antimicrobial effects of four lactobacilli strains isolated from yoghurt against e ...

ANTIMICROBIAL EFFECTS OF FOUR LACTOBACILLI STRAINSISOLATED FROM YOGHURT AGAINST ESCHERICHIACOLI O157:H7ABBAS ALI IMANI FOOLADI1,5, MARYAM CHAVOSHI FOROOSHAI2, PARVANEH SAFFARIAN3 andREZVAN MEHRAB4

1Applied Microbiology Research Center, Baqiyatallah University of Medical Sciences, Sheikh Bahaei Street, Molla Sadra Street, Vanak Sq., Tehran984359-44711, Iran2Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran3Department of Bacteriology, School of Medical Sciences, Tarbiat Modares University, Tehran, Iran4Department of Pharmaceutics, Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran

5Corresponding author.TEL: +98-2188068924;FAX: +98-2188068924; EMAIL:[email protected] [email protected]

Received for Publication October 20, 2013Accepted for Publication February 9, 2014

doi: 10.1111/jfs.12108

ABSTRACT

This study aimed to isolate Lactobacillus species from yoghurt and to evaluate itsantimicrobial activity against enterohemorrhagic Escherichia coli O157:H7. Afterincubation of different yoghurt samples in MRS (de Man, Rogosa and Sharpe)agar at 37C under anaerobic conditions, four Lactobacillus species, L. casei, L.acidophilus, L. helveticus and L. delbrueckii ssp. bulgaricus were identified. Standardgrowth curves of E. coli O157:H7 in proximity with lactobacilli test strains wereobtained. The antibacterial effects of lactobacilli cell debris and culture superna-tant against E. coli O157:H7 were determined. The results showed that the anti-bacterial effects of culture supernatant were stable at different temperatureconditions (56–100C) for 30 and 60 min; also, it was stable at pH 3–10. Withregard to the antibacterial effect of the lactobacilli strains in this study, they mayhelp in the treatment of E. coli O157:H7-associated diseases and can be applied asa biological preservative in the food industry.

PRACTICAL APPLICATIONS

In recent years, foodborne diseases become a health problem in most of the popu-lation. One of the most important etiologic agents of such diseases is Escherichiacoli O157:H7, which can be transmitted through eating undercooked infectedmeat and leads to hemorrhagic diarrhea and kidney failure. There is increasingevidence that lactobacilli bacteria produce potential agents (H2O2, small organiccompounds, lactic acid, etc.) that can inhibit growths of some invasive foodbornebacteria, such as enterohemorrhagic E. coli. The results of this study also con-firmed these reports and showed that the use of lactobacilli bacteria is a promisingway to prevent the infection of E. coli O157:H7; also, they can be used as a biologi-cal preservative in the food industry.

INTRODUCTION

Lactobacillus bacteria are gram-positive, spore-free, long orshort rods. These bacteria are included in the lactic acidbacteria (LAB) (Agirre et al. 2008) group, which were firstisolated from milk (Carr et al. 2002) and used in food fer-mentation industries, including dairy, meat, vegetable and

bakery products (Marugg 1991; O’Sullivan et al. 2002; Liu2003; Batdorj et al. 2007). Therefore, fermented foodsmay play an important role in determining the amountof living bacteria within the human body when theywere biotechnologically used as starter cultures (Hummelet al. 2007). These bacteria are known to produce variousmetabolites, such as bacteriocins, hydrogen peroxide

bs_bs_banner

Journal of Food Safety ISSN 1745-4565

150 Journal of Food Safety 34 (2014) 150–160 © 2014 Wiley Periodicals, Inc.

(H2O2), diacetyl (2,3-butanedione), acetaldehyde, ammonia,free fatty acids, lactic acid, other organic acids and ethanol(Jay 1982; Klaenhammer 1988; Djouzi et al. 1997; Erdouruland Erbulur 2006), which have an inhibitory effect on thegrowth of a broad range of microorganisms, and mayinhibit the growth of several foodborne pathogenic micro-organisms and putrefactive food microorganisms suchas Listeria (Ennahar and Deschamps 2000), Clostridiumand enterococci (Zhu et al. 2000), and some Bacillusand Staphylococcus (Messens and De Vuyst 2002). Inaddition, lactobacilli have activity toward various humanintestinal and vaginal pathogens such as enterohemorrha-gic Escherichia coli O157:H7 (Batdorj et al. 2007). Theenterohemorrhagic E. coli O157:H7 as an important humanpathogen is the dominant cause of hemorrhagic colitis andhemolytic uremic syndrome (HUS) (Zhao et al. 1995) andit has been documented as the source of many outbreaks. Ithas apparently low infectious dose (100 cells) and is able tosecrete Shiga-like toxin and is estimated to cause more than20,000 infections and death each year (Boyce et al. 1995;Wachsmuth et al. 1997). So, E. coli O157:H7 is considered asone of the most serious known foodborne pathogens(Lynch et al. 2006). Besides, since use of antibiotic mayincrease risk of HUS by induction of Stx-encoding bacterio-phages, no specific antibiotic treatments are available inhumans suffering from HUS (Bielaszewska et al. 2012).Hence, it is necessary to find other noninvasive ways to treatthis important pathogen.

Lactobacillus species are nonpathogenic and nontoxi-cogenic (Macfarlane and Cummings 1999; Gorbach 2000;Tharmaraj and Shah 2003; Manley et al. 2007) and areregarded as a major group of probiotic bacteria in theindustry (Caplice and Fitzgerald 1999; Schrezenmeir and DeVrese 2001). Protective effect of Lactobacillus in fermentedfoods is mainly due to the acid production by convertingcarbohydrates to organic acids (acetic acid and lactic acid),which led to pH reduction (Kuipers et al. 2000; Erdouruland Erbulur 2006). This process occurs during the growthof bacteria in food, which may increase the half-life andquality of the fermented food. Therefore, they were used asbiological preservatives in fermented foods (Sreekumar andHosono 2000; Giraffa et al. 2010). Many reports have dem-onstrated the health benefits of lactobacilli (Dunne 2001;Marteau et al. 2001; Ohashi et al. 2007) and the essentialrole of bacteria in yoghurt in the prevention and treatmentof some diseases caused by pathogenic bacteria in severalmechanisms (Akpinar et al. 2011). The health beneficialeffects of lactobacilli include prevention of antibiotic-associated diarrhea, providing a healthy replacement ofnormal flora in the intestinal tract following antibiotictherapy; improve the treatment of intestinal disorders suchas acute infantile diarrhea, recurrent Clostridium difficiledisease and various diarrheal illnesses (Biller et al. 1995;

Erdourul and Erbulur 2006); provide immune protectionagainst infections or cancer; and improve the symptoms oflactose intolerance and aiding in cholesterol reduction(Thoreux et al. 1998; Sreekumar and Hosono 2000).

Nonetheless, Lactobacillus species such as L. helveticusand L. delbrueckii ssp. lactis are less traditional and aresometimes mixed with the starter culture in yoghurt(McKinley 2005). In recent years, the industrial productionof yoghurt is increasingly developed in the world andspecial strains of LAB are used in its production (Sudi et al.2011). Recently, the majority of yogurts and fermented milkare produced industrially, and bifidobacteria, L. acidophilusor L. delbrueckii ssp. bulgaricus are used as new probiotics(Erdourul and Erbulur 2006).

So far, several researchers have reported in vitro inhibi-tory effect of LAB on the growth of pathogenic E. coliO157:H7 (Gopal et al. 2001; Nissen et al. 2001; Ogawa et al.2001; Hirano et al. 2003; Jones et al. 2008). But, to ourknowledge, few works were performed on the antimicrobialeffects of dairy-derived probiotics such as lactobacilli strainsisolated from yoghurt to emphasize the importance of theirrole in protection against foodborne pathogenic bacteriasuch as E. coli O157:H7.

The aim of this study was to determine the antibacterialactivity of bacterial cell debris and culture supernatant offour strains belonging to the genus Lactobacillus (L. casei,L. acidophilus, L. helveticus and L. delbrueckii ssp. bulgaricus)isolated from yoghurt against enterohemorrhagic E. coliO157:H7.

MATERIAL AND METHODS

Isolation and Phenotypic Identification ofTest Lactobacilli Strains from Yogurt

Seven samples of yogurt were purchased from differentcompanies, and after dilution, they were cultured on MRS(de Man, Rogosa and Sharpe) and incubated at 37C underanaerobic jar with gas pack. After the colony formation,species of Lactobacillus were identified using standard pro-tocols: Gram staining, cell morphology, biochemical andsugar fermentation tests. The tested carbohydrates includedmannitol, cellobiose, maltose, melezitose, sorbitol, salisinand osculin (Erdourul and Erbulur 2006). For carbohydratefermentation test, 1% of each sugar was added to sugarfermentation medium.

Turbidity Survey

Standard growth curve related to tested strains of Lactoba-cilli and E. coli O157:H7 in proximity to these strains ofLactobacilli were drawn to compare the growth of patho-genic bacteria for 24 h. Initially, it is essential that the

A. A. IMANI FOOLADI ET AL. ANTIMICROBIAL EFFECT OF LACTOBACILLI SPP.

151Journal of Food Safety 34 (2014) 150–160 © 2014 Wiley Periodicals, Inc.

bacterial growth curves were obtained in standard condi-tions. In this study, we used turbidimetry method at a wave-length of 650 nm and colony counting method (Matsusakiet al. 1996). For each of lactobacilli strains and E. coliO157:H7, 10 μL of the medium containing a concentrationof 3 × 108 bacteria/mL (1McFarland) of these strains wasinoculated into two tubes containing 5 mL of tryptic soybroth (TSB). Then, turbidity was read after 4, 12 and 24 h(Matsusaki et al. 1996).

Colony Counting

A concentration of 3 × 108 bacteria/mL from the testedstrains of Lactobacilli and E. coli O157:H7 was inoculated tofour tubes containing 5 mL of TSB related to four differenttime intervals (0, 4, 12 and 24 h). Then, the serial dilutionsof 10−6–10−10 were prepared from each tube. Afterward,1 mL of each of dilutions was cultured on melted Mueller–Hinton agar plates at 40–45C. Following solidification ofthe MHA medium, the plates were incubated under anaero-bic conditions at 37C for 24 h. Plates containing 10–300colonies were selected and their colonies were counted (testresults analyzed in triplicate).

Molecular Identification of Lactobacilli TestStrains DNA Extraction

At first, strains were cultured in 2 mL Luria broth media,followed by incubation overnight at 37C for 24 h. Then,genomic DNA extraction process was performed on pelletfrom centrifugation according to the instructions of DNAextraction kit (Metabion, Planegg-Martinsried, Germany).Five microliters of the extracted product was subject toelectrophoresis on 0.8% agarose gel (Sigma, St. Louis, MO)and stained with ethidium bromide, DNA band presentedbeside the 100 bp DNA size marker. DNA concentration wasmeasured by a Nano-drop spectrophotometer (NanoDrop1000, Thermo Scientific, Waltham, MA).

Polymerase Chain Reaction (PCR) Assayand Optimization

To identify lactobacilli test strains, we used primers relatedto 16 s–23 s spacer regions (Walter et al. 2000); the primerswere made by SinaGen, Inc. (Tehran, Iran; Table 1). PCRreaction was performed in 25 μL total volume containing2 μL 10X PCR buffer, 2 μL MgCl2 (2.5 mM), 1 μL of eachprimer (10 pmol), 2 μL dNTPs (2.5 mM), 0.5 μL Taq DNApolymerase enzyme (5 U) and 2 μL of DNA template andincubated at 92C for 2 min and 35 cycles of amplification(denaturation at 95C for 30 s, annealing at 55C for 30 s andextension at 72C for 30 s with a final extension at 72C for1 min). Standard strains including L. casei ATCC 4684,L. acidophilus ATCC 4356, L. helveticus ATCC 15807 andL. delbrueckii ssp. bulgaricus ATCC 11842 were used as posi-tive control (obtained from the microbial Bank of IranianScience and Technology Research Organization). Then, thesamples were electrophoresed next to the 100 bp DNA sizemarker on 1.5% agarose gel and bands were presented usingstaining with ethidium bromide under ultraviolet light(Fig. 1) (Walter et al. 2000).

Evaluation of the Antibacterial Activity ofCulture Supernatant Obtained fromLactobacilli Test Strains

Lactobacilli were grown in MRS broth and then culture wascentrifuged at 5,000 rpm for 10 min, and culture superna-tant was collected. The inhibitory effect of each culturesupernatant against the growth of E. coli O157:H7 wasdetermined by means of the turbidimetry (at wavelength650 nm) method, and followed by determination of theminimum inhibitory concentration (MIC) and minimumbactericidal concentration (MBC) amounts.

Turbidity Survey

One milliliter of culture supernatant containing a concen-tration of 3 × 108 cfu/mL (1McFarland standard) of each

TABLE 1. SPECIES PRIMERS RELATED TO 16 S–23 S SPACER REGIONS WERE USED FOR THE IDENTIFICATION OF LACTOBACILLI TEST STRAINS

Primerpairs Lactobacilli test strain Primer sequence (5′–3′) Reference

1 Lactobacillus casei F-primer: CAGACTGAAAGTCTGACGG

(Walter et al. 2000)

R-primer: GCGATGCGAATTTCTTTTTC2 Lactobacillus acidophilus F-primer: AGCTGAACCAACAGATTCAC

R-primer: ACTACCAGGGTATCTAATCC3 Lactobacillus helveticus F-primer: CGCTGATTCTAAGTCAAGCT

R-primer: CGACTAAGAAGTGGAACATTA4 Lactobacillus bulgaricus F-primer: AAAAATGAAGTTGTTTAAAGTAGGTA

R-primer: AAGTCTGTCCTCTGGCTGG

ANTIMICROBIAL EFFECT OF LACTOBACILLI SPP. A. A. IMANI FOOLADI ET AL.


lactobacilli test strain was mixed – in separate tubes – with0.5 mL of suspension of the pathogenic bacterial strains andturbidity was read at 650 nm wavelength after 0, 4, 12 and24 h, and the results were presented as graphs (results areaverage of the independent test repeats).

The MIC and MBC Determination

The antibacterial effect of lactobacilli bacterial cell debrisand its culture supernatant were tested against E. coliO157:H7 using broth macrodilution method. Briefly, serialdilutions (1.2–1.64) of culture supernatant obtained fromeach lactobacilli test strains were prepared in Mueller–Hinton broth and then 1 mL of E. coli O157:H7 suspension(1McFarland) was added to each tube. Incubation of tubesat 37C for 24 h was followed by MIC determination. Then,100 μL of those MIC tubes with no turbidity was culturedon Mueller–Hinton agar and the plates were incubated at37C for 24 h. Afterward, colonies were counted and MBCamount was determined.

Evaluation of the Antibacterial Activity ofLactobacilli Test Strains Cell Debris

Ten microliters of each lactobacilli test strains and E. coliO157:H7 strains (with concentration of 3 × 108 cfu/mL)were separately and concurrently mixed into four tubescontaining TSB broth. After certain inoculation intervals(T0, T4, T12 and T24), the contents of the tubes were culturedon the TSB agar and were incubated at 37C for 24 h. Finally,lactobacilli and E. coli O157:H7 colonies were counted sepa-rately and the results were compared with their growthcurves (Boris et al. 2001).

Survey of Physicochemical Properties ofCulture Supernatant Obtained fromLactobacilli Test Strains

Temperature Effect. Culture supernatant obtained fromlactobacilli test strains was incubated at 56, 70 and 80C for10 min and at 10, 30 and 60 min at 100C, and then the anti-bacterial activity was evaluated using well diffusion agar(WDA) method (Schillinger and Lucke 1989). Briefly,100 μL of culture supernatant of each lactobacilli test strainwas flowed separately into 4 wells (ø6 mm) previously madein a Petri dish with 20 mL of Mueller–Hinton agar andincubated at 37C in anaerobic condition. After 18 h, 40 μLof E. coli O157:H7 suspension (1McFarland) was swab onthe entire plate and incubated at 37C for 24 h. Afterward,the clear zones around the colonies were measured in orderto determine the antimicrobial activity of each lactobacillitest strain supernatant.

pH Effect. The pH of culture supernatant of lactobacillitest strains were adjusted to 3.7 and 10 by means of normalNaOH and HCl, and its antibacterial activity was evaluatedby the WDA method. All data were analyzed by SPSSsoftware v. 17 (SPSS, Inc., Chicago, IL), chi-square andFisher’s test.

RESULTS

Identification of Lactobacilli Strains

In this study, out of seven yogurt samples, we obtained twoL. casei, three L. acidophilus, one L. helveticus and oneL. delbrueckii ssp. bulgaricus. Genus and species of thesebacteria were confirmed based on colony morphology, the

FIG. 1. IDENTIFYING LACTOBACILLI TEST STRAINS USING PRIMERS RELATED TO 16 S–23 S SPACER REGIONSColumn 1 – marker 100 bp DNA marker; column 2 – standard strain of each of lactobacilli as positive control; columns 3 and 4 – the lactobacilli teststrains isolated from yoghurt samples; column 5 – Escherichia coli O157:H7 as negative control; columns 6 and 7 – negative control for (a) Lactoba-cillus casei (305 bp), (b) Lactobacillus acidophilus (610 bp), (c) Lactobacillus bulgaricus (1,065 bp) and (d) Lactobacillus helveticus (726 bp).



microscopic characteristics, biochemical tests, fermentationof carbohydrate and molecular methods such as PCR(Fig. 1). After 7–3 days under anaerobic conditions at 37C,bacterial colonies were observed with white to creampigment and 1–2 mm in diameter on the MRS agar. Thesebacteria were gram-positive, non-spore-forming, long andsome short rods. Standard growth curve of these strains oflactobacilli and E. coli O157:H7 for 24 h under standardconditions shows that their growth was appropriate (Fig. 2).

Antibacterial Effect of Culture SupernatantRelated to Lactobacilli Test Strains

The Turbidity Survey. Proximity of E. coli O157:H7 withculture supernatant obtained from tested strains of lactoba-cilli (at times T0, T4, T12 and T24) was significantly reduced inthe growth of pathogenic bacteria (P < 0.05) (Fig. 3).

Among the culture supernatants of lactobacilli teststrains, that of L. bulgaricus has the highest impact, whereas

8.44 10.5114.54 13.44

8.4610.5

14.47 13.448.4410.46

14.513.47

8.43

10.47

14.4713.47

8.46

10.47

14.4713.44

0

10

20

30

40

50

60

70

80

0 4 12 24

L. helve cus

L. bulgaricus

L. acidophilus

L. casei

E. coli O157:H7

aO

D (6

50nm

)

Time (h)

b

FIG. 2. STANDARD GROWTH CURVES OFESCHERICHIA COLI O157:H7 AND LACTOBA-CILLUS CASEI, LACTOBACILLUS ACIDOPHILUS,LACTOBACILLUS BULGARICUS AND LACTOBA-CILLUS HELVETICUS FOR 24 H OF INCUBATIONOF EITHER ALONEData were analyzed by (a) colony counts and(b) turbidimetry method.

568 545 512 489

571 549 517 492

572 548 503 485

572 549 520 495

580

1485

23502005

0

500

1000

1500

2000

2500

3000

3500

4000

4500

5000

0 4 8 12 16 20 24

OD

(650

nm

)

Time (h)

E. coli O157H7 growth

E. coli O157H7 mixed with L. helve�cus

E. coli O157H7 mixed with L. bulgaricus

E. coli O157H7 mixed with L. acidophilus

E. coli O157H7 mixed with L. casei

FIG. 3. GROWTH OF PATHOGEN BACTERIAFOR 24 HGrowth curves of Escherichia coli O157:H7before (as negative control) and after mix withculture supernatant of lactobacilli test strainsfor 24 h of incubation at 37C. The growth wasanalyzed by turbidimetry method (wavelength650 nm).



L. helveticus has lower inhibitory effect on the pathogenicbacteria.

WDA Method. Culture supernatant obtained from testedstrains of lactobacilli showed antibacterial activity againstE. coli O157:H7. The inhibition zones that belong to culturesupernatant of L. casei, L. acidophilus, L. bulgaricus andL. helveticus were 17, 16, 14, 13.5 mm, respectively.

Cell Debris Antibacterial Effect ofLactobacilli Test Strains

Simultaneous cultivation of pathogenic bacteria (E. coliO157:H7) in proximity with tested strains of lactobacillicompared to the positive control (growth curve of each oflactobacilli test strains and E. coli O157:H7 alone) showsthat the growth of E. coli O157:H7 as pathogenic bacteriawas significantly reduced in proximity with the testedstrains of lactobacilli (P < 0.05). The results in Fig. 4 showedthat L. bulgaricus have the highest inhibitory effect on E. coliO157:H7 growth, whereas L. casei, L. aciduphylus andL. helveticus showed a similar inhibitory effect on thegrowth of E. coli O157:H7. On the contrary, the number oflactobacilli test strains did not change or reduce.

The MIC and MBC Assay. The results of MIC and MBCare presented in Fig. 5. MIC results related to the culture

supernatant obtained from L. casei, L. acidophilus,L. bulgaricus and L. helveticus against E. coli O157:H7 were1/16, 1/8, 1/8, 1/4, respectively. MBC results from theculture supernatant obtained from L. casei, L. acidophilus,L. bulgaricus and L. helveticus against E. coli O157:H7 were1/8,1/4, 1/4, 1/4, respectively. Therefore, a comparison of theresults of MIC and MBC demonstrates that minimal

a b

c d

FIG. 4. GROWTH OF PATHOGEN BACTERIA FOR 24 HGrowth curve of simultaneous cultivation of pathogenic bacteria (Escherichia coli O157:H7) in proximity with tested strains of lactobacilli:(a) Lactobacillus casei, (b) Lactobacillus acidophilus, (c) Lactobacillus bulgaricus and (D) Lactobacillus helveticus.

0

1

2

Log10(cfu/ml)

MICMBC

FIG. 5. THE MINIMUM INHIBITORY CONCENTRATION (MIC) ANDMINIMUM BACTERICIDAL CONCENTRATION (MBC) AMOUNTSRELATED TO THE CULTURE SUPERNATANT OBTAINED FROMLACTOBACILLUS CASEI, LACTOBACILLUS ACIDOPHILUS, LACTOBACIL-LUS BULGARICUS AND LACTOBACILLUS HELVETICUS AGAINSTESCHERICHIA COLI O157:H7



concentration of L. casei, which has an inhibitory effect onthe E. coli, is lower than other lactobacilli.

The Physicochemical Properties of the CultureSupernatant Obtained from Lactobacilli TestStrains. The results, as shown in Table 2, demonstratedthat the culture supernatant obtained from the testedstrains of lactobacilli was stable at temperatures of 56, 70and 80 and 100C for 10 min. Furthermore, its antibacterialeffect was retained at pH 3, 7 and 10 (normal pH of the lac-tobacilli test strains culture supernatant was 5.5), and onlyL. helveticus was sensitive to 100C temperature for 30 and60 min, and pH 10.

DISCUSSION

LAB are used as starter in dairy products, which causedfood fermentation and protection. These bacteria alsoproduce antimicrobial substances that contribute in thepotential health benefits of the dairy products such asyogurt (Djouzi et al. 1997) and have a significant role inflavor and texture of fermented products (Izco et al. 2002).The study of Ohashi et al. (2007) showed that, in additionto the competitive relationship between probiotic LABs,there is a symbiotic relationship among these bacteria(Ohashi et al. 2007).

Many reports have demonstrated that several strainsof probiotics have health benefits in the prevention andtreatment of antibiotic-associated diarrhea (Jones 2010).Researchers have estimated that a healthy colon shouldcontain at least 85% Lactobacillus and 15% Coliform bacte-ria. In addition, Lactobacillus, especially L. acidophilus, helpsin the formation of B vitamins such as B1, B2, B3, B12 andfolic acid (Tenney 1996). Findings of several studies haveshown that the antimicrobial effect of Lactobacillus spp. ishigher than Streptococcus spp. (Akpinar et al. 2011) becausethe maximum acidification rate of the Lactobacillus spp. isgenerally higher than that of the Streptococcus spp. (Spinnlerand Corrieu 1989).

L. acidophilus is a member of the microflora in thehuman and animal gastrointestinal tract, mouth and vagina(Quan-Xi 2011). Dr. Khem Shahani demonstrated thatL. acidophilus in fermented milk produces a powerful anti-biotic with similar functionality as penicillin, streptomycinand terramycin, which is referred to as “acidophilin”.L. acidophilus in yogurt is effective in treating vaginal yeastinfections, infant diarrhea and food poisoning, and inpreventing influenza infection (Tenney 1996). L. delbrueckiissp. bulgaricus is another example of beneficial bacteria thatis sometimes found in the intestinal tract. It helps producelactic acid and has some antibiotic activity that leads to theprevention of infections (Tenney 1996). Many reports havedemonstrated that all strains of L. bulgaricus exhibited anti-microbial activity against E. coli, Staphylococcus aureus, andBacillus cereus strains due to the production of hydrogenperoxide and different antimicrobial substances. Accordingto the study of Zeinhom et al., L. acidophilus producesome bioactive molecules that can decrease the severity ofEHEC-related disease in experimental mice that fed withL. acidophilus La5 cell-free spent medium (LAla-5AF). Theirresults showed that LAla-5AF can alter attachment andcolonization of EHEC. Also, they found that this bioactivemolecules could downregulate several EHEC virulencegenes, including stxB2, qseA, luxS, tir, ler, eaeA and hlyB,when tested by reverse transcription real-time PCR(Zeinhom et al. 2012). Also, Arslan et al. (2002) determinedthe antimicrobial activity of specific strains of L. bulgaricusand Streptococcus thermophilus against Listeria monocyto-genes, C. difficile, E. coli O157:H7 and S. aureus by agar diskdiffusion method. The study of Akpinar et al. (2011) sup-ported the aforementioned information and demonstratedthat some L. bulgaricus and S. thermophilus strains, whichwere isolated from homemade yoghurt, had shown antimi-crobial activity against some foodborne pathogen andspoilage microorganisms especially L. monocytogenes,E. coli, Klebsiella pneumoniae and Pseudomonas fluorescens(Akpinar et al. 2011).

The result of the study of Alvarez et al. (2001) demon-strates that injection of L. casei isolated from yogurt to

TABLE 2. THE SENSITIVITY OF THE CULTURE SUPERNATANT OF LACTOBACILLI IN DIFFERENT CONDITIONS

Tested strains

pH effect

Temperature

Resistant to 100C (min)Resistant to high temperaturefor 10 min (C)

3 7 10 10 30 60 56 70 80

Lactobacillus casei R R R R R R R R RLactobacillus acidophilus R R R R R R R R RLactobacillus bulgaricus R R R R R R R R RLactobacillus helveticus R R S R S S R R R

R, resistant; S, sensitive.



young mice leads to enhanced lung clearance ofP. aeruginosa and phagocytic activity of alveolar mac-rophages in a dose-dependent manner (Alvarez et al. 2001).Batdorj et al. (2007) reported that Listeria viabilitydecreased significantly in aerated mixed cultures ofL. debrueckii ssp. lactis T31 and L. innocua. They suggestedL. delbrueckii ssp. lactis T31can be used as a probiotic toprevent intestinal and urogenital infections or as a protec-tive culture in food industries (Batdorj et al. 2007). In theirstudy, Manley et al. (2007) demonstrated that following theuse of a probiotic yoghurt, a significant reduction occurs inthe detection of vancomycin-resistant enterococci in fecalspecimens isolated from patients (containing LGG) (Manleyet al. 2007). Petti et al. (2008) investigated the differencesbetween susceptibility of several strains of viridans strepto-cocci to yoghurt and in vitro studies found that yoghurtconsumption leads to a selective decrease in the oral level ofStreptococcus mutans but not S. sobrinus.

These data suggest that the S. mutans were more suscep-tible to yoghurt than other strains of viridans streptococci,and yoghurt and dairy products have a positive effect on theecology of dental plaque (Petti et al. 2008). Ota (1999)reported that use of yogurt causes more colonization ofLactobacillus in intestine and provides circumstances thatprevent the colonization of enterohemorrhagic E. coli.

Casla et al. (1996) performed food inoculation in theMRS broth and then after a few hours, cultured on MRSagar in order to isolate Lactobacillus. This method of enrich-ment usually help in obtaining Lactobacillus from vegetableand seafood (Casla et al. 1996). But, in the present study,Lactobacillus was grown on MRS without using the enrich-ment method. This is probably due to the large number ofbacteria used as a starter in the dairy products. Toba et al.incubated culture supernatant of Lactobacillus in proximitywith pathogenic bacteria such as L. monocytogenes, Salmo-nella, Shigella and S. aureus, and turbidity was examined atdifferent time intervals and concluded that the rate of tur-bidity was reduced from 566 to 407 in this condition (Tobaet al. 1991; Itoh et al. 1995). Erdourul and Erbulur (2006)showed that culture supernatants obtained from L. casei andL. bulgaricus exhibited weak antibacterial activity (∼8 mmzone of inhibition) against E. coli, S. aureus, P. aeroginosa,B. subtilis, K. pneumonia, S. Typhimurium and E. cloacae(Erdourul and Erbulur 2006). In this study, the effect oftested strains of Lactobacilli culture supernatant was inves-tigated against pathogenic strains of enterohemorrhagicE. coli. Decrease of turbidity (at times T0, T4, T12 and T24, at awavelength of 650 nm) suggests that the E. coli O157:H7incubation in proximity with culture supernatant obtainedfrom tested strains of lactobacilli can lead to significantreduction in growth of pathogenic bacteria (P < 0.05).Among culture supernatant of lactobacilli test strains,L. bulgaricus has the highest impact and L. helveticus has

lower inhibitory effect on the pathogenic bacteria. More-over, a comparison of the results of MIC and MBC demon-strates that culture supernatant from L. casei has aninhibitory effect against E. coli O157:H7 in lower concentra-tion than other lactobacilli.

Hirano et al. studied the antimicrobial effect of theculture supernatant of Lactobacillus sakei, Lactobacillusplantarum and Lactobacillus curvatus using the WDAmethod and found that these substances have an inhibi-tory effect on a wide range of pathogenic bacteria such asL. monocytogenes, S. aureus and Yersinia enterocolitica(Hirano et al. 2003).

In the present study, we showed that supernatant of lac-tobacilli test strains has antibacterial activity againstenterohemorrhagic E. coli using the WDA method and hasa significant inhibition zone against E. coli O157:H7. Theantimicrobial activity of supernatant Lactobacillus of vaginawas stable in pH 5.4–7, but in this acidity, its antimicrobialactivity was lost (Alphy-Karaoglu et al. 2003). In our study,the antibacterial effect of L. casei, L. acidophilus andL. bulgaricus supernatant was resistant to pH 3, 7 and 10(normal pH of the lactobacilli test strains culture superna-tant were 5.5), which has not been observed in otherstudies.

Ogunbanwo et al. reported that the supernatant ofL. plantarum and Lactobacillus brevis has fully retained itsantibacterial activity after storage at −20C for 60 days, butits activity is relatively stable at 4C for 120 days, whereasthis suspension showed no activity after storage at 37C for10–80 days (Ogunbanwo et al. 2003). In the present study,the antibacterial stability of the culture supernatantobtained from lactobacilli test strains were studied at differ-ent temperatures and it was found that at temperatures of56, 70, 80 and 100C, they were stable for 10 min and onlyL. helveticus was sensitive to 100C for 30 and 60 min, wasalso sensitive at pH 10. The present study was differentfrom the above study in two points. First, our studyused L. casei, L. acidophilus, L. helveticus and L. delbrueckiissp. bulgaricus and, second, we survey temperatures above37C up to 100C, which was not examined by Ogunbanwoet al. (2003).

In addition, the turbidimetry of the simultaneous cultiva-tion of pathogenic bacteria (E. coli O157:H7) in proximitywith tested strains of lactobacilli showed similar results withthe effect of cell debris of L. casei, L. acidophilus andL. helveticus on E. coli O157:H7 as pathogenic bacteria andshowed that the growth significantly was reduced, in prox-imity with the lactobacilli test strains, whereas L. bulgaricushave the highest inhibitory effect on the growth of E. coliO157:H7. On the contrary, the number of E. coli O157:H7cells was not changed or reduced when cultured alone.Matsusaki et al. (1996) used the other method to surveythe inhibitory effect of Lactobacillus on the growth of



pathogenic bacteria and performed the colony countof bacteria at different time intervals after exposure toLactobacillus.

It can be concluded from the results of this study thatculture supernatant and cell debris of lactobacilli teststrains can be used against intestinal pathogens such asenterohemorrhagic E. coli and its antibacterial effectsremain stable at hard condition of temperature and acidity.

ACKNOWLEDGMENTS

This study was part of the dissertation of Maryam ChavoshiForooshani, submitted to Baqiyatallah University of MedicalSciences in partial fulfillment of the requirements for theMSc in microbiology.

REFERENCES

AGIRRE, J., MECHALY, A., CABO-BILBAO, A. and GUERIN,D.M. 2008. A plate holder for non-destructive testing ofmesophase crystallization assays. Eur. Biophys. J. 37(6),871–877.

AKPINAR, A., YERLIKAYA, O. and KILIC, S. 2011.Antimicrobial activity and antibiotic resistance ofLactobacillus delbrueckii ssp. bulgaricus and Streptococcusthermophilus strains isolated from Turkish homemadeyoghurts. Afr. J. Microbiol. Res. 5(6), 675–682.

ALPHY-KARAOGLU, S., AYDIN, F. and KILIC, A. 2003.Antimicrobial activity and characterization of bacteriocinsproduced by vaginal lactobacilli. Turk. J. Med. Sci. 33, 7–13.

ALVAREZ, S., HERRERO, C., BRU, E. and PERDIGON, G. 2001.Effect of Lactobacillus casei and yogurt administration onprevention of Pseudomonas aeruginosa infection in youngmice. J. Food Prot. 64(11), 1768–1774.

ARSLAN, F. 2002. Lactic acid bacteria isolated from some ofbacteriocins selected Herzegovina on pathogenic bacteria effects.Master Thesis, 18: 214, EUTKAUM. F. B. E.

BATDORJ, B., TRINETTA, V., DALGALARRONDO, M.,PREVOST, H., DOUSSET, X., IVANOVA, I., HAERTLE, T.and CHOBERT, J.M. 2007. Isolation, taxonomic identificationand hydrogen peroxide production by Lactobacillus delbrueckiisubsp. lactis T31, isolated from Mongolian yoghurt: Inhibitoryactivity on food-borne pathogens. J. Appl. Microbiol. 103(3),584–593.

BIELASZEWSKA, M., IDELEVICH, E.A., ZHANG, W.,BAUWENS, A., SCHAUMBURG, F., MELLMANN, A.,PETERS, G. and KARCH, H. 2012. Effects of antibiotics onShiga toxin 2 production and bacteriophage induction byepidemic Escherichia coli O104:H4 strain. Antimicrob. AgentsChemother. 56(6), 3277–3282.

BILLER, J.A., KATZ, A.J., FLORES, A.F., BUIE, T.M. andGORBACH, S.L. 1995. Treatment of recurrent Clostridiumdifficile colitis with Lactobacillus GG. J. Pediatr. Gastroenterol.Nutr. 21(2), 224–226.

BORIS, S., JIMÉNEZ-DÍAZ, R., CASO, J.L. and BARBÉS, C.2001. Partial characterization of a bacteriocin produced byLactobacillus delbrueckii subsp. lactis UO004, an intestinalisolate with probiotic potential. J. Appl. Microbiol. 91(2),328–333.

BOYCE, T.G., SWERDLOW, D.L. and GRIFFIN, P.M. 1995.Escherichia coli O157:H7 and the hemolytic-uremicsyndrome. N. Engl. J. Med. 333(6), 364–368.

CAPLICE, E. and FITZGERALD, G.F. 1999. Food fermentations:Role of microorganisms in food production and preservation.Int. J. Food Microbiol. 50(1–2), 131–149.

CARR, F.J., CHILL, D. and MAIDA, N. 2002. The lactic acidbacteria: A literature survey. Crit. Rev. Microbiol. 28(4),281–370.

CASLA, D., REQUENA, T. and GÓMEZ, R. 1996. Antimicrobialactivity of lactic acid bacteria isolated from goat’s milk andartisanal cheeses: Characteristics of a bacteriocin produced byLactobacillus curvatus IFPL105. J. Appl. Microbiol. 81(1),35–41.

DJOUZI, Z., ANDRIEUX, C., DEGIVRY, M.-C., BOULEY, C.and SZYLIT, O. 1997. The association of yogurt starters withLactobacillus casei DN 114.001 in fermented milk alters thecomposition and metabolism of intestinal microflora ingerm-free rats and in human flora-associated rats. J. Nutr.127(11), 2260–2266.

DUNNE, C. 2001. Adaptation of bacteria to the intestinal niche:Probiotics and gut disorder. Inflamm. Bowel Dis. 7(2),136–145.

ENNAHAR, S. and DESCHAMPS, N. 2000. Anti-Listeria effectof enterocin A, produced by cheese-isolated Enterococcusfaecium EFM01, relative to other bacteriocins from lactic acidbacteria. J. Appl. Microbiol. 88(3), 449–457.

ERDOURUL, O. and ERBULUR, F. 2006. Isolation andcharacterization of Lactobacillus bulgaricus andLactobacillus casei from various foods. Turk. J. Biol. 30(1),39–44.

GIRAFFA, G., CHANISHVILI, N. and WIDYASTUTI, Y. 2010.Importance of lactobacilli in food and feed biotechnology.Res. Microbiol. 161(6), 480–487.

GOPAL, P.K., PRASAD, J., SMART, J. and GILL, H.S. 2001. Invitro adherence properties of Lactobacillus rhamnosus DR20and Bifidobacterium lactis DR10 strains and their antagonisticactivity against an enterotoxigenic Escherichia coli. Int. J. FoodMicrobiol. 67(3), 207–216.

GORBACH, S.L. 2000. Probiotics and gastrointestinal health.Am. J. Gastroenterol. 95(Suppl. 1), S2–S4.

HIRANO, J., YOSHIDA, T., SUGIYAMA, T., KOIDE, N., MORI,I. and YOKOCHI, T. 2003. The effect of Lactobacillusrhamnosus on enterohemorrhagic Escherichia coli infection ofhuman intestinal cells in vitro. Microbiol. Immunol. 47(6),405–409.

HUMMEL, A.S., HERTEL, C., HOLZAPFEL, W.H. and FRANZ,C.M.A.P. 2007. Antibiotic resistances of starter and probioticstrains of lactic acid bacteria. Appl. Environ. Microbiol. 73(3),730–739.



ITOH, T., FUJIMOTO, Y., KAWAI, Y., TOBA, T. and SAITO, T.1995. Inhibition of food-borne pathogenic bacteria bybacteriocins from Lactobacillus gasseri. Lett. Appl. Microbiol.21(3), 137–141.

IZCO, J.M., TORMO, M. and JIMÉNEZ-FLORES, R. 2002.Development of a CE method to analyze organic acids indairy products: Application to study the metabolism ofheat-shocked spores. J. Agric. Food Chem. 50(7), 1765–1773.

JAY, J.M. 1982. Antimicrobial properties of diacetyl. Appl.Environ. Microbiol. 44(3), 525–532.

JONES, K. 2010. Probiotics: Preventing antibiotic-associateddiarrhea. J. Spec. Pediatr. Nurs. 15(2), 160–162.

JONES, R.J., HUSSEIN, H.M., ZAGOREC, M., BRIGHTWELL,G. and TAGG, J.R. 2008. Isolation of lactic acid bacteria withinhibitory activity against pathogens and spoilage organismsassociated with fresh meat. Food Microbiol. 25(2), 228–234.

KLAENHAMMER, T.R. 1988. Bacteriocins of lactic acidbacteria. Biochimie 70(3), 337–349.

KUIPERS, O.P., BUIST, G. and KOK, J. 2000. Current strategiesfor improving food bacteria. Res. Microbiol. 151(10),815–822.

LIU, S.Q. 2003. Practical implications of lactate and pyruvatemetabolism by lactic acid bacteria in food and beveragefermentations. Int. J. Food Microbiol. 83(2), 115–131.

LYNCH, M., PAINTER, J., WOODRUFF, R. and BRADEN, C.2006. Surveillance for foodborne-disease outbreaks – UnitedStates, 1998–2002. Morb. Mortal. Wkly Rep. Surveill. Summ.55(10), 1–42.

MACFARLANE, G.T. and CUMMINGS, J.H. 1999. Probioticsand prebiotics: Can regulating the activities of intestinalbacteria benefit health? BMJ 318(7189), 999–1003.

MANLEY, K.J., FRAENKEL, M.B., MAYALL, B.C. and POWER,D.A. 2007. Probiotic treatment of vancomycin-resistantenterococci: A randomised controlled trial. Med. J. Aust.186(9), 454–457.

MARTEAU, P.R., DE VRESE, M., CELLIER, C.J. andSCHREZENMEIR, J. 2001. Protection from gastrointestinaldiseases with the use of probiotics. Am. J. Clin. Nutr. 73(2),430S–436S.

MARUGG, J.D. 1991. Bacteriocins, their role in developingnatural products. Food Biotechnol. 5(3), 305–312.

MATSUSAKI, H., ENDO, N., SONOMOTO, K. and ISHIZAKI,A. 1996. Lantibiotic nisin Z fermentative production byLactococcus lactis IO-1: Relationship between production ofthe lantibiotic and lactate and cell growth. Appl. Microbiol.Biotechnol. 45(1), 36–40.

MCKINLEY, M.C. 2005. The nutrition and health benefits ofyoghurt. Int. J. Dairy Technol. 58(1), 1–12.

MESSENS, W. and DE VUYST, L. 2002. Inhibitory substancesproduced by lactobacilli isolated from sourdoughs – a review.Int. J. Food Microbiol. 72(1–2), 31–43.

NISSEN, H., MAUGESTEN, T. and LEA, P. 2001. Survival andgrowth of Escherichia coli O157:H7, Yersinia enterocolitica andSalmonella enteritidis on decontaminated and untreated meat.Meat Sci. 57(3), 291–298.

OGAWA, M., SHIMIZU, K., NOMOTO, K., TANAKA, R.,HAMABATA, T., YAMASAKI, S., TAKEDA, T. and TAKEDA,Y. 2001. Inhibition of in vitro growth of Shigatoxin-producing Escherichia coli O157:H7 by probioticLactobacillus strains due to production of lactic acid. Int. J.Food Microbiol. 68(1–2), 135–140.

OGUNBANWO, S.T., SANNI, A.L. and ONILUDE, A. 2003.Characterization of bacteriocin produced by Lactobacillusplantarum F1 and Lactobacillus brevis OG1. Afr. J. Biotechnol.2(8), 219–227.

OHASHI, Y., TOKUNAGA, M., TAKETOMO, N. and USHIDA,K. 2007. Stimulation of indigenous lactobacilli by thefermented milk prepared with probiotic bacterium,Lactobacillus delbrueckii subsp. bulgaricus strain 2038, in thepigs. J. Nutr. Sci. Vitaminol. (Tokyo) 53(1), 82–86.

O’SULLIVAN, L., ROSS, R.P. and HILL, C. 2002. Potential ofbacteriocin-producing lactic acid bacteria for improvementsin food safety and quality. Biochimie 84(5–6), 593–604.

OTA, A. 1999. Protection against an infectious disease byenterohaemorrhagic E. coli 0–157. Med. Hypotheses 53(1),87–88.

PETTI, S., TARSITANI, G. and D’ARCA, A.S. 2008. Antibacterialactivity of yoghurt against viridans streptococci in vitro. Arch.Oral Biol. 53(10), 985–990.

QUAN-XI, S. 2011. Effect of “wuqinxi” exercise on antioxidantstatus, intestine Bacillus acidophilus, Lactobacillus casei andBacillus bifidus in obese old people. J. Med. Plants Res. 5(11),2445–2447.

SCHILLINGER, U. and LUCKE, F.K. 1989. Antibacterial activityof Lactobacillus sake isolated from meat. Appl. Environ.Microbiol. 55(8), 1901–1906.

SCHREZENMEIR, J. and DE VRESE, M. 2001. Probiotics,prebiotics, and synbiotics – approaching a definition. Am. J.Clin. Nutr. 73(2), 361S–364S.

SPINNLER, H.E. and CORRIEU, G. 1989. Automatic method toquantify starter activity based on pH measurement. J. DairyRes. 56(05), 755–764.

SREEKUMAR, O. and HOSONO, A. 2000. Immediate effect ofLactobacillus acidophilus on the intestinal flora and fecalenzymes of rats and the in vitro inhibition of Escherichia coliin coculture. J. Dairy Sci. 83(5), 931–939.

SUDI, I.Y., DE, N. and DUNKRAH, U.A. 2011. Nigerianindigenous yoghurt (kindirmo) production usingLactobacillus bulgaricus and Streptococcus thermophilusmutants as starter culture. Afr. J. Biotechnol. 10(9),1651–1654.

TENNEY, D. 1996. Acidophilus, Midpoint Trade Books Inc,New York, NY.

THARMARAJ, N. and SHAH, N.P. 2003. Selective enumerationof Lactobacillus delbrueckii ssp. bulgaricus, Streptococcusthermophilus, Lactobacillus acidophilus, bifidobacteria,Lactobacillus casei, Lactobacillus rhamnosus, andpropionibacteria. J. Dairy Sci. 86(7), 2288–2296.

THOREUX, K., BALAS, D., BOULEY, C. and SENEGAS-BALAS,F. 1998. Diet supplemented with yoghurt or milk fermented



by Lactobacillus casei DN-114 001 stimulates growth andbrush-border enzyme activities in mouse small intestine.Digestion 59(4), 349–359.

TOBA, T., YOSHIOKA, E. and ITOH, T. 1991. Acidophilucin A,a new heat-labile bacteriocin produced by Lactobacillusacidophilus LAPT 1060. Lett. Appl. Microbiol. 12(4),106–108.

WACHSMUTH, I.K., SPARLING, P.H., BARRETT, T.J. andPOTTER, M.E. 1997. Enterohemorrhagic Escherichia coli inthe United States. FEMS Immunol. Med. Microbiol. 18(4),233–239.

WALTER, J., TANNOCK, G.W., TILSALA-TIMISJARVI, A.,RODTONG, S., LOACH, D.M., MUNRO, K. andALATOSSAVA, T. 2000. Detection and identification ofgastrointestinal lactobacillus species by using denaturing

gradient gel electrophoresis and species-specific PCR primers.Appl. Environ. Microbiol. 66(1), 297–303.

ZEINHOM, M., TELLEZ, A.M., DELCENSERIE, V., EL-KHOLY,A.M., EL-SHINAWY, S.H. and GRIFFITHS, M.W. 2012.Yogurt containing bioactive molecules produced byLactobacillus acidophilus La-5 exerts a protective effect againstenterohemorrhagic Escherichia coli in mice. J. Food Prot.75(10), 1796–1805.

ZHAO, T., DOYLE, M.P., SHERE, J. and GARBER, L. 1995.Prevalence of enterohemorrhagic Escherichia coli O157:H7 ina survey of dairy herds. Appl. Environ. Microbiol. 61(4),1290–1293.

ZHU, W.M., LIU, W. and WU, D.Q. 2000. Isolation andcharacterization of a new bacteriocin from Lactobacillusgasseri KT7. J. Appl. Microbiol. 88(5), 877–886.



antimicrobial effects of four lactobacilli strains isolated from yoghurt against e ...

Documents