular endothelial growth actor

and matrix metalloproteases and was antimetastasis throughinhibition o tumor necrosis actor and interleukin- whichregulate cell migration andmetastasis []. Besides exhibitingsimilar mechanisms o action as avonoids, alkaloids andsaponins may also contribute to antiprolierative effects by inducing cell cancer autophagy and antimultidrug resistanceand antimitotic effect []. Existing data on concomitant useo antioxidant compounds and chemotherapy showed thatantioxidant supplementation led to improvement in treat-ment outcomes, increased survival times, increased tumorresponse, and reduced toxicity []. However, some studiesalso showed no signicant improvements in treatment out-comes that could be attributed to use o insufficient antiox-

idant doses []. Chemotherapeutic drugs like doxorubicinand vinorelbine work via mechanisms that involve inductiono apoptosis in cancer cells through ROS-mediated oxidativestress [, ]. For these types o drugs, concomitant sup-plementation with antioxidants during cancer chemotherapy may lead to diminished anticancer effects. However, no trialshave reported signicant reductions in treatment efficacy with antioxidant supplementation, suggesting no evidence o antioxidants interering with chemotherapy [, ].

.. Apoptosis Induction by EtOAcExtract and F of P. minusinHepG Cells. Mode o cell death induced by F wasexaminedvia detection o translocation o phosphatidylserine into

a a aa

bb

a

c

c

a

d

e

0

10

20

30

40

50

60

70

80

90

100

24 48 72

E a r l y a p o p t o s i s ( % )

Time (hour)

Untreated control

12.5 g/mL

25 g/mL

37.5 g/mL

F : Percentage o HepG cells in early apoptosis uponexposure toF o P. minus. HepG cells (1×106/well)wereincubatedwith F o P. minus (.–. g/mL) or different periods (, ,

and h) at ∘

C. Apoptosis was detected by ow cytometry usingannexin V-FIC. Results are mean ± S.D ( = 3). Values withdifferentalphabets are signicantly different( < 0.05, ANOVA andBonerroni test).

outer cell membrane. Tis is a hallmark event or early apop-tosis whereby cancer cells will emit the signal to surroundingmacrophages to initiate autophagy []. EtOAc crude extractelicited a signicant increase in percentage o HepG cellsin early apoptosis (Figure ). Lowest concentration o EtOAccrude extract ( g/mL) showed time-dependent increase inpercentage o cells undergoing early apoptosis. Exposure to h produced about % increase. Afer h o exposure,maximal increase to nearly % was seen, but afer h,percentage o cells in early apoptosis had dropped signi-cantly to less than %. A higher concentration ( g/mL)o EtOAc crude extract increased percentage o cells inearly apoptosis by between and % starting rom ho incubation; however no urther increase was seen atlonger incubation times. Highest concentration o EtOAccrude extract ( g/mL) produced maximal increase inpercentage o cells in early apoptosis by h. By h, thepercentage had dropped signicantly to about %. A urthersignicant decrease in percentage o cells in early apoptosiswas seen at h. reatment o HepG cells with F also

produced similar effects (Figure ). A shorter incubationperiod o h with F (.–. g/mL) did not affect thecell population in early apoptosis. At h, a concentration-dependent increase in percentage o cells in early apoptosiswas seen. Highest concentration o F (. g/mL) inducednearly % o cells to undergo apoptosis. Tis effect wasinversely dependent on incubation time as percentage o cells undergoing early apoptosis decreased to approximately % afer h. With a longer period o incubation, HepGcells shifed rom a situation o having maximum viability toentering early apoptosis and then to late-stage apoptosis andnecrosis (Figure ). Population o cells undergoing apoptosisupon exposure to F at its IC

50, at h, was smaller than at


8/13


: Gene name, base pair (b.p) size, and orward and reverse primer sequences that were used in the real time PCR experiment.

Gene name b.p Forward primer Reverse primer

NM . ( Actb) AGGGGGAGGGCAG CAAGCCGGCAAGG

NM . (Bcl) CCACCAAGAAAGCAGGAAACC GGCAGGAAGCAGCACAGG

NM . (Casp) CGGACGGGCAGAGAC ACAAAGCGACGGAGAACC

NM . ( p) AGAACGAGGAGACGGAAAGG CAAGACCGACGAGGAACC

NM . (Bax ) CAGAGGGCAAAGC CAACAAGCAAGGCAC

Annexin V-FITC

P I

Control

100

101

102

103

104

100 101 102 103 104

(a)

Annexin V-FITC

24 h

P I

100

101

102

103

104

100 101 102 103 104

(b)

Annexin V-FITC

48 h

P I

100

101

102

103

104

100 101 102 103 104

(c)

Annexin V-FITC

72 h

P I

100

101

102

103

104

100 101 102 103 104

(d)

F : Histogram o annexin-V andFIC/PI ow cytometry o HepG cells exposed to F. HepGcells (1×106/well) were incubatedwithFo P. minus ( g/mL, equivalent to IC

50) or (a) control or (b) , (c) and (d) h at∘C. Lower lef quadrant in each panel represents

viable cells which excluded PI and were negative or annexin V-FIC binding. Upper right quadrant contains nonviable, necrotic cells or latestage apoptotic cells, positive or annexin V-FIC/PI uptake. Lower right quadrant contains early apoptotic cells, annexin V-FIC positiveand PI negative. One experiment is representative o three independent experiments.

h. Conversely, late apoptotic/necrotic cell population washigher at h than at h. Tese results show that at h,F had induced necrotic cell death rather than apoptotic celldeath. A range o stimuli such as radiation, hypoxia, heat,and cytotoxic compounds induce apoptosis at low concen-trations but higher concentrations o these stimuli can resultin necrosis []. Tree types o cellular response to plantextracts have been proposed []. Mild exposure may causemild oxidative stress that ignites cellular antioxidant deensesystems; exposure to moderate to higher concentrations may gradually overwhelm antioxidant deense systems to induceapoptosis, while exposure to even higher concentrations orlong periods may quickly overwhelm antioxidant deensesto stimulate prooxidative effects leading to cellular damagevia necrosis. wo actors that transorm an ongoing apop-totic process to a necrotic process are the availability o intracellular AP and o caspases []. Extended exposure

o cells to plant extract may cause loss o mitochondrialmembrane potential and may promote release o cytochrome-c leading to distortion o electron transport and inhibitiono Krebs cycle []. Tis will nally cause depletion in APand rapid generation o ROS which can both cause cell deathwithout involvement o caspases []. Proapoptotic activity o apoptosome is dependent on availability o AP; thusreduction o energy would cause a greater proportion o cells to undergo necrosis rather than apoptosis []. DNAragmentation during apoptosis o HepG cells that weretreated with F (.–. g/mL) or h was visualizedvia UNEL assay using uorescent conocal microscopy (Figure ). Cells that were stained red were viable while

bright green stains indicated apoptotic cell bodies with DNAragmentation.

.. Expression of Genes Related to Apoptosis. Molecularmechanism o apoptosis was investigated using R-PCR by examining expression o key apoptotic-related genes.Primer sequences o the genes are shown in able . Bcl-gene is an antiapoptotic gene; overexpression o this genewould prevent apoptosis while Bax gene is a proapoptoticgene working oppositely. P and caspase- genes are vitalin executing the apoptosis process in cells. Expression o Bax , Bcl-, p, and caspase- genes in HepG cells thatwere treated with F (.–. g/mL) or h is shown inFigure . F induced a concentration-dependent increase inBax expression. Compared to control untreated cell, mRNAexpression o Bax was signicantly elevated by about -oldat highest concentration o F (. g/mL). Te two lower

concentrations o F produced about –.-old increase inBax expression. Similar concentration-dependent increasein expression levels o caspase- and p genes was seenin F-treated cells. Lowest concentration o F signicantly increased caspase- expression rom control. A signicantly greater increase in caspase- expression by about .-old waselicited by the highest concentration o F used. Expressiono p gene was signicantly increased rom control by lowestconcentration o F. Maximal increase in p gene expressionby about -old was elicited by middle concentration o F( g/mL) as no urther increase was seen at . g/mL.In contrast, expression o antiapoptotic gene, Bcl-, wasinhibited in concentration-dependent manner by F. Highest


9/13


Untreated control

(a)

12.5 g/mL

(b)

25g/mL

(c)

37.5g/mL

(d)

F : Fluorescence conocal imaging o UNEL positive staining in HepG cells exposed to F at h. HepG cells (0.5 × 106/well)were treated with F o P. minus (.–. g/mL) or h at ∘C. Red stain shows viable, healthy cells while intense green stain indicatesapoptotic cell with DNA ragmentation. One experiment is representative o three independent experiments.

0

0.5

1

1.5

2

2.5

3

3.5

4

Control 12.5 25 37.5

m R N A e x p r e s s i o n l e v e l ( f o l d )

Concentration of F7 (g/mL)

Bax

Caspase-3

P53Bcl-2

ab

c

d d

d

f f

f

g g

h

F : Effect o F on expression levels o apoptotic-related genes in HepG cells. HepG cells (1 × 1 06/well) were incubated with F o P.minus (.–. g/mL) or h at ∘C. Results are mean ± S.D ( = 3). Values with different alphabets are signicantly different ( < 0.05,ANOVA and Bonerroni test).


10/13


Untreated control 24 h

DNA content

0 10 20 30 40

N u m b e r

0800

1600

2400

3200

4000

6.53% ± 2.56%

52.28% ± 0.88%

S

G0/G1

SubG1

G2/M

30.04% ± 0.92%

17.67% ± 0.87%

DNA content

0800

1600

2400

3200

4000

0 10 20 30 40

24 h: 12.5g/mL

∗

∗

∗5.89% ± 2.74%

65.11% ± 2.13%

S

G0/G1

SubG1

G2/M

24.80% ± 3.35%

10.08% ± 1.25%

24 h: 25g/mL

DNA content

0 10 20 30 40

0

800

1600

2400

3200

4000

∗

∗

6.77% ± 0.92%

50.48% ± 1.94%

S

G0/G1

SubG1

G2/M

38.77% ± 1.48%

10.77% ± 1.62%

24 h: 37.5g/mL

DNA content

0 10 20 30 40

0800

1600

2400

3200

∗

∗

∗6.68% ± 2.55%

35.90% ± 1.69%

S

G0/G1

SubG1

G2/M

38.87% ± 0.82%

25.23% ± 1.08%

(a)

Untreated control 48 h

DNA content

0 10 20 30 40

N u m b e r

0

800

1600

2400

3200

3.60% ± 1.40%

61.82% ± 1.85%

S

G0/G1

SubG1

G2/M

22.92% ± 0.89%

15.27% ± 0.97%

DNA content

0 10 20 30 40

0

800

1600

2400

3200

4000

∗

∗

∗

48 h: 12.5 g/mL

10.01% ± 1.70%

62.44% ± 1.20%

S

G0/G1

SubG1

G2/M

15.16% ± 2.07%

22.41% ± 1.01%

DNA content

0 10 20 30 400

800

1600

2400

3200

∗

∗

∗

48 h: 25g/mL

5.28% ± 2.36%

38.58% ± 1.10%

S

G0/G1

SubG1

G2/M

34.47% ± 1.20%

26.94% ± 0.64%

DNA content

0 10 20 30 40

0

800

1600

2400

3200

48 h: 37.5g/mL

∗

∗

∗25.34% ± 1.20%

30.37% ± 0.28%

∗

S

G0/G1

SubG1

G2/M

52.59% ± 0.33%

17.03% ± 0.49%

(b)

F : Effect o F o P. minus on cell cycle progression in HepG cells. Cells (1×106

/well) were treated with F (.–. g/mL) or (toplane) h or (bottom lane) h at ∘C. Data are representative o three independent experiments. ∗Signicantly different rom untreatedcontrol cells ( < 0.05, ANOVA and Bonerroni test).

concentration o F elicited maximal inhibition in Bcl-expression. Ratio o Bax/Bcl- is crucial at determiningsusceptibility o cells to death signals []. Our resultsshowed F induced apoptosis via upregulation o Bax, p,and caspase- genes and downregulation o Bcl- gene.Activation o p stimulates release o cytochrome-c rommitochondria []. Consequently, apoptosome complex isormed to urtherinitiateeffector caspases, including caspase-, to execute the apoptosis process. Release o mitochondria

apoptogenic actors is controlled by Bax and Bcl- geneswhich either induced or suppress permeabilization o outermitochondrial membrane []. Similar observations werereported in determination o antiprolierative effect o Juglanregia L. by assessment o apoptotic related genes [].

.. Cell Cycle Arrest by F. reatment o HepG cells with F(., , and . g/mL) or and h resulted in signi-cant accumulation o cells at S-phase as compared to controluntreated cells (Figure ). Te effect was concentration-and time-dependent. Afer h o incubation with or. g/mL F, cell population at S-phase was increased com-pared to control whileG

2/M cell population was increased by

the highest concentration o F. Tis showed that F delayedcell progression through S-phase, earlier than G

2/M phase,

thus restricting cells rom entering G0/G

1 phase. Sub-G

1 cell

population afer treatment with F at h was not altered.Following h o incubation, highest concentration o Fincreased Sub-G

1 and S-phase populations to approximately

25.34 ± 1.20% and 52.59 ± 0.33%, respectively, while G2/M

phase was decreased to 17.03 ± 0.49%. Sub-G1

phase isa hallmark o apoptosis []; thereore these ndings are

consistent with ow cytometry measurements o apoptosis inHepG cells treated with F. p also plays an important rolein executing cell cycle arrest []. During S-phase, cellularDNA is replicated precisely and accurately to prevent geneticabnormalities which could lead to mutations or cell death []and p is responsible or regulation o certain proteins whichare related to cell cycle checkpoint.

5. Conclusion

In summary, P. minus as ethyl acetate crude extract or itsraction, F, showed high antioxidant capacity and selec-tive antiprolierative activity against HepG cells. Te high


11/13


antioxidant capacity o this herb is probably attributed toits polyphenolic content. Antiprolierative effect o F wasdirectly correlated to its antioxidant capacity. Flow cytometry analyses and gene expression studies in F-exposed HepGcells provided evidence that F induced apoptosis in time-and concentration-dependent manner through upregulation

o proapoptotic genes and downregulation o antiapoptoticgene. F was antiprolierative towards HepG cells via inhi-bition o the cell cycle at S-phase. Continuing work to identiy the compounds in F that are responsible or these activitiesis in progress in our laboratory. We are also looking at effectso F on a cancer model in vivo.

Conflict of Interests

Te authors declare that there is no conict o interests.

Acknowledgments

Tis work was supported by MOSI -IRDC/BIOEK//(/) through a research Grant held by Universitieknologi MARA. Mohd Alazari Mohd Ghazali is supportedby a ellowship rom USM. Te authors wish to thank Faculty o Pharmacy, UiM, or support and acilities.

References

[] J. M. Brown and L. D. Attardi, “Te role o apoptosis in cancerdevelopment and treatment response,” Nature Reviews Cancer , vol. , no. , pp. –, .

[] V. Jendrossek, “Te intrinsic apoptosis pathways as a target inanticancer therapy,” Current Pharmaceutical Biotechnology , vol.

, no. , pp. –, .[] G. Waris and H. Ahsan, “Reactive oxygen species: role in the

development o cancer and various chronic conditions,” Journal of Carcinogenesis, vol. , article , .

[] U. Gawlik-Dziki, M. Swieca, M. Sulkowski, D. Dziki, B. Bara-niak, and J. Czyz, “Antioxidant and anticancer activities o Chenopodium quinoa leaves extracts—in vitro study,” Food and Chemical oxicology , vol. , pp. –, .

[] M. Maizura, A. Aminah, and W. M. W. Aida, “ otal phenoliccontent and antioxidant activity o kesum (Polygonum minus),ginger (Zingiber officinale) and turmeric (Curcuma longa)extract,” International Food Research Journal , vol. , no. , p., .

[] A. A. Azlim Almey, C. Ahmed Jalal Khan, I. Syed Zahir, K.Mustapha Suleiman, M. R. Aisyah, and K. Kamarul Rahim,“otal phenolic content and primary antioxidant activity o methanolic and ethanolic extracts o aromatic plants’ leaves,”International Food ResearchJournal , vol. , no. , pp. –,.

[] Y. Sumazian,A. Syahida,M. Hakiman, andM. Maziah, “Antiox-idant activities, avonoids, ascorbic acid and phenolic contentso Malaysian vegetables,” Journal of Medicinal Plant Research, vol. , no. , pp. –, .

[] N. Huda-Faujan, A. Noriham, A. S. Norrakiah, and A. S. Babji,“Antioxidant activity o plants methanolic extracts containingphenolic compounds,” African Journal of Biotechnology , vol. ,no. , pp. –, .

[] N. Huda-Faujan, A. Noriham, A. S. Norrakiah, and A. S. Babji,“Antioxidative activities o water extracts o some Malaysianherbs,” ASEAN Food Journal , vol. , no. , pp. –, .

[] S. W. Qader, M. A. Abdulla, L. S. Chua, H. M. Sirat, andS. Hamdan, “Pharmacological mechanisms underlying gastro-protective activities o the ractions obtained rom Polygonumminus in sprague dawley rats,” International Journal of Molecu-lar Sciences, vol. , no. , pp. –, .

[] S. Q. Wasman, A. A. Mahmood, H. Salehhuddin, A. A. Zahra,and I. Salmah, “Cytoprotective activities o Polygonum minusaqueous lea extract on ethanol-induced gastric ulcer in rats,” Journal of Medicinal Plant Research, vol. , no. , pp. –, .

[] M. M. Mackeen, A. M. Ali, S. H. El-Sharkawy et al., “Antimi-crobial and cytotoxic properties o some Malaysian traditional vegetables (ULAM),” Pharmaceutical Biology , vol. , no. , pp.–, .

[] S. W. Qader, M. A. Abdulla, L. S. Chua, N. Najim, M. M.Zain, and S. Hamdan, “Antioxidant, total phenolic content andcytotoxicity evaluation o selected Malaysian plants,” Molecules,

vol. , no. , pp. –, .[] Y. K. Ming, N. B. . Zulkawi, C. Vandana Kotak, and Y. K.

Choudhary, “Acute and sub-acute oral toxicity o Polygonumminus aqueous extract (biotropics PM) in wistar rats,”International Journal of Pharmacy and Pharmaceutical Sciences, vol. , no. , pp. –, .

[] Z. A. Zakaria, A. M. Mohamed, N. S. M. Jamil et al., “In vitrocytotoxic and antioxidantproperties o the aqueous,chloroormand methanol extracts o dicranopteris linearis leaves,” African Journal of Biotechnology , vol. , no. , pp. –, .

[] M. H. Johnson and E. Gonzalez de Mejia, “Comparison o chemical composition and antioxidant capacity o commer-cially available blueberry and blackberry wines in Illinois,” Journal of Food Science, vol. , no. , pp. C–C, .

[] S. Gorinstein, O. Martin-Belloso, E. Katrich et al., “Comparisono the contents o the main biochemical compounds and theantioxidant activity o some Spanish olive oils as determinedby our different radical scavenging tests,” Journal of Nutritional Biochemistry , vol. , no. , pp. –, .

[] O. Erel, “A novel automated direct measurement method ortotal antioxidant capacity using a new generation, more stableABS radical cation,” Clinical Biochemistry , vol. , no. , pp.–, .

[] M. Carvalho, G. Hawksworth, N. Milhazes et al., “Role o metabolites in MDMA (ecstasy)-induced nephrotoxicity: an invitro study using rat and human renal proximal tubular cells,” Archives of oxicology , vol. , no. , pp. –, .

[] N. Armania, L. S. Yazan, S. N. Musa et al., “Dillenia suffruticosaexhibited antioxidant and cytotoxic activity through inductiono apoptosis and G/M cell cycle arrest,” Journal of Ethnophar-macology , vol. , no. , pp. –, .

[] J. Nestorov, G. Matic, I. Elakovic, and N. anic, “Gene expres-sion studies: How to obtain accurate and reliable data by quan-titative real-time R PCR,” Journal of Medical Biochemistry , vol., no. , pp. –, .

[] K. S. Sim, A. M. Sri Nurestri, and A. W. Norhanom, “Phenoliccontent and antioxidant activity o Pereskia grandifolia Haw.(Cactaceae) extracts,” Pharmacognosy Magazine, vol. , no. ,pp. –, .

[] F. Al-Juhaimi, C. Saglam, and M. M. Ozcan, “Antioxidantproperties and total phenolic content o two solvent extraction


12/13


extracts o some plants belong to labiatae amily,” Asian Journal of Chemistry , vol. , no. , pp. –, .

[] W. Kusirisin, S. Srichairatanakool, P. Lerttrakarnnon et al.,“Antioxidative activity, polyphenolic content and anti-glycationeffect o some Tai medicinal plants traditionally used indiabetic patients,” MedicinalChemistry , vol. , no. , pp. –,.

[] S. Sannigrahi, U. K. Mazuder, D. K. Pal, S. Parida, and S. Jain,“Antioxidant potential o crude extract and different ractionso Enhydra uctuans Lour,” Iranian Journal of Pharmaceutical Research, vol. , no. , pp. –, .

[] N. Grujic, Z. Lepojevic, B. Srdjenovic, J. Vladic, and J. Sudji,“Effects o different extraction methods and conditions on thephenolic composition o mate tea extracts,” Molecules, vol. ,no. , pp. –, .

[] Y. B. ripathi, A. P. Chaturvedi, andN. Pandey, “Effect o Nigellasativa seeds extracts on iNOS through antioxidant potentialonly: crude/total extract as molecular therapy drug,” Indian Journal of Experimental Biology , vol. ,no., pp. –, .

[] C.-Y. Liu, Y.-C. Lin, J.-S. Deng, J.-C. Liao, W.-H. Peng, and G.-

J. Huang, “Antioxidant, anti-inammatory, and antiprolierativeactivities o axillus sutchuenensis,” American Journal of Chinese Medicine, vol. , no. , pp. –, .

[] K. N. Prasad, L. Y. Chew, H. E. Khoo, K. W. Kong, A. Azlan,and A. Ismail, “Antioxidant capacities o peel, pulp, and seedractions o Canarium odontophyllum Miq. ruit,” Journal of Biomedicine and Biotechnology , vol. , Article ID , pages, .

[] S. Shukla, A. Mehta, P. Mehta, and V. K. Bajpai, “Antioxidantability and total phenolic content o aqueous lea extract o Ste-via rebaudiana Bert,” Experimental and oxicologic Pathology , vol. , no. -, pp. –, .

[] N. Babbar, H. S. Oberoi, D. S. Uppal, and R. . Patil, “otalphenolic content and antioxidant capacity o extracts obtained

rom six important ruit residues,” Food Research International , vol. , no. , pp. –, .

[] B. B. Misra and S. Dey, “Comparative phytochemical analysisand antibacterial efficacy o in vitro and in vivo extracts romEast Indian sandalwood tree (Santalum album L.),” Letters in Applied Microbiology , vol. , no. , pp. –, .

[] R. Hadh, A. Abdulamir, F. Bakar, F. Jalilian, F. Abas, andZ. Sekawi, “Novel molecular, cytotoxical, and immunologicalstudy on promising and selective anticancer activity o Mungbean sprouts,” BMC Complementary and Alternative Medicine, vol. , article , .

[] M. Paydar, Y. L. Wong, B. A. Moharam, W. F. Wong, andC. Y. Looi, “In vitro anti-oxidant and anti-cancer activity o

methanolic extract rom Sanchezia speciosa leaves,” Pakistan Journal of Biological Sciences, vol. , no. , pp. –, .

[] . P. Szatrowski and C. F. Nathan, “Production o large amountso hydrogen peroxide by human tumor cells,” Cancer Research, vol. , no. , pp. –, .

[] L. Gibellini, M. Pinti, M. Nasi et al., “Interering with ROSmetabolism in cancer cells: the potential role o quercetin,”Cancers, vol. , no. , pp. –, .

[] K. Bishayee, S. Ghosh, A. Mukherjee, R. Sadhukhan, J. Mondal,and A. R. Khuda-Bukhsh, “Quercetin induces cytochrome-crelease and ROS accumulation to promote apoptosis and arrestthecell cycle in G/M, in cervical carcinoma: signalcascade anddrug-DNA interaction,” Cell Proliferation, vol. , no. ,pp. –, .

[] H. Luo, G. O. Rankin, L. Liu, M. K. Daddysman, B.-H. Jiang,and Y. C. Chen, “Kaemperol inhibits angiogenesis and VEGFexpression through both HIF dependent and independentpathways in human ovarian cancer cells,” Nutrition and Cancer , vol. , no. , pp. –, .

[] Y. Lin, R. Shi, X. Wang, and H.-M. Shen, “Luteolin, a avonoidwith potential or cancer prevention and therapy,” Current

Cancer Drug argets, vol. , no. , pp. –, .

[] C. V. Rao, C. D. Kurkjian, and H. Y. Yamada, “Mitosis-targetingnatural products or cancer prevention and therapy,” Current Drug argets, vol. , no. , pp. –, .

[] C. B. Simone II, N. L. Simone, V. Simone, and C. B.Simone, “Antioxidants and other nutrients do not interere withchemotherapy or radiation therapy and can increase kill andincrease survival, part ,” Alternative Terapies in Health and Medicine, vol. , no. , pp. –, .

[] A. K. Pathak, M. Bhutani, R. Guleria et al., “Chemotherapy alone vs. chemotherapy plus high dose multiple antioxidants inpatients with advanced non small cell lung cancer,” Journal of the American College of Nutrition, vol. , no. , pp. –, .

[] W.-H. Chiu, S.-J. Luo, C.-L. Chen et al., “Vinca alkaloids causeaberrant ROS-mediated JNK activation, Mcl- downregulation,DNA damage, mitochondrial dysunction, and apoptosis inlung adenocarcinoma cells,” Biochemical Pharmacology , vol. ,no. , pp. –, .

[] A. Rogalska, A. Gajek, M. Szwed, Z. Jóźwiak, and A. Marczak,“Te role o reactive oxygen species in WP -induced deatho human ovarian cancer cells: a comparison with the effect o doxorubicin,” oxicology in Vitro, vol. , no. , pp. –,.

[] K. I. Block, A. C. Koch, M. N. Mead, P. K. othy, R. A. Newman,and C. Gyllenhaal, “Impact o antioxidant supplementation onchemotherapeutic efficacy: a systematic review o the evidencerom randomized controlled trials,” Cancer reatment Reviews,

vol. , no. , pp. –, .[] K. Balasubramanian, B. Mirnikjoo, and A. J. Schroit, “Regulatedexternalization o phosphatidylserine at the cell surace: impli-cations or apoptosis,” Te Journal of Biological Chemistry , vol., no. , pp. –, .

[] S. Elmore, “Apoptosis: a review o programmed cell death,”oxicologic Pathology , vol. , no. , pp. –, .

[] H. Babich, A. G. Schuck, J.H. Weisburg, andH. L. Zuckerbraun,“Research strategies in the study o the pro-oxidant natureo polyphenol nutraceuticals,” Journal of oxicology , vol. ,Article ID , pages, .

[] M. Leist, B. Single, A. F. Castoldi, S. Kühnle, and P. Nicotera,“Intracellular adenosine triphosphate (AP) concentration: aswitch in the decision between apoptosis and necrosis,” Te

Journal of Experimental Medicine, vol. , no. , pp. –,.

[] J.-L. Vayssière, P. X. Petit, Y. Risler, and B. Mignotte, “Commit-ment to apoptosis is associated with changes in mitochondrialbiogenesis and activity in cell lines conditionally immortalizedwith simian virus ,” Proceedings of the National Academy of Sciences of the United States of America, vol. , no. , pp. –, .

[] C. J. Zeiss, “Te apoptosis-necrosis continuum: insights romgenetically altered mice,” Veterinary Pathology ,vol.,no.,pp.–, .

[] Y. Eguchi, A. Srinivasan, K. J. omaselli, S. Shimizu, and Y. su- jimoto, “AP-dependent steps in apoptotic signal transduction,”Cancer Research, vol. , no. , pp. –, .


13/13


[] I. Marzo and J. Naval, “Bcl- amily members as moleculartargets in cancer therapy,” Biochemical Pharmacology , vol. ,no. , pp. –, .

[] V. Gogvadze, S. Orrenius, and B. Zhivotovsky, “Multiple path-ways o cytochrome c release rom mitochondria in apoptosis,”Biochimica et Biophysica Acta—Bioenergetics, vol. , no. -,pp. –, .

[] M. Schuler and D. R. Green, “Mechanisms o p-dependentapoptosis,” Biochemical Society ransactions, vol. , no. , pp.–, .

[] A. A. Alshatwi, . N. Hasan, G. Sha et al., “Validation o the antiprolierative effects o organic extracts rom the greenhusk o Juglans regia L. on PC- human prostate cancercells by assessment o apoptosis-related genes,” Evidence-Based Complementary and Alternative Medicine, vol. , Article ID, pages, .

[] W. K. Ng, L. S. Yazan, and M. Ismail, “Tymoquinone romNigella sativa was more potent than cisplatin in eliminating o SiHa cells via apoptosis with down-regulation o Bcl- protein,”oxicology in Vitro, vol. , no. , pp. –, .

[] L. Ding, Y. Huang, Q. Du et al., “GEV nucleocapsid proteininduces cell cycle arrest and apoptosis through activation o psignaling,” Biochemical and Biophysical Research Communica-tions, vol. , no. , pp. –, .

[] D. Y. akeda and A. Dutta, “DNA replication and progressionthrough S phase,” Oncogene, vol. , no. , pp. –, .

apoptosis induction by polygonum minus is related to antioxidant capacity, alterations in expression...

Documents