antimicrobial effect of cranberry powder on e.coli atcc 25922 in apple cider and ground beef
TRANSCRIPT
Antimicrobial Effect of Cranberry Powder on E.coli ATCC 25922
in Apple Cider and Ground Beef
by
Jane Palakeel
A Research Paper Submitted in Partial Fulfillment of the
Requirements for the Master of Science Degree
With a Major ill
Food & Nutritional Sciences
Approved: 6 Semester Credits
The Graduate School University of Wisconsin-Stout
August, 2010
Author:
Title:
The Graduate School University of Wisconsin-Stout
Menomonie, WI
Palakeel, Jane J.
Antimicrobial Effect of Cranberry Powder on E.coli ATCC
25922 in Apple Cider and Ground Beef
Graduate DegreelMajor: MS Food and Nutritional Sciences
Research Adviser: Cynthia Rohrer, PhD
MonthNear: August, 2010
Number of Pages: 122
Style Manual Used: American Psychological Association, 6th edition
Abstract
The possibility of using cranberry powder as an antimicrobial agent was studied by
examining its effect on the growth of E coli A TCC 25922 in apple cider and ground beef and its
organoleptic properties in beef patties. The standard plate counts (SPC) results showed that
cranberry powder (2% w/w) reduced Ecoli ATCC 25922, by 0.43 log CFU/mL, in apple cider
(p>0.05) and 0.08 log CFU/g in ground beef (p<0.05) compared to their respective controls on day
6. Thus demonstrating that 2% w/w cranberry powder posses antimicrobial benefits when
2
incorporated in ground beef but not as well in apple cider. RT-PCR showed results contrary to that
observed in SPC. Cranberry powder (2% w/w) significantly reduced E coli ATCC 25922 (p<0.05),
by 0.83 log CFU/mL in apple cider but showed less antimicrobial activity in ground beef compared
to the control. At least one hundred panelists evaluated beef patties supplemented with and without
cranbeny powder. No significant difference for color, cooked beef flavor, cardboard flavor, grainy
texture, aftertaste, overall acceptance and preference were found among beef patties with 0%, and
2% w/w cranberry powder on day 0 (p>0.05) except for sweetness and juiciness which were both
significantly greater in cranberry supplemented beef patties. Therefore, 2% w/w concentration of
cranberry powder can be considered an ideal concentration to be added into ground beef patties.
3
The Graduate School University of Wisconsin-Stout
Menomonie, WI
Acknowledgements
I would like to express my sincere gratitude to the following individuals for their help,
contribution, effort, encouragement in completion of my thesis work. I would like to thank Dr.
Cynthia Rohrer, for her tremendous contribution to my thesis completion by involving in framing,
editing the research proposal, designing the sensory tests, editing my thesis, research poster and for
her constant encouragement. Dr. Kitrina Carlson for helping set up the microbiology experiments,
developing the methodology, providing work space and supplies, and for great moral support and
help in completing my thesis work. I would like to thank Dr. Carolyn Barnhart for editing my
thesis and instilling the zeal in me to complete my thesis work. I would like to thank Dr. Marcia
Miller for providing me valuable inputs for my research and for editing my thesis. I would like to
specially thank the Biology department, for providing the laboratory equipment, reagents and
microbiology media and the space to carry out the experiments for the research. I would like to
4
thank the Cranberry Seed Oil Company for providing the cranberry powder to conduct my research.
I would like also thank Dr. Steve Nold for guiding, helping me with data analysis and directing me
towards completing the last components of my research work. I would like to thank my family
members and friends, without their valuable support, advice and help I would not have been
successful in achieving my goal. Last but not least, I would like to thank God for giving me the
strength to overcome all the uphill battles I faced during my research work.
5
Table of Contents
..................................................... . .............................................. . . . . . .... , .... Page
Abstract ..................................................... . ......................................... .. ........... 2
List of Tables ... . ........................................ . ......................................................... 9
List of Figures ... ........................................ ........................................ . .... .. .......... 10
Chapter 1: Introduction ............... .. .. · .... . ........ . ..... . . ... .. . ......... ...... .... .. .. .. .. .... .. .... .. .... . 12
Statement of the Problem ............ . ... ......... . . . .... . ................................. ... ........ . 15
Research 0 bj ecti ves ............................ . .. . ......... . .................................. . ....... 15
Assumptions of the Study ............ .. .......... .. ... . ....................................... ... ..... 16
Definition of Terms .................................................................................... 16
Limitations of the Study ................ ' " .. '" ... . .. ........ ................................... . ..... 17
Chapter II: Literature Review ........................................ . ...... . ............ . ..... .... .. ... . .... .. .. 18
History of Cranberries . . ... . .... ....... . .. . .... . ..... ' . .. . ... ... ................................... , ..... 18
Cranberry Species and Attributes .................. . .......... . ....................................... 19
Cranberry Cultivation Factors ....................... . .......................................... .. ..... 19
Dry Harvesting ............................... . ................................................. 20
Wet Harvesting ................... . .... . .... . . . ... . ...................................... . ..... . 20
Processing of CranbelTies ........................... . ... . .. . .... ... .. ... ....... . .. . ... . .. ............. . 21
Physiochemical Quality .. .. .... ........ ... . .. . ...... . . . . . ..... . .. ... . .... . . . ........ ....... . ... . ........ 21
Polyphenols .. ................................................................................... 22
Phenolic Acid Chemistry of Cranberries ... . ..... .. .......... ...................... . ....... 22
Flavonoid Chemistry of Cranberries .............. . . . ........................................ 23
Flavonols .......... .................. ..... . ...... . ..... .. ..... . ......... ........................ 24
6
Flavanols .......................................................................... . ..... . ...... 26
Proanthocyanidins ............................................................................ 27
Anthocyanins ................................................................................... 28
Resveratrol ...................................................................................... 29
Nutritive Quality ........................................................................................ 30
Health Benefits ......................................................................................... 31
Urinary Tract. .............................................................. . ..... . ........ . ... 31
Helicobacter Pylori ........................................................................... 33
Prevention of Kidney Stone Information .................................................. 34
Cardiovascular Diseases ............................................................. . ....... 35
Antimicro bial Properties ...................................................................... 36
Antioxidants .................................................................................... 39
Anticancer. ..................................................................................... 40
Dental Plaque .................................................................................. 41
Cranberry Powder. ..................................................................................... 42
Engineering of Cranberry Powder ......................................................... .42
Antimicrobial Effects of Phenolic and Organic Acids ............................................ .43
Inhibition of E.coli 0157 :H7 in Apple Cider. ...................................................... .44
Inhibition ofE.coli 0157: H7 in Ground Beef.. .................................................... 46
Real Time Polymerase Chain Reaction ................................................... . ......... .47
Sensory Evaluation ..................................................................................... 48
Chapter III: Methodology ....................................................................................... 51
Sample Selection and Description .................................................................... 51
7
Bacterial Strain ................................................................................. 52
Reagents ........................................................................................ 52
Preparation of Mueller Hinton Agar. ....................................................... 53
Methanol Extraction and Vacuum Filtration ....................................................... 53
Kirby Bauer Disk Diffusion (Antimicrobial Disk Method) ...................................... 53
Microanalysis for Apple cider. ....................................................................... 54
Apple Cider Preparation ..................................................................... 54
pH Measurement ............. " .............. , ............. , ..... , ............................ 56
Microanalysis for Ground Beef. ..................................................................... 56
Ground Beef Preparation ..................................................................... 56
pH Measurement .............................................................................. 57
Sensory Evaluation .................................................................................... 57
Genomic DNA Extraction ............................................................................ 59
Real Time PCR Analysis .............................................................................. 60
Data Analysis ........................................................................................... 61
Chapter IV: Results and Discussion .......................................................................... 62
Methanol Extraction ................................................................................... 62
Antimicrobial Effect of Cranbeny Powder In Apple Cider. ..................................... 64
Antimicrobial Effect of CranbelTY Powder In Ground Beef. .................................... 69
Comparison of E. coli Population in Cranbeny Powder Added Apple Cider and Ground
Beef. ..................................................................................................... 76
Quantification by RT-PCR ................................................................................. 77
Sensory Evaluation .................................................................................... 87
Chapter V: Conclusion ......................................................................................... 92
8
Recommendations .... ....... . ...... .. ..................................................... . ........... 96
References .. ..... . ..... . ... .. ..... . . ..... .. ... . .................................................................. 97
Appendix A: Sensory Advertisement. ................. '" ..... . ........................................... 121
Appendix B: Beef Patty Scorecard .......................................................................... 122
List of Tables
Table 1: Apple Cider and Ground Beef Treatments .................................................... 55
Table 2: Samples and Three Digit Codes Assigned ................................................... 59
Table 3: Diameter of Zone ofInhibition of CranbelTy-Methanol Extract on
Saureus ATCC 25923, Ecoli ATCC 25922 and Styphimurium .................................. 64
Table 4: Colony Forming Units (CFU/mL) of Ecoli ATCC 25922 in Apple Cider with and
without Cranbeny Powder at different Dilutions on Day 0, Day 2, Day 4, and Day
6 ................................................................................................... 66
Table 5: Means and Confidence Intervals of Colony Fonning Units (log CFU/mL) in Apple
Cider with and without Cranberry Powder .................................................. 67
Table 6: Colony Forming Units (CFU/g) of Ecoli ATCC 25922 in Ground Beef with and
without Cranberry Powder at different Dilutions on Day 0, Day 2, Day 4, and Day
6 ................................... ~ ............................................................... 71
Table 7: Means and Confidence Intervals of Colony Forming Units (log CFU/g) in Ground Beef
with and without Cranbeny Powder ......................................................... 72
Table 8: Concentrations of Serially Diluted Ecoli DNA with adding Cranbeny Powder.. ....... 81
Table 9: Concentrations of Serially Diluted Ecoli DNA without adding Cranbeny Powder... 81
Table 10: Mean Concentrations of Ecoli ATCC 25922 DNA in Apple Cider with
and without Cranbeny Powder. ................. . ............................................ 82
Table 11: Mean Concentrations of Ecoli ATCC 25922 DNA in Ground Beef with
and without Cranbeny Powder .............................................................. 84
Table 12: Mean Sensory Attributes of Control and Cranbeny Powder added-Ground Beef
Patties ................ .. , ........................... .. ................... .... ...................... .. ........... 87
9
10
List of Figures
Figure 1: Caffeic acid, Sinapic acid, p-Coumaric acid and Benzoic acid .............. ...... ....... 23
Figure 2: Quercetin and Myricetin .......................... .... ... . ......................... .. .... .. ..... 26
Figure 3: Procyanidin dimer AI and Procyanidin dimer A2 ........................................... 28
Figure 4: Cyanidin and Peonidine ............... . .. ..... .......... . ................................... ... 30
Figure 5: Apple Cider ( concentrate) and Ground Beef Treatments .................................... 52
Figure 6: Serial dilution and spread plating technique ................................................. 57
Figure 7: Dilution of sample and stomaching in stomacher ........................................... 58
Figure 8: Sample Preparation and taste testing in sensory booth ............. . ......... . .. .. ... . ..... 60
Figure 9: C1000 Thermal Cycler ... . . .... .................. . ..... . ........... . ... ......................... 61
Figure 10: Inhibition of Ecoli ATCC 25922 in Apple Cider with and without CranbelTY Powder
on Day 0, Day 2, Day 4, and Day 6 .............................................................. 69
Figure 11: Plate Counts of E coli A TCC 25922 in Ground Beef with Cranberry Powder on Day
2 ...... ... ........... . ............. .. ........... .. ............... . ......... .. .............................. 74
Figure 12. Plate Counts of Ecoli ATCC 25922 in Ground Beef without CranbelTY Powder on
Day 2 .... .. ... .................... .. ........ . ... . ..... . .......................... .. . .. .. ... .. ... .. 74
Figure 13: Inhibition of E coli ATCC 25922 in Ground Beef with and without Cranberry Powder on
Day 0, Day 2, Day 4 and Day 6 .................................................................................. 75
Figure 14: Inhibition of Ecoli ATCC 25922 in both Apple Cider and Ground Beef having added
CranbelTY Powder on Day 0, Day 2, Day 4 and Day 6 .................... . ................. 77
Figure 15 : Melting Curve for Ecoli ATCC DNA sample at 10-1 dilution ............................ 78
Figure 16. Amplification of Serially Diluted E coli DNA with and without Cranberry
Po\vder. ......................................................................................... 79
11
Figure 17. Standard Curve for Ecoli ATCC 25922 with Cranbeny Powder ..................... 80
Figure 18 . Standard Curve for E coli ATTC 25922 without Cranbeny Powder .... .............. 80
Figure 19. Concentrations of E coli A TCC 25922 in Apple Cider with and without Cranberry
Powder on Day 0, Day 2, Day 4 and Day 6 ............................ .... ............... 83
Figure 20. Concentrations of E coli A TCC 25922 in Ground Beef with and without Cranbeny
Powder on Day 0, Day 2, Day 4 and Day 6 ............................................... 86
Figure 21: Overall acceptance of Control and 2% w/w Cranberry Powder added-Beef
Patties . .................. . .................. .. ................................................... 89
Figure 22: Preference of Control and 2% w/w Cranbeny Powder added-Beef
Patties . .. ....... ........ ... . ................... .. ............. . . ................. . .............. 90
12
Chapter I: Introduction
Foodborne disease sickens an estimated 76 million people each year in the United States,
accounting for 325,000 hospitalizations and more than 5,000 deaths (Centers for Disease Control
and Prevention, 2005). Foodborne illnesses are considered those diseases, usually either infectious
or toxic in nature, that are caused by variety of microbes such as bacteria , fungi, viruses and
parasites that enter the body primarily by the ingestion of contaminated food (World Health
Organization, 2007). Statistics show that one in four Americans become sick due to the
consumption of foods containing harmful pathogens such as Escherichia coli 0157 :H7, Salmonella,
Hepatitis A, Campylobacter, Shigella, or Norovirus (Injury Aleli, 2010).
Escherichia coli 0157:H7 is a food borne pathogen that has been associated with meat,
produce, and water-related disease outbreaks (Hrudey et aI., 2003 ; Kassenborg et aI., 2004;
Sivapalasingam et al., 2004). This pathogen, which is known for its low infective dose level and its
ability to cause severe disease and death, emerged as a food borne threat in the 1980s and early
1990s (Riley et aI., 1983; Tuttle et aI., 1999). It is reported that incidences of E. coli contamination
and foodborne illness have been occurring more in the United States (Wu et aI., 2009). It has been
estimated that 73 ,000 cases of E.coli contamination occur in the United States every year, with
about 60 of those cases ending in death (Centers for Disease Control and Prevention, 2005).
Until recently, fruit juices were not recognized as vehicles of foodborne illness because of
their low pH and high organic acid levels (Mazzotta, 2000; Sheryl & Harris, 2001). However,
several outbreaks associated with unpasteurized fruit juices have been reported in the last decade,
and as a consequence, issues surrounding the safety of juice products started to be addressed
(Anderson & Bailey, 2001). Escherichia coli 0157:H7 and Salmonella serotype Typhimurium
(Besser et aI., 1993; Centers for Disease Control and Prevention, 1975; Centers for Disease Control
and Prevention, 1996) have been involved in foodbome outbreaks transmitted by unpasteurized
apple cider.
Therefore more recently, sorbate and benzoate were found to be effective against E.coli
13
o 157:H7 in apple cider (Zhao et aI., 1993). The addition of cranberry juice to apple cider (cran
cider process) at a 15% (v/v) level; followed by warm hold and freeze thaw steps, achieved a 5-log
reduction in the numbers of E. coli 0157 :H7, Salmonella serovars and Listeria monocytogenes. The
cranbeny-cider process provides a novel way to improve microbial safety of unpasteurized apple
cider, but it does not meet Food & Drug Administration (FDA) mandated pathogen reductions for
wholesalers (Ingham et aI. , 2006). However, sellers making apple cider at a retail level could
implement this process to improve product safety
The beef industry has suffered through difficult years of recalls , many of them caused by the
presence of E. coli bacteria in ground beef (Chicago Tribune, 2008). Because early outbreaks were
associated with ground beef, the United States Department of Agriculture Food Safety and
Inspection Service produced several regulations aimed at eliminating this pathogen from red meat
(Tenance et aI., 2005). Unfortunately, no single intervention or combination of interventions have
yet been identified that will eliminate E. coli 0 157:H7 from beef, and sporadic beef associated
outbreaks of E. coli 0 157:H7 have continued to occur. In 2008, the largest ever recall hit America,
with around 143 million pounds of beef were associated wi th 43 cases of E. coli 0157 :H7
contamination (United States Dep31iment of Agriculture, 2008).
Recent findings (Wu et aI., 2008) indicated that cranbelTY concentrate exhibits antimicrobial
properties against commonly occuning foodborne pathogens. Cranbeny concentrate contains organic
acids, anthocyanins and non-anthocyanins polyphenolic compounds (Hong &Wrolstad, 1986; Kim &
14
Lee, 2005). Its use in ground beef was demonstrated as a natural food preservative and an inhibitor of
E.coli 0157:H7 growth.
Cranberry (Vaccinium macrocarpon), a Native American fruit, has traditionally been used
to treat urinary tract infections, diatThea, and blood poisoning. Cranberries contain many bioactive
compounds such as proanthocyanidins and flavonols that have antioxidant, antimutagenic,
antihypercholesterolemic and other health benefits (Cunningham et ai. , 2004; Vattem et ai., 2005,
Neto, 2007). The proanthocyanidins and flavonols are found to be major microbial inhibitors of
cranberry other than benzoic acids (Aref et ai., 1986). Cranberry's antimicrobial effects offer
considerable promise as a natural and effective tool to prevent food borne outbreaks (Wu et ai.,
2009).
Cranberries are a native species to Wisconsin and influence its economy both in value and
acreage. According to the Economic Research Service of the United States Department of Agriculture,
Wisconsin was the leading producer of cranberries in the year 2006. The majority of harvested
cranberries are futiher processed into juice. The processing makes use of only 85 % of the fruit. The
remaining 15%, which comprises the nutritious portion of cranberry such as the skin, seed and pomace
are unfotiunately discarded as waste (Fruit Essential, 2006). Cranberry waste disposal not only
removes the healthier parts of cranberry but also creates serious economic and environmental problems
that the cranbeny industry has been tackling for years.
Recently food technologists have developed a powder from cranbeny waste, with this powder
containing all the essential and branched chain amino acids, essential fatty acids, anthocyanins,
phenolic, phytosterol, phospholipids, minerals, vitamins, and dietary fiber similar to cranberry
concentrate (Sojitz Corporation, 2007).
15
However, no published research has been conducted on the antimicrobial effects of this
powder on foodborne pathogens. Therefore it is postulated that cranberry powder may offer
antimicrobial benefits against Ecoli 0157:H7 similar to cranberry concentrate on supplementation
into apple cider and ground beef.
A nonpathogenic heat resistant strain, E coli A TCC 25922, has been shown to be a potential
surrogate organism for E coli 0157 :H7 and Salmonella in terms of growth and survival
charactersistics. These surrogate strains may be useful for evaluating the efficacy of intervention
steps in reducing populations of selected strains of E coli 0157 :H7 and Salmonella in processing
environments where these pathogens cailllot be introduced (Denise et aI., 2005). Therefore in this
study, Ecoli ATCC 25922 has been used to mimic the pathogenic strain Ecoli 0157:H7 and
elucidate the antimicrobial properties of cranbeny powder and the combined effects of temperature
and pH against E coli A TCC 25922 in apple cider and ground beef.
Statement of the Problem
Due to the increased incidence of E coli contamination and foodborne illness , this study was
designed to determine if adding cranberry powder to apple cider and ground beef helped
significantly suppress or reduce the growth of E coli ATCC 25922 in apple cider and ground beef.
Research Objectives
1. Explore the potential antimicrobial effects of cranberry powder at (2% w/w
concentration) on Ecoli ATCC 25922 in apple cider stored at 4°C (refrigeration
temperature) for 6 days.
2. Explore the potential antimicrobial effects of cranberry powder at (2% w/w
concentration) on E coli A TCC 25922 in ground beef stored at 4°C (refrigeration
temperature) for 6 days.
16
3. Compare the microbial population, in apple cider and ground beef after adding cranberry
powder.
4. Quantify E.coli population using Real Time Polymerase Chain Reaction CRT-PCR) in
apple cider and ground beef.
5. Conduct a sensory evaluation of cooked beef patties supplemented with 2% w/w
concentration of cranberry powder at day 0 for color, sweetness, cooked beef flavor,
cardboard flavor, grainy texture, juiciness, overall acceptance and preference of the beef
patties.
Assumptions of the Study
There are two assumptions in the research study. One assumption is that the growth of
E. coli ATCC 25922 in apple cider and ground beef will be able to be studied in six days . The
second assumption is that the ground beef patties will be unifonnly mixed with 2% w/w cranbelTY
powder and cooked thoroughly and uniformly for sensory evaluation.
Definition of Terms
Antioxidant. Phytochemicals capable of preventing oxidation of molecules .
Anthocyanins. Water soluble pigments that form a parent class of flavonoids.
Essential amino acids. Amino acids that cannot be synthesized in the body and therefore
need to be supplemented in the diet.
Essential fatty acids. Fats that are not synthesized in the body and therefore must be
supplied in the diet.
Flavonoids. Group of polyphenolic compounds that are found in plants.
Foodborne il1nesses. Defined as diseases, usually either infectious or toxic in nature,
caused by variety of microbes such as bacteria, fungi, viruses and parasites that enter the body
through the ingestion of food (World Health Organization, 2007).
Pathogens. Disease causing organisms.
Pbytosterols. Sterols that are concentrated in vegetables and the seeds of fruits.
Polyphenols. Sub classes of phytochemicals that include over 8,000 compounds that are
thought to play many important roles in the body (Groff, Grouper, & Smith, 2005).
Proanthocyanidins. Class of flavanols derived from plants that have potential health
benefits.
Phospholipids. Class of lipids found mainly in the cell membrane.
Recalls. Requests made by the manufacturer of a defective product to return the product.
Limitations of the Study
17
There are three limitations for this study. The first limitation is that ground beef is prone to
oxidation which could affect the sensory results. The second limitation is that cranberry powder
does not dissolve in apple cider and does not distribute uniformly within the ground beef which
may thus influence the effect of the cranberry powder on E. coli population. The third limitation is
that RT-PCR may give false positive results while detecting and quantifying E. coli ATCC 25922 in
apple cider and ground beef.
18
Chapter II: Literature Review
History of Cranberries
Cranberries (Vaccinium macrocarpon) along with blueberries and Concord grapes are one
of the only three indigenous fruits grown commercially in North America. Native Americans were
the first to recognize cranberries as having a variety of uses in foods, dyes and medicines. The
European settlers in Massachusetts gained knowledge on cranberries and were served cranberries at
the first Thanksgiving Feast. The cranberry gets its name from the Pilgrims who named it as
'craneberry ' due to its small pink blossoms resembling the head and bill of a Sandhill crane
(Wisconsin State Cranberry Growers Association, 2010). Captain Henry Hall, an American veteran
from Massachusetts, was the first to initiate the commercial cultivation of the cranbeny in 1816.
Hall's techniques were copied by other growers which led to the increased production of
cranberries throughout the 19th century. Cranberry production was so popular that in 1871 the first
association of cranberry growers was established (Cape Cod Cranbeny Growers Association,
2010). The early 19th century was a period of cranberry research and several cranberry related
inventions. The first mechanical ride-on dry harvester for instance, was invented by Oscar Tervo
(Cape Cod Cranberry Growers Association, 2010). In 1959, the cranberry market crashed after an
announcement made by Arthur S. Flemming, the Secretary of Health, Education and Welfare,
indicating that the cranberry crop contained traces of herbicide aminotriazole (Barbara, 1994). The
cranberry industry lost millions in revenue due to the ban on sales. However, Ocean Spray®'s
rigorous efforts and huge investments to produce improved cultivars helped increase cranbeny
production. With the successful introduction of Ocean Spray®' S new products such as the cranbeITY
cocktail, cranapple juice, jams, and jellies, the cranberry gained in market share in 1964 (Cape Cod
Cranberry Growers Association, 2010). During the 1980's and in subsequent years, the
19
international demand for cranberries increased, leading to a historic peak in the price of cranberries
and additional opportunities for growers.
Cranberry Species and Attributes
Cranberries are a major crop grown in the United States, especially in Maine,
Massachusetts, Michigan, Mirmesota, New Jersey, Oregon, Washington, and Wisconsin.
According to the Economic Research Service of the United States Department of Agriculture
(2008) Wisconsin is the leading producer of cranberries, with over half of United States production
followed by Massachusetts. The majority of cranberries that are harvested in the United States are
from the species of Vaccinium macrocarpon known commonly as the American cranberry or
bearberry. This species of cranberries are native to the northeastern region of North America. This
evergreen trailing shrub has pinkish-whitish bell-shaped flowers that grow either singly or in
clusters, upon slender stems. The leaves are glossy and leathery with a size that ranges from 10-20
mm. In the autumn season, the shrubs produce bright red, oval berries with a pulp that contains
high fiber, acidity and numerous seeds making it unpalatable when eaten raw. The flavor of the
Vmacrocarpon can be described as a slightly apple-like taste (United States Department of
Agriculture, 2007). Cranberries are unique fruits that can grow only under a special combination of
factors.
Cranberry Cultivation Factors
An acidic peat soil base, a top layer of sand and an abundant fresh water supply are the key
factors to a successful cranberry harvest (Ocean Spray®, 2007) . Proper combination of soil and
water are required for the survival of cranberries . Massachusetts, Wisconsin, and Oregon all
provide these ideal conditions and a growing season from May to October. The cranberry plant is a
low-hanging vine found in temperate regions. These vines are set inside impermeable beds referred
20
to as "bogs" or "marshes" that contain layers of sand, peat, gravel , and clay. In addition, these beds
are developed by glacial deposits through natural means. The bogs also contain dikes . Dikes are
created by forming a ridge of soil around the perimeter of the bogs. These dikes enable the bogs to
be flooded prior to harvesting the cranberries and to protect the vines during the winter season.
Irrigation equipment is used to provide sufficient water to the cranberry vine for proper growth and
at times for frost protection. Frost prevention is a very crucial step as frost can ruin an entire year ' s
crop (Ocean Spray@, 2007). Cranberry growers monitor temperatures and sprinklers 24 hours a day
to prevent frost formation . During the growing season, the cranberry beds are irrigated in order to
maintain proper soil moisture levels (Ocean Spray@, 2007). Cranberries are harvested once a year
from mid-September through early November when they reach a deep red color. There are two
methods of harvesting cranberries namely dry and wet (Cape Cod Cranberry Growers, 2010).
Dry Harvesting. During dry harvesting of cranberries, they are taken off of their vines and
collected in burlap bags by the use of a mechanized picking machine (Burlington County Library
System, 2007). After a sufficient amount of bags are filled, they are then removed from the bogs
using bog vehicles or helicopters. The dry harvested cranberries are sold generally to fresh fruit
markets and grocery stores and are used by consumers for baking and cooking purposes. This
traditional method of harvesting represents only 10% of the cranberry harvest. The remaining 90%
of the crop is harvested using the wet harvesting method.
Wet Harvesting. During wet harvesting a section of the bog is flooded with six to eight
inches of water allowing the cranberries to detach from the submerged vines and float on the
surface of the water. The floating cranberries are then collected and pumped or conveyed out of the
bogs into waiting trucks to be transported to processing plants (Burlington County Library System,
2007).
21
Processing of Cranberries
The majority of harvested cranberries are fUliher processed to make fruit juice and other
cranberry food products; 35% are processed into sauce products and 60% are processed into various
fruit drinks (Ghaedian, Shetty, & Vattem, 2005). In cranberry juice processing, the fruits are
frozen, thawed, extracted, filtered and then concentrated into 50° Brix juice concentrate (Diane et
al.,2004). The concentrate is fUliher processed into cranberry juice drinks. Pressing, mash
depectinization, and counter current extraction are the different methods for extracting juice from
cranberries (Hui et ai., 2006a). Pressing enables high quality juice with stable color and excellent
flavor attributes since no heat is involved during the process. Once the juice is pressed , it is filtered
using screens or membranes. The filtered juice is concentrated to improve microbial stability and
reduce storage volume. The concentrate is stored at -18°C in drums for industrial usage. Only 85%
of the total cranberry is used for processing into juice; while the remaining 15% of the cranberry
consists of the skin, seeds, and pomace (Fruit Essentials, 2006). Cranberry pomace, the by-product
of cranberry processing, has been traditionally used as an ingredient in animal feed or disposed into
soils, where it poses significant economic problems. However, a recent study has shown that dried
cranberry pomace contains six anthocyanins including derivatives of cyanidin and peonidin along
with thilieen flavonols of which myricetin and quercetin were the most prominent (Brittany et ai.,
2009). Cranberries are known for their diverse phytochemical profile.
Physiochemical Quality
The cranberry fruit has a unique chemical composition that sets it apart from other North
American fruits. Cranberries are an excellent source of anthocyanins (Hong & Wrolstad, 1986;
Mazza & Miniati, 1993; Prior et ai., 2001; ZapsaJis & Francis, 1965), flavonol glycosides (Kandil et
ai., 2002 ; Puski & Francis, 1967), proanthocyanidins (Foo & Porter, 1980; Hale et ai., 1986; Kandil
et al., 2002; Prior et al., 2001) and phenolic acids (Zuo et al., 2002). The major phenolic
compounds in the beny are phenolic acids and flavonoids . Chen et al. (2001) found a total of 400
mg of flavonoids and phenolic compounds per liter of sample in freshly squeezed cranbeny juice;
and approximately 44% were phenolic acids and 56% flavonoids .
22
Polyphenols. Polyphenols are a group of phenolic phytochemicals found abundantly in a
variety of fruits and vegetables. Polyphenols contain 12-16 phenolic groups and 5-7 aromatic rings
per 1000 relative molecular mass (Shetty, 2006). Common fruits such as apples, cranben'ies,
grapes, raspbenies, and strawberries and their beverages are rich sources of polyphenols (Vattem et
al., 2005). Polyphenolic antioxidants are considered premier disease fighters that protect the body
against free radicals or unstable molecules that can cause cell damage leading to chronic and
degenerative diseases (Hoelzl et aI., 2005). Recently, polyphenols have received considerable
attention due to their health-promoting and disease-preventing benefits. Polyphenols can be
classified into simple phenols and phenolic acids, flavonoids, and hydrocinnamic acid derivatives
(Feno-Luzzi et aI., 1997).
Phenolic Acid Chemistry of Cranberries. Phenolic acids present in plants are
hydroxylated derivatives of benzoic and cinnamic acids (Herrmann 1989, Naczk & Shahidi, 2005).
Cranbenies contain about 1 g/kg of fresh weight of phenolic acids (Zuo et ai., 2002), predominantly
as glycosides and esters (Chen et ai., 2001). The phenolic acids identified in cranbeny are ortho,
meta and para-hydroxybenzoic acid, p-hydroxyphenyl acetic acid, 2,3-dihydroxybenzoic acid, 2,4-
dihydroxybenzoic acid, vanillic acid, o-hydroxycinnamic acid , caffeic, p-coumaric acid, ferulic and
sinapic acid (Marwan & Nagel, 1982; Zuo et aI., 2002). Hydroxybenzoic acids have. a general
structure of C6-C I derived directly from benzoic acid. Variations in the structures of individual
hydroxybenzoic acids arise by hydroxylations and methylations of the aromatic ring (Macheix et
23
al ., 1990) which are demonstrated in the Figure 1. The two most commonly occuring
hydroxy benzoic acids found in cranberries are p-hydroxybenzoic acid and vanillic acids. They may
be present in soluble form conjugated with sugars or organic acids as well as bound to cell wall
fractions (Schuster & Henmann, 1985). Hydroxycinnamic acids usually occur in various
conjugated forms; the free forms are artifacts from chemical or enzymatic hydrolysis during tissue
extraction. The four most widely distributed hydroxycinnamic acids in cranberries are p-coumaric,
caffeic, ferulic and sinapic acids (Macheix et aI., 1990). Ellagic acids are present in high
concentrations in many berries including strawberries, raspberries, cranberries, and grapes (Marwan
& Nagel, 1982; Chen et aI., 2001). Ellagic acid is a naturally occuring phenolic lactone flavonoid
that has antioxidative (Osawa et aI., 1987, Frankel, 1993, Rice-Evans et aI., 1996, Robards et aI. ,
1999) and anti carcinogenic effects (Hayatsu et aI., 1988, Strube et aI., 1993, Shanna et aI., 1994,
Stavric, 1994; Naczk & Shahidi, 2005). The phenolic acids contribute to the sensory and nutritional
quali ties of cranberries.
POCH~OH
.. 1 OCH:)
HOOC P·oo
r.6-I
HOOC
Figure 1. Caffeic acid, Sinapic acid, p-Coumaric acid and Benzoic acid
Flavonoid Chemistry of Cranberries. Flavonoids are a sub-class of polyphenols derived
from the secondary metabolism of plants that consist of two aromatic rings linked through a three
carbon bridge that usually fonn an oxygenated heterocycle having a C6-C3-C6 backbone structure
(Shetty,2006). Flavonoids are divided into two main classes, those in which the three-carbon
bridge is "open" and those in which the three-carbon bridge is involved in a heterocyclic ring,
referred to as ring 'C'. Variations in ring 'C ' and the various substitution patterns available for
24
rings A and B allow for a variety of flavonoid structures (Hollman & Katan, 1997). Flavonoids
possess significant antioxidant properties such as scavenging oxygen free radicals or chelating
metals (Salah et a!., 1995 ; Rice-Evans et a!., 1996; Cao et aI. , 1998; Sugihara et aI., 1999). The
polyphenol structures of flavonoids contain numerous double bonds, and hydroxyl groups that
donate electrons through resonance to stabilize the free radicals (Machlin & Bendich, 1987). The
radical scavenging properties associated with the structure of flavonoids defend against oxidative
stress and in doing so, may reduce heart disease, prevent cancer, and slow the aging processes in
cells responsible for many degenerative diseases (Hollman & Katan, 1997). There are several
subclasses of flavonoids: flavanols , flavanones, flavones, isoflavones, anthocyanidins,
proanthocyanidins and flavonols (Hollman & Katan, 1997). Cranbenies contain three major classes
of flavonoids: flavonols, flavanols, proanthocyanidins, and anthocyanins. Resveratrol is the non
flavonoid compound found in cranberry.
Flavonols. Flavonols are pale yellow, poorly soluble substances present in flowers and
leaves of at least 80% of higher plants and also in fruits and benies (Kuhnau, 1976). Flavonols
occur in foods usually as o-glycosides, with D-glucose being the most common sugar residue. The
preferred binding site for the sugar residue is C3 and less frequently the C7 position (Henmann,
1976, 1988). The flavonols identified in cranberry fruits are quercetin, quercitin 3-0-galactoside
(hyperin), quercetin 3-0-arabinoside, quercetin 3-0-rhamnoside (quercitin), myricetin 3-0-
arabinoside and 3-0-digalactoside (Kandil et aI., 2002; Puski & Francis, 1967). The total flavonol
content of cranbeny fruit usually falls in the range of 20-30 mg/l 00 g fresh fruit weight (Catherine,
2007). Quercetin is the major flavonol found in cranberry. Quercetin is one of the most
biologically active compounds among flavonoids (Middleton, 1998). When quercetin (3,5,7,3' ,4'
pentahydroxyflavone) reacts with a free radical, it donates a proton and becomes a radical itself, but
25
the resulting unpaired electron is delocalized by resonance, making the quercetin radical too low in
energy to be reactive (Mariani et a!., 2005). Three structural groups aid in quercetin's ability to
maintain its stability and act as an antioxidant when reacting with free radicals: the Bring 0-
dihydroxyl groups, the 4-oxo group in conjugation with the 2, 3- alkene, and the 3- and 5- hydroxyl
groups (Hollman & Katan, 1997). Among the flavonoids, quercetin is one of the most extensively
studied with regard to anticancer activity because of its prevalence among fruits and vegetables.
There are numerous reports of quercetin's ability to inhibit proliferation of cancer cell lines in vitro ,
including breast, colon, pancreas, and leukemia (Lee et aI., 2004 ; Choi et a!., 2001). Its
mechanisms of chemopreventive action includes induction of apoptosis, observed in Hep02
hepatoma and colorectal cells, with the anest of the Hep02 cell cycle in 0 1 phase (Choi et aI., 2001;
Ramos et aI., 2005; Richter et aI., 1999); inhibition of epidermal growth factor receptor expression
and associated tyrosine kinase activity (Lee, 2002; Richter et aI., 1999); reduced expression of Ras
protein in colon cancer cells and primary colorectal tumors (Ranelletti et aI., 2000); increased
expression of endogenous inhibitors of matrix metalloproteinases (Morrow et aI., 2001); and
phytoestrogenic activity involving interaction with the estrogen (J.- and j3-receptors of human
mammary MCF-7 cells (Hanis et aI., 2005).
A study conducted on highbush bluebenies, cranberries, and blackbelTies aimed to
determine the difference in the distribution of quercetin, kaempferol, and myricetin, and found that
the total content of quercetin and myricetin in cranbeny fruit to range from 73-250 mg and from 4 .0
to 26 .7 mg/kg fresh of weight, respectively (Bilyk & Sapers, 1986). Due to its abundance in the
diet, its commercial availability in dietary supplements and its biological activity, quercetin is
commonly studied in experimental and clinical studies. Quercetin's ability to prevent the oxidation
of low-density lipoproteins (LDL) may aid in the prevention of ce11ain diseases, such as cancer,
26
atherosclerosis, and chronic inflammation (Hollman & Katan, 1997; Murota & Terao, 2003).
Quercetin, myricetin and kaempferol, are effective glucosyl transferases (GTF) inhibitors. GTF are
enzymes responsible for dental plaque. The inhibitory effect of these compounds has been due to
the presence of an unsaturated double bond between C-2 and C-3, shown in Figure 2, which
provides a site for nucleophilic addition of the amino acids side chains of GTF (Koo et aI. , 2002).
Small quantities of Kaempferol (0.6 to 2 .7 mg/kg fresh weight) were also detected in some
cranberry varieties (Amakura et aI., 2000; Bilyk & Sapers, 1986).
HOlYO I
YI1 OR
OH 0
OH
OH
Figure 2. Quercetin and Myricetin
OH
HO
OR
OH 0
OH
OH
Flavanols. Flavanols are a complex group of polyphenols characterized by a C6-C3-C6
skeleton with a hydroxyl group in position three of the C-ring (Pascaul-Teresa & Cristina, 2010).
Flavan-3-0Is represent the largest class of monomeric C6-C3-C6 flavanols. Cranberry flavan-3-ols
include catechin, catechin gallate, epicatechin, epicatechin gallate, epigallocatechin gallate, and
gallocatechin gallate. In vitro and in vivo animal studies have found anti-flammatory,
anticarcinogenic, antiplatelet aggregation, vasodilatory, and other effects of several of these flavan-
3-01 compounds (Watson, 2001). Flavanols range from monomeric flavan-3-0Is to polymeric
procyanidins known as condensed tannins including a whole range of oligomeric intermediates
going from dimers up to undecamers and dodecamers and then polymers, mainly provided by fruits
and derived products such as fruit juices, tea, wine, cocoa and cereals (Pascaul-Teresa & Cristina,
2010). CUlTently, the health benefits of condensed tannins such as proanthocyanidins are of great
interest to researchers.
27
Proanthocyanidins. Proanthocyanidins, or condensed tannins, are high molecular weight
polymers of flavan-3-01 monomers whose structure consists of three phenyl rings each with various
hydroxyl substituents (J ohnson-White et al., 2006). Whole cranberries contain about 17 mg/kg of
total proanthocyanidins, while 2.16 to 2.23 mg/L of total proanthocyanidins are found in cranberry
juices (Prior et al., 2001). The polymeric proanthocyanidins comprise 63% of the total
proanthocyanidins in cranberries (Gu et al., 2002). Foo et al. (2000) isolated and identified three
proanthocyanidin trimers with A-type doubly linked interflavonoid linkages in ripe American
cranberry fruits, namely: epicatechin- (413-6)- epicatechin-( 413-8, 213-0-7)-epicatechin,
epicatechin-( 413-8)-213-0-7)- epicatechin-( 413-6)-epicatechin, and epicatechin-( 413-8)
epicatechin-(413-8,213-0-7)-epicatechin. Prior et al. (2001) reported that (-) epicatechin and its
dimers and A-type trimers are the predominant proanthocyanidins in cranberries. Recently, Kandil
et al. (2002) detected (-) epicatechin, (+) catechin, gallocatechin and epigallocatechin as well as
higher molecular weight proanthocyanidins in the American cranberry. Catechin and epicatechin
have been shown to inhibit the proliferation of prostrate tumor cell lines (Kampa et al., 2000).
Proanthocyanidins are also known to bind proteins forming protein-polyphenol complexes
(Haslam, 1996; Bravo, 1998), which could inhibit the activity of glucosyltransferase responsible for
dental plaque. The proanthocyanidin fraction of cranberry consists of molecules with both A and B
type linkages. Recent studies show that proanthocyanidins with A-type linkages are more effective
than those with B-type linkages in inhibiting the adherence of bacteria to cell surfaces (Howell et
al.,2005). The A-type proanthocyanidins are characterized by a linkage between C2 of the upper
unit and the oxygen at C7 of the starter unit, in addition to linkage between C4 of the upper unit and
28
positions 6 or 8 of the lower unit. Apparently, the linkage to C4 of the upper unit proceeds first as
in the biosynthesis of B-type proanthocyanidins, and A-type proanthocyanidins can be formed from
the B-type compounds in vitro (e.g. treatment of proanthocyanidins B I or B2 with an oxidizing
agent resulted in formation of proanthocyanidins Al or A2) (Kondo et aI., 2000) which is
demonstrated in Figure 3.
OH
HO
)yOH o .).~.) HO
OH
Figure 3. Procyanidin dimer Al and Procyanidin dimer A2
Anthocyanins. Anthocyanins are water-soluble glycosidic compounds made up of a sugar
portion (glycone) and non-sugar portion (aglycone). Anthocyanins are anthocyanidins with sugar
moieties attached at position 3 of the 3-carbon bridge between ring A and B. Anthocyanidins are
hydroxylated and methoxylated derivatives ofphenyl-2-benzopyrylium, (Figure 4) . The appealing
color of cranberries is contributed by the red anthocyanins, and the yellow flavonols and carotenes.
Vaccinium fruits are among the most plentiful food sources of anthocyanins. The total content of
anthocyanins in cranberry fruits ranges from 180.-656 mg/kg of fresh weight (Bilyk & Sapers, 1986;
Wang & Stretch, 2001); these are located under the fruit skin (Francis, 1957; Sapers et a!., 1983a;
Vorsa & Welker, 1985). The predominant anthocyanins in American cranberries are 3-0-
galactosides and 3-0-arabinosides of cyanidin and peonidin, while European cranberries contain 3-
o-glucosides of cyanidin and peonidin (Mazza & Miniati, 1993; Sapers & Hargrave, 1987; Zapsalis
& Francis, 1965). Cyanidins comprise approximately 55% of total anthocyanins in cranberry (Prior
29
et ai., 2001). Zheng and Wang (2003) reported that the concentration of major anthocyanins in
cranberry as peonidin-3-galactoside (213.6 jJg/g fresh weight), peonidin-3-arabinoside (99.7 jJglg),
cyanidin-3-galactosides (88.9 f.l,g/g), cyanidin-3 arabinoside (48.0 f.l,g/g) and peonidine 3-glucoside
(40.4 f.l,g/g). Compared with other compounds in cranberry, the anthocyanins show little direct
antiproliferative properties in the in vitro models. Purified cyanidin-3-galactoside was evaluated in
eight tumor lines in vitro using the Sulforhodamine B colorimetric assay. In all cell lines, GIso
values were >250 mglL (Murphy et al., 2003). In a multi-cell-line study using luminescent cell
viability assay (Seeram et ai. , 2004), an anthocyanin subfraction of cranberry limited growth in
three prostate tumor lines (RWPE-1, R WPE-2 and 22R vi) by 50-70% but did not significantly
inhibit oral or colon tumor cell line proliferation. The anthocyanin content is affected by cultivar,
fruit size, pre and post harvest conditions. Smaller belTies contain greater levels of anthocyan ins
compared to larger ones due to the location of anthocyanins in the fruits (Hui et al. , 2006b).
OH OMe
OH OH
HO HO
OR
OH OH
Figure 4. Cyanidin and Peonidine
Resveratrol. Resveratrol is a non-flavonoid compound that exists in two isomeric forms,
the biologically inactive cis-resveratrol and the most relevant and biologically active trans
resveratrol (trans-3 , 4, 5-trihydroxystilbene) (Vassallo, 2008). Though resveratrol is mainly found
in grapes and red wine and even peanuts, it has also been detected in cranberry fruit. The
concentration of resveratrol in cranberry (0.25 mg/kg) is similar to that found in Concord grape
juice (0.36 mg/kg) (Shahidi & Naczk, 2004). Raw cranberry juice contains predominantly trans
resveratrol, while processing increases the level of cis-resveratrol (Wang et al., 2006). Resveratrol
30
has been the focus of a large number of studies demonstrating the antioxidant, anti-inflammatory,
antimutagenic, and anticarcinogenic effects of this compound in vitro or in vivo (Jang, 1997; Soleas
et aI., 1997). In an in vitro study, it was found that resveratrol had the abili ty to protect PC 12 cells
against AB-induced toxicity and accumulation of intracellular reactive oxygen species
demonstrating resveratrol's antioxidant ability (Chao, 2009). Resveratrol may have a beneficial
effect on the circulatory system by inhibiting lipid peroxidation of LDL, preventing blood platelet
aggregation as well as expanding blood vessels (Bm'baste et aI. , 2002; Hertog et aI., 1993). In
addition to the varied phytochemicals, cranberries contain beneficial nutrients.
Nutritive Quality
Raw cranberries are relatively low in sugar content and minerals compared to other smaller
fruits. The two main sugars found in cranberries are glucose and fructose, which are 2.9% and
1.0%, respectively. Fructose has been shown to inhibit the adherence of E.coli with type 1
(mannose sensitive) fimbriae to uro-epithelial bladder cells grown in tissue culture (Zafriri et aI. ,
1989), thus helping prevent urinary tract infections. Cranberries are a good source of Vitamin C
(18 mg); contain a fairly good amount of Vitamin A (1.2 units/g) and have an insignificant amount
of Vitamin B and Vitamin D. The Vitamin C content in cranberries is affected by the temperature
and type of processing. Alternate freezing and thawing is found to have a destructive effect on the
Vitamin C content of cranberries. Evaporated whole cranberries contain an insignificant amount of
Vitamin C, but a quick-dried powder or film retains over 50 percent of the original content (Fellers,
1933). The tartness and unpalatable nature of pure cranberry juice in a single-strength form is due
to the combination ofa high acid content of (approximately 2.0%) and a low Brix level of roughly
7.5 0 Brix giving it a Brix/acid ratio of 3 .75 which is very low compared to apple and orange juice
(Hui et aI., 2006c). Cranberries have a low protein and fat content of 0.4%. The high jellying
31
power of cranberry sauce is contributed by pectin, which is present in considerable quantities. A
wax is present largely on the skins and acts to protect the fruit from water, insects and fungi. The
ash content is relatively low and consists oflargely potassi urn, calcium, phosphorous and
manganese. The iodine content ranges from 26 to 138 parts per billion (Morse, 1932; McClendon,
1930). This content is relatively large for fruits and vegetables, and that cranberries approach some
marine foods in its large iodine content which is notable. In an unsweetened form cranberries are
low in calories, sodium, and free from cholesterol and saturated fats. Cranberry is of growing
public interest as a functional food because of the potential health benefits linked to the
phytochemicals in the fruit.
Health Benefits
Urinary Tract. Urinary tract infection (UTI) refers to the presence of clinical signs and
symptoms arising from the genitourinary tract plus the presence of one or more micro-organisms in
the urine exceeding a threshold value of 102-103 CFU/mL (David, 2009). Approximately 8 to 10
million people in the United States develop at least one UTI each year. Twenty percent of women
in the United States develop a UTI and 20% of those have a recurrence. Urinary tract infection in
children is common (5-10%) and recurs in 10-30% (Williams & Craig, 2009). It has been found
that the chemicals present in cranberries known as proanthocyanidins prevent E. coli, which is the
cause of 85% of UTI, from adhering to the urinary tract epithelium by affecting its surface
properties (Science Daily, 2009).
A six month study on 150 women having recuning urinary tract infection showed that
patients who received over 3 tablespoons of cranberry-lingonberry juice concentrate daily had a
50% reduction of episodes of UTI (Kontiokari et aI., 2001). There was no effect on either the
control group (no treatment) or the group that was administered less than seven tablespoons of a
32
lactobacillus drink five days a week for one year. Only eight women in the cranberry group had at
least one recurrence, compared with 19 in the lactobacillus group and 18 in the control group; thus
demonstrating that drinking cranberry juice reduced the recurrence of urinary tract infection.
Another study comparing the in vitro anti-adhesion activity of A-linked proanthocyanidins
from a cranberry juice cocktail with the anti-adhesion activities of B-1 inked proanthocyanidins from
the commercial grape and apple juices, green tea and dark chocolate showed that the A-type
proanthocyanidins from cranbeny juice cocktail elicited in vitro anti-adhesion activity at 60
microg/mL, the B-type proanthocyanidins from grape exhibited minor activity at 1200 !J.g/mL,
while other B-type proanthocyanidins were not active. Anti-adhesion activity in human urine was
detected following cranberry juice cocktail consumption, but not after consumption of the non
cranbeny food products (Howell et a!., 2005). Thus indicating the in vitro and bacterial anti
adhesion effect of A-type linkages of cranberry proanthocyanidins, thereby maintaining urinary
tract health.
The effect of a cranberry powder and proanthocyanidin extract on the adherence of a P
fimbriated uropathogenic E. coli isolate to the primary cultured bladder epithelial cells and vaginal
epithelial cells was investigated (Gupta et a!., 2008). The cranberry powder was found to decrease
the mean adherence of E. coli IA2 to vaginal epithelial cells from 18.6 to 1.8 bacteria per cell (p
<0.001). The mean adherence of E. coli to primary cultured bladder epithelial cells was decreased
by exposure to 50 !J.g/mL proanthocyanidin extract from 6.9 to 1.6 bacteria per cell (p<O.OO 1).
Inhibition of adherence of E. coli by proanthocyanidin extract occurred in a linear, dose dependent
fashion over a proanthocyanidin concentration range of 75 to 5 !J.g/mL. These findings provide
fUliher mechanistic evidence and biological plausibility for the role of cranberry products for
preventing urinary tract infection.
33
Anthocyanins may offer health benefits against urinary tract infections. A study on eleven
healthy volunteers who consumed 200 mL of cranberry juice containing 650.8 )lg of the total
anthocyanins showed a 5.0% recovery of total anthocyanins in the urine after 24 h of consumption
(Ohnishi et aI. , 2006) . Among the anthocyanins recovered in urine, peonidin 3-0-galactoside, the
second most abundant anthocyanin present in cranberry, was found at the highest concentration
after 24 h. This study further indicates that cranbelTY anthocyanins are highly absorbed and
excreted in the human urine, thus helping against urinary tract infections.
Helicobacter Pylori. Helicobacter pylori infection is a major cause of peptic ulcer disease
and gastric cancer. A randomized double-blind, placebo-controlled trial was carried out on 189
adults affected with Hpylori infection (Zhang et aI., 2005). The degree of Hpylori infection was
determined using the 13C-urea breath test before randomization at 35 and 90 days of intervention to
assess the efficacy of cranberry juice in alleviating the infection. The study concluded that 14 of
the 97 patients who orally consumed two 250 mL juice boxes of cranberry juice daily for 90 days
and 5 of the 92 subjects who received a placebo beverage yielded negative urea breath results.
Eleven individuals from the cranbelTY juice treatment group and only two from the placebo group
were negative at 35 and 90 days of experiment. The results were significant (p< 0.05) and
demonstrated the ability of cranberry juice to effectively suppress the growth of Hpylori in a
population that was at high risk of gastric cancer.
A multicentric, randomized, controlled, double-blind trial calTied out on 295
asymptomatic Hpylori positive children, aged between 6 and 16 years, found a significant
difference in the Hpylori eradication rates for each of the four groups assigned (Gotteland et aI.,
2008). The eradication rates were 1.5% for the control group that received placebo juice/heat-killed
La1 , 14.9% for placebojuice/Lactobacillusjohnsonii La1 (La1), 16.9% for cranbeITY juice/heat-
34
killed Lal (CB), and 22.9% for cranbelTY juice/ Lactobacillusjohnsonii La] (CB/La1) at (p<0.01).
This shows that a regular intake of cranberry juice in the absence of Lactobacillus johnsonii is
effective in treating asymptomatic children diagnosed with Hpylori infection.
In another study, 889 patients on OAC (omeprazole, amoxicillin and clarithromycin) were
randomized into 3 groups; Group 1 received OAC + 8.5 oz. of cranberry juice for 1 week, followed
by cranberry juice alone the next 2 weeks; Group 2 followed a similar regimen but received a
placebo-cranberry beverage, and Group 3 took only OAC (Shmuely et aI., 2007). While the
addition of cranberry juice did not appear to improve Hpylori eradication in men, among the
women, cranberry juice raised the rate of Hpylori elimination from 82.5% to 95.2%. This further
indicates that cranbeny juice is effective in controlling Hpylori population in women receiving the
triple therapy (OAC) than men.
Prevention of Kidney Stone Formation. Cranberries contain quinic acid, an acidic
compound that is not broken down in the body but is excreted unchanged in the urine. The
presence of quinic acid in the urine makes it slightly acidic to a level that is sufficient to prevent
calcium and phosphate ions from joining to form insoluble stones. In patients suffering from
recurrent kidney stones, cranberry juice has been effective in reducing the amount of ionized
calcium in urine by more than 50%. A randomized cross-over trial (McHarg et aI. , 2003) was
carried out in 20 South African male students with no previous history of kidney stones. The first
group drank 500 mL of cranberry juice diluted with 1500 mL tap water for two weeks, while the
second group drank 2000 mL of tap water for the same period. This was followed by a two-week
washout period before the two groups crossed over. During the experimental phase, subjects kept a
three-day food diary to assess their dietary and fluid intakes; 24-h urine samples were collected at
baseline and on day 14 of the trial periods. Urine analysis data showed a significant decrease in the
35
oxalate and phosphate excretion and an increase in the citrate excretion after ingestion of cranbelTY
juice. There was also a decrease in the relative super saturation of calcium oxalate, which tended to
be significantly lower than that induced by water alone. This study implies that cranberry juice can
be used as a therapeutic to control the formation of kidney stones.
Cardiovascular Diseases. Several studies have proven quercetin's ability to inhibit LDL
(Low-density lipoprotein) oxidation. In the study (Graf, 2005), workers found a 21 % reduction in
cardiovascular disease mortality when the intake of quercetin was greater than 4 mg/d. Twenty-one
male subjects were supplemented with a placebo drink for two weeks and randomized into two
groups. One group (n = 11) received the red wine extract (1 g/day, equivalent to 375 mL of red
wine) and the other group (n = 10) quercetin (30 mg/day) for 2 weeks, followed by a 5-week
washout period. In both the red wine extract and quercetin-supplemented groups, LDL oxidation
increased significantly compared to the placebo and washout period thus indicating that red wine
extract and its component, quercetin, can inhibit LDL oxidation without affecting antioxidant,
vitamin and carotenoid concentrations. Chopra (2000) gave one group of males 30mg/d of
quercetin and another group 1 g of red wine powdered extract for two weeks, prior to which there
had been a placebo period for all pat1icipants so that each could be their own control. It was found
that there was an ex vivo copper-initiated oxidation of LDL in both red wine extract-supplemented
group as well as quercetin group in comparison to the placebo group (p<0.05). Supplementation
with red wine or quercetin inhibited LDL without affecting plasma concentrations of Vitamins C
and E, retinol and carotenoid concentrations; thus, indicating that LDL-cholesterol is only lowered
by quercetin in hyperlipidemic patients; otherwise, quercetin inhibits LDL oxidation (Chopra,
2000).
36
A trial conducted on 30 abdominally obese men, aged 51 years who drank increasing
amounts (4 ounces, 8 ounces and 12 ounces daily) of low-calorie cranberry juice during three
successive 4-week periods showed no changes in the men's HDL after drinking four ounces of
cranberry juice each day, a large increase (+8.6%) in circulating levels ofHDL after drinking eight
ounces of cranberry juice, and an effect that leveled out (+8.1 %) after drinking 12 ounces of the
juice. After drinking eight ounces of cranberry juice daily, the men's triglyceride levels dropped,
while their levels of LDL cholesterol remained unchanged, which means that overall, their lipid
profile significantly improved (Ruel et aI., 2005) when consuming eight ounces of cranberry juice
daily.
Another study (Vinson, 2003) on 19 subjects having high cholesterol was conducted to
examine the effect of cranberry juice on lowering cholesterol. Ten of the subjects were given
cranberry juice with an attificial sweetener, while the other subjects drank cranberry juice with no
added sugars. Each subject dranJ( one eight-ounce glass of juice a day for the first month, then two
glasses a day for the next month, and finally, three glasses a day during the third month of the
study. Although no changes occurred in their overall cholesterol levels, the HDL (High-density
Ii poprotein) level increased by an average of 10% after drinking three glasses of cranberry juice per
day-an increase that, corresponds to approximately a 40% reduction in heart disease risk. The
plasma antioxidant capacity was significantly increased by 121 % after two to three servings of
juice; therefore, giving credence to consuming cranberry juice daily.
Antimicrobial Properties. BelTY fruits are a rich source of phenolic and organic acids that
have antimicrobial properties against human pathogens. There have been however very few reports
of the antimicrobial properties of cranberries . Swartz and Medrek (1968) tested the antimicrobial
activity of cranberry juice against eight fungi and found that cranberry juice contains a dialyzable
37
factor that diminishes the antifungal effect of benzoic acid. Eschenbecher and Josh (1977)
demonstrated that the antimicrobial effect of cranbelTies is due to other plant substances such as
alkaloids, phenols, glycosides, essential oils, coumarins and tannins. An extract of cranberry
exe11ed a significant antimicrobial effect on Saccharomyces bayanus and Pseudomonas jluorescens.
The antimicrobial properties of the extract were found to be due to a combined effect of a pH of 2.6
and the effect of proanthocyanins, flavonols and benzoic acid. The study showed that
proanthocyanidins provided the highest inhibition of 21.3%, followed by flavonols with 18.5% and
benzoic acid with 15.6% (Aref & Nagel , 2006). The increased activity of proanthocyanidins at a
high pH of 5.2 may be due to stronger interaction between the proanthocyanidins and the
organism's cell membrane proteins. Another reason for an increase in activity may be due to the
oxidation and polymerization of proanthocyanidins. Organic acids such as citric acid, quinic acid
and malic acid play an important role in the antimicrobial properties of cranbelTies (Chen et ai. ,
2001). Conner et ai. (1990) found that antilisterial activity of organic acids was better at 30°C than
at lOOC. Wen et al. (2003) found that phenolic acids in cranberries had an antimicrobial effect
against L.monocytogenes . The effect was found to be pH dependent. The latest study on the
antimicrobial action of the American cranberry constituents against E. coli 0 l57:H7 (Lacombe et
aI., 2010) showed that each constituent produced significant reductions (p<0.05) at the native pH.
Phenolics at native pH 4 produced reductions below detectable limits compared to the control at 24
h and initial inocula for treatments of 5.40 giL and 2.70 giL. Sugars plus organic acids at native pH
3 produced a reduction below detectable limits «1 log CFU/mL) compared to the control at 24 h
for Brix/acid ratios of2.2 and 2.1, respectively. Anthocyanins at native pH 2 produced reductions
below detectable limits for treatments of29.15 mglL and 14.80 mglL cyanidin-3-g1ucoside
equivalents whereas neutralized anthocyanins reduced bacterial growth below detectable limits at
38
the concentration of 29.15 mg/L. Neutralized phenolics and anthocyanins had the same Minimum
Inhibitory Concentration (MIC) as those at their native pH. Neutralized sugars plus organic acids
did not inhibit bacterial growth compared to the control. Neutralized phenolics reduced bacteria
below detectable limits in treatments of 5.40 giL and 2.70 giL compared to the control.
Puupponen-Pimia et al. (2001) repolied that cranberry and blueberry extracts rich in anthocyanins
generally inhibited gram negative bacteria. Puupponen-Pimia et al. (2005) also found that
ellagitannins extracted from berries strongly inhibited Saureus but not Styphimurium.
A study carried out by Wu et al. (2008) found that cranberry concentrate showed better
antimicrobial effects on Styphimurium and Ecoli 0 l57:H7 than L. monocytogenes and S aureus. In
the study, ground beef was inoculated with four food pathogens, supplemented with cranberry
concentrate (10% w/w) and stored at 21°C and JOe. The results showed that cranberry concentrate
had a greater antimicrobial activity at 21°C than at 7°C (p<0.05) suggesting that the antimicrobial
effect of cranbelTY concentrate is reduced with a decrease in temperature but could still be used to
control foodbome pathogens in vitro.
Another study on the effect of different concentrations (2.5%, 5.0%, and 7.5%w/w) of
cranberry concentrate on E coli 0 157:H7 in ground beef showed that microbial inhibition increased
with concentration and time (Wu et a!., 2009). Cranberry concentrate (2.5%,5.0%, and 7.5%)
reduced Ecoli 0157:H7 population by 0.4 log, 0.7 log, and 2.4 log CFU/g, respectively, by day 5
(p<0.05). The inhibitory effect of cranberry concentrate increased with time and concentration
indicating the synergetic effect of time and concentration on reduction of E coli 0157:H7. Ellagic
acids were found to inhibit the mutagenesis induced by aflatoxin B 1 in Salmonella tester strains T A
98 and TA 100 (Vattem et aI., 2003). Solid state bioprocessing of fruit wastes such as cranberry
pomace using food grade fungi Rhizopus o/igosporus and Lentinus edodes has been shown to enrich
phenolic antioxidants and improve phytochemical consistency. The antimicrobial activity of the
extracts against pathogens such as E.coli 0157:H7, Listeria monocyLogenes, Vibrio
parahaemolyticlls and Hpylori of cranberry pomace was also enhanced by solid state
bioprocessing, demonstrating the benefit of using this technology to develop antimicrobial
ingredients containing cranberry pomace for dietary management of Hpylori infections.
39
Antioxidants. Cranberry ranks high among fruits in both antioxidant quality and quantity
(Vinson et aI., 2001) because of its substantial flavonoid content and a wealth of phenolic acids.
Yan et a1. (2002) found that the greatest radical scavenging activity was associated with cranberry
extract composed primarily of flavonols glycosides in comparison to Vitamin E when assayed using
either the diphenyl-2-picrylhydrazyl radical scavenging method or the low density lipoprotein
oxidation system. Anthocyanin cyanidin 3-galactoside stood out by its superior antioxidant activity
to flavonoids and Vitamin E using both the methods thus validating the antioxidant properties of
cranberry fruit.
A study (Pedersen, 2000) was conducted on nine healthy volunteers between the ages of23
and 41 years. The volunteers were given 500 mL of either blueberry juice, cranberry juice or a
control solution (containing similar sugar content to the fruit juices (9% w/v sucrose in water)).
Blood samples were collected 5 minutes before and 0.5 h, 1 h, 2 hand 4 h after consumption of
beverage. Urine sample was collected after 4 h of consumption. The antioxidant capacity, Vitamin
C content and total phenols were measured. Results showed that the consumption of blueberry
juice did not significantly lead to an increase in plasma concentration of total phenols. However,
consumption of cranberry juice resulted in an increase in the concentration of total phenols, 30%
increase in Vitamin C content in plasma and an increase in antioxidant capacity, indicating
cranberry ' s superiority to blueberries in terms of antioxidant capacity.
40
Anticancer. Diets rich in grains, fruits, and vegetables are known to reduce cancer risks
due to the anticancer activity exhibited by them. Berries, including cranben'y are a rich source of
many flavonoids. Cranbeny extracts were shown to inhi bit the proliferation of tumor cell lines in
vitro in some studies (Katsube et aI. , 2003; Sun et a!. , 2002; Yan et aI. , 2002). A cranberry
presscake extract (material remaining after juice is extracted) was repOlied by Ferguson et al. ,
(2004) to inhibit the proliferation of eight human tumor cell lines . Using a standard
chromatographic technique, a cranbeny presscake was fractionated , yielding an acidified methanol
fraction (Fraction 6, or Fr6) containing t1avonoids that demonstrated antiproliferative activity. The
extract was found to inhibit proliferation of eight human tumor cell lines of multiple origins. The
growth of prostrate cell line was inhibited by 50% using 10 mg/L of Fr6, 250 mg/L of Fr6 inhibited
the growth of both an estrogen dependent breast line as well as androgen-dependent prostrate cell
line by 50% (Ferguson et aI. , 2004). Other human tumor lines originating from breast (MCF-7),
skin (SK-MEL-5), colon (HT-29) , lung (DMSI14), and brain (U87) had intelmediate sensitivity to
Fr6. In addition Fr6 was shown to block cell cycle progression (P<0.05) in MDA-MB-435 cells
and induce cellular apoptosis in a dose-dependent manner. Thus demonstrating that constituents in
cranberry press cake could yield a novel anticancer agent.
Murphy et a1. (2003) identified several new triterpenoid hydroxycinnamates from a
bioactive cranberry fruit fraction namely cis (1) and trans-(2) isomers of 3-o-p-hyroxycinnamoyl
ursolic acids. Bioassay of these purified triterpene cinnamates in tumor cell lines in vitro showed
that a greater antitumor activity was associated with isomer 1 resulting in 50% growth inhibition,
with 0150 values of approximately 20 ~M in MCF -7 breast, ME 180 cervical and PC3 prostate tumor
cell lines. Quercetin was slightly less active than isomer 1, while cyanidin-3-galactoside exhibited
much lower cytotoxicity, with GIso greater than 250 )lM in all cell lines. Thus validating the
anticancer properties of cranberry constituents.
Dental Plaque. Dental plaque is the fonnation of a biofilm comprising of bacteria on the
tooth surface. Acids are fOlmed by Streptococcus mutans resulting in dissolution of the teeth.
41
S mutans is regarded as the primary microorganism responsible for the pathogenesis of dental caries
although additional acidogenic microorganisms may be involved (Loesche, 1986; Bowen, 2002;
Beighton, 2005). Glucosyltransferase catalyzes the synthesis of glucans responsible for biofilm
formation and microbe growth on teeth.
In one study (Koo et ai., 2010), the influence of cranbelTY anthocyanins, flavonols, and
proanthocyanidins (PAC) on glucosyltransferase (GTF), glycolitic activites and development and
acidogenecity of Smutans biofilms were examined. Tests were performed in solution and on
saliva-coated hydroxyapatite (calcium compounds sometimes used in dental implants) containing
biofilm. It was found that flavonoids (125 mgmL-') and PAC (500 mgmL-'), alone or in
combination, inhibited the activity ofGTF by 30-60% (Koo, 2010). PAC inhibited the activity of
Smutans by >85%. Flavonols suppressed the activity ofF-ATPase a proton translocator which
protects S mutans against environmental stress caused by acidification of the biofilms (p<0.05).
A high-molecular weight nondialyzable material (NDM) extracted from cranberry juice was
found to inhibit the formation of biofilms and coaggregates of oral bacteria, the activity of
glucosyltransferases (GTF), and the bacterial adherence on apatitic surfaces (Weiss et ai., 2002;
Steinberg et ai., 2004; Yamanaka et ai., 2004; Duarte et ai., 2005). The results therefore, indicate
the potential of cranberry bioactive components to inhibit virulent strains of S mutans that are
involved in pathogenesis of dental caries.
42
Cranberry Powder
Cranberry pomace is a byproduct of the cranberry juice processing industry composed of
pulp, peel, seeds and stalks of the fruit obtained after the juice and water have been pressed from the
fruit. Traditionally pomace has been used as an ingredient in animal feed; however, due to its poor
nutritive value it is disposed into landfills causing considerable economic loss and environmental
problems. Pomaces from small fruits (berry fruits and grapes) are often extracted for pigments and
phenolic compounds, sLlch as anthocyanins and polyphenolics from grape pomaces (Murthy et aI. ,
2002), cranberry pomaces (Vattem & Shetty 2002,2003) , and bluebelTY pomaces (Lee & Wrolstad,
2004). Recently, an Active Cranberry Powder was produced from the whole fruit, using an
enzymation and filtration process to retain the maximum amount of bioavailable nutrients as no
harsh solvents or high temperatures are used in the cold processing. The powder delivers a
complete protein, essential fatty acids, dietary fiber, vitamins, minerals, total phenols, and organic
acids (Sojitz Corporation, 2007).
Engineering of Cranberry Powder. The Active Cranbeny Powder, unlike any other
cranberry based ingredient, delivers a high concentration of proanthocyanidins using specialized
extraction techniques. The cranberry powder is extracted Llsing a proprietary enzymatic process.
The fruit is selected based on color and total acid levels . The selected fruit is reduced to a pat1icle
size which ensures mechanical opening up of the skin, cuticles, seed, and other fruit parts to allow
maximum enzymatic exposure. Many polysaccharide components within the cranberry fruit are
resistant to digestion and absorption. Enzymes enable the hydrolysis of these structural and non
structural components. In addition, it enables pat1icle size reduction of the nutritional components
of the cranberry fruit. The drying procedure removes the water from slurry, maintains a low
temperature and controls oxidation by preventing air exposure. The active cranberry powder
43
contains increased levels of organic acids, condensed tannins or proanthocyanidins and
antioxidants. Various studies have shown the indi vidual benefits of each of the components against
microbial activity.
Antimicrobial Effects of Phenolic and Organic Acids
Cranbeny fruit possesses intrinsic antimicrobial properties against many pathogens some of
which may be linked to its bacterial anti-adhesion activity against pathogens (Puupponen-Pimia,
2005). Other effects, however, are possibly due to the various acids and phenolics found in this
fruit. The treatment of cranbeITY extracts to E coli was found to down-regulate the expression of
Ecoli genes that are responsible for the membrane functioning and maintenance of ionic balance
(Germon et ai., 2001; Pages et a\., 2008; Tramonti et ai., 2006) of E coli causing disruption of
bacterial cell membrane and prevention of protein synthesis required for bacterial growth.
Phytochemicals such as tannins, and their hydrolyzed products such as ellagic acid can inhibit the
growth of microorganism by sequestering metal ions critical for microbial growth and metabolism
(Vattem & Shetty, 2005c), or by inhibiting critical functions of the bacterial membrane such as iron
channels and proteolytic activites, which are all dependent on pH and ionic strength. The microbial
inhibitory concentrations for cranbeny constituents; sugars plus organic, phenolics, and
anthocyanins against 5 log inocula of Ecoli 0157:H7 were found to be 5.6°12.6° Brix/acid (citric
acid equivalents), 2.70 gIL (gallic acid equivalent), and 14.80 mg/L (cyanidin-3-glucoside
equi valent), respectively. Sugars plus organic acids caused visible osmotic stress, while phenolics
and anthocyanins caused disintegration of the outer membrane (Lacombe et ai., 2010). The results
thus validate the antimicrobial action of American cranbeITY constituents; phenolics, anthocyanins,
and organic acids, against foodbome pathogen Ecoli 0157:H7.
Inhibition of E.coli 0157:H7 in Apple Cider
Until recently, apple cider was regarded a safe product due to its low pH and high organic
acid levels, however, recent foodbome illness outbreaks and deaths linked to the consumption of
unpasteurized apple cider have changed this assumption. Unpasteurized apple cider is an
unfermented , unc1arified, untreated liquid obtained from the pressing of clean, mature apples .
44
(Food Safety Risk Assessment, 2001) During the growing and production process, apples used for
cider have the potential exposure to contamination through contact with animal feces , contaminated
soil and water, human contact, pests, and animals. Although apple cider and juice are acidic (PH of
3-4) both Cryptosporidium and Ecoli 0157:H7 are acid-tolerant and both organisms can survive in
apple cider for up to 4 weeks (Millard et aI. , 1997; Zhao et aI. , 1993). Unpasteurized apple
cider/juice contaminated with E coli 0157 :H7 has been implicated in several outbreaks of
food borne illness (Besser et a!., 1993; Centers for Disease Control and Prevention, 1996; Centers
for Disease Control and Prevention, 1997). In October 1996, unpasteurized apple cider or juice was
associated with three outbreaks of gastrointestinal illness. In the Western United States, an
outbreak of E coli 0 157:H7 infections associated with unpasteurized commercial apple juice caused
illness in 66 persons and one death (Centers for Disease Control and Prevention, 1996).
Several studies have been carried out to find ways to eliminate or control E coli
contamination in apple cider. Comes and Beelman (2002) demonstrated fumaric acid in
combination with sodium benzoate was an excellent preservative treatment which can increase the
safety and prolong the shelf-life of apple cider. The researchers demonstrated a 5-log reduction of
Ecoli 0 157:H7 in apple cider by adding a fumaric acid (0.15% w/v) and sodium benzoate (0.05%
w/v) preservative mixture to the apple cider, followed by holding the cider at 25°C for at least 6 h.
When the holding temperature was increased to 35°C, no E coli 0 157:H7 populations were
45
recovered after 3 h. In contrast, the control ciders (without fumaric acid and sodium benzoate)
showed little reduction of Ecoli 0157:H7 populations even after 24 h at 25°C. In the present study,
apple cider samples were adjusted to pH values between 3.2 and 4.7 and held at 5°C, destruction of
E coli 0 157:H7 significantly (p < 0.05) decreased with increasing pH value. Cider containing
added fumaric acid and sodium benzoate (0.15% and 0.05%, w/v) and adjusted to pH 3.2 required
92 h to achieve a 5 log reduction. A subsequent increase in apple cider pH to 3.8 or above
increased the required time to 342 h. At low cider pH values, the concentration of the bactericidal
fumaric acid increased which explains the observed increase in the destruction of E coli 0157 :H7.
Specific inhibition of metabolic functions by an undissociated acid and the acidification of the
cytoplasm by H+ ions released from the organic acids upon entering the cell may be responsible for
the growth inhibition and subsequent destruction of pathogens by apple cider (Salmond et aI.,
1984). Recently, cranberry juice was supplemented with unpasteurized apple cider to evaluate its
antimicrobial properties against Ecoli 0157: H7, Salmonella serovars, and Listeria
monocytogenes. Cranberry juice was added to apple cider at 15% (v/v), followed by warm hold
(45°C for 2 h) and freeze-thaw steps (-20°C for 24 h, 5°C for 24 h). The study found that in the
absence of the injury-repair step, the cran-cider process achieved a 5-log reduction in Ecoli
0157:H7, Salmonella serovars, and Listeria monocytogenes. However, an injury-repair step
resulted in 3.5 to 4 .2 log reductions of Ecoli 0157 :H7 which failed to meet the Food & Drug
Administration (FDA) requirement. Consumer evaluation of apple cider subjected to the cran-cider
process was favorable (n=197) with a mean score of 5.8 on a seven-point hedonic scale, where
1 =dislike extremely and 7= like extremely. The cran-cider process provides a novel way to
improve microbial safety of unpasteurized apple cider, but it does not meet FDA-mandated
46
pathogen reductions for wholesalers (Ingham et aI., 2006). Therefore, these results give credence to
the addition of cranberry to apple cider to improve safety against food borne pathogens.
Inhibition of E.coli 0157:H7 in Ground Beef
Beef is a highly consumed meat in the United States, averaging 67 pounds per person per
year. In 2004, retail beef represented 56 percent of all red meats (beef, pork, lamb, and veal)
consumed in the United States (USDA, 2005). American's meat consumption helps fulfill the daily
recommended dietary intake of protein, and beef is rich in vi tamin B 12 , iron, and zinc. Ground beef
holds the largest market share of 42% for all identifiable beef cuts, followed by steaks which are
20%, and then stew beef, beef dishes, and other beef cuts. Ground beef is eaten in the form of
hamburgers, spaghetti meat sauce, and meat pizzas. Depending on the percentage of fat added
ground beef is available in forms such as Super Lean, Extra Lean, Lean, and Regular Hamburger.
Regular Hamburger is 70% lean and 30% fat as opposed to Super Lean which has only 7-10% fat.
Fresh meat and poultry are highly susceptible to microbe contamination and spoilage due to their
emiched nutrient composition, high pH (5.5-6.5), water activity (0.98-0.99) and cross
contamination of microbes from the skin and digestive tract during handling (Nicholaos, 2005).
E coli 0157 :H7 was first reported as a cause of illness in 1982 due to an outbreak in contaminated
hamburgers (Rangel et aI., 2005). Frenzen et al. (2005) estimated that annual cost of illness due to
E coli from all sources of infection was $405 million, including $370 million for premature deaths,
$30 million for med ical care and $5 million for lost productivity. In 2010 a multistate E coli
o 157:H7 outbreak due to infection associated with beef and poultry resulted in 21 infections, 9
hospitalizations, and 1 case of hemolytic uremic syndrome (Centers of Disease Control and
Prevention, 2010). The inhibition of E coli in ground beef using acid or natural compounds has
been explored. Allanson et al. (2000) found 0.37 log and 2.29 log CFU/g reduction of Ecoli in
47
ground beef samples with 1 % and 2% polyactic acid after 7 day storage. Wu et aI. , (2009) explored
the antimicrobial properties of a cranberry concentrate in ground beef and found that there was a 2.4
log CFU/g reduction in E coli using 7.5% w/w cranbeny concentrate after 6 days (refrigerated
storage). Cranbeny concentrate interacted with the cell outer membrane of E coli 0157 :H7,
disrupted the membrane and inhibited the transcription of genes which prevented the synthesis of
proteins necessary for microbial grovvth of Ecoli 0157:H7. Adding cranbeny thus serves as an
potential method to control potential E. coli outbreaks in ground beef.
Real Time Polymerase Chain Reaction
The Polymerase Chain Reaction (PCR) technique is an in situ DNA (Deoxyribonucleic acid)
replication process that allows for exponential amplification of target DNA in the presence of
oligonucleotide primers and thermostable DNA polymerase (Wilson, 2001). PCR methods are
specific to species and detect the target organism in the presence of other microbes. PCR based
methods have been developed for quick identification of purified cultures of a number of foodbome
pathogens including Salmonella spp. (Rahn et a!. , 1992), Listeria monocytogenes (Border et aI.,
1990), and E coli 0157:H7 (Pollard et a!. , 1990). Recently, Real-Time Polymerase Chain Reaction
(RT-PCR) has emerged as a substitute for conventional PCR as it allows for early detection of PCR
amplification. Measuring the kinetics of the reaction in the early phases of PCR provides a distinct
advantage over traditional PCR detection. RT-PCR also replaces the use of agarose gel detection,
which is often time-consuming and gives poor resolution of amplified DNA fragments. RT-PCR
quantifies reaction products for each sample in every cycle thus giving an amazingly broad 107 -fold
dynamic range; data analysis including standard curve generation and copy number calculation is
performed automatically. In this method , a standard curve is first constructed from Ribonucleic
acid (RNA), purified plasmid Double Stranded Deoxyribonucleic acid (dsDNA), in vitro generated
48
ssDNA or any cDNA sample expressing the target gene of known concentration. This curve is then
used as a reference standard for extrapolating quantitative information for mRNA targets of
unknown concentrations. Spectrophotometric measurements at 260 run can be used to assess the
concentration of the DNA for each target mRNA, which can then be convelied to a copy number
value based on the molecular weight of the sample used. Bacterial population is also calculated
using manual methods of enumeration which require the users to count colonies and then transfer
the results into a computer. This is not only a time-consuming and tedious action, but can lead to
misinterpretation with final plate reading. In addition, because this method produces no
computerized image of the plate alongside the count, there is no reliable means of validating the
procedure. Hence RT-PCR is used to quantify E.coli ATCC 25922 population in apple cider and
ground beef supplemented with cranbeny powder and compared with the results obtained from the
colony counting technique.
Sensory Evaluation
Sensory analysis is defined as a scientific application used to evoke, measure, analyze, and
interpret responses to food attributes or characteristics as they are perceived through a person's
sense of sight, smell, hearing, touch, and taste in forming a food perception (Stone and Sidel, 2004).
It is practically applied in product development by helping in product matching, improvements, and
grading products as well as in research. Sensory analysis is classified into two broad categories
namely subjective and objective measurements. Subjective measurements involve trained and
untrained panelists, while objective testing employs the use of mechanical instrumentation. Both
tests are essential in sensory evaluation and necessary in a variety of conditions (Meilgaard, Civille,
& Carr, 1991).
49
Hedonic tests in sensory evaluation measure the degree of acceptance and specifics of what
is liked and disliked about the product being tested (Amerine et a!., 1965). Hedonic testing is used
with untrained people as well as with experienced trained panel members (Mahony, 1986).
Samples are presented either sequentially, or in groups (Chambers & Wolf, 1996); and the
consumers measure specific consumer responses to particular sensory attributes (appearance, color,
flavor, texture, etc.) of a product. A separate scale is provided for each sample in a test session.
The scales may be grouped together on a page, or on separate pages (ASTM, 1968). The hedonic
scale is anchored verbally with nine different categories ranging from like extremely (9) to dislike
extremely (1). The major advantage of acceptance tests is that they provide significant insight into
a consumer's likes and dislikes of a particular sample and provide the researcher with numerical
values to conduct sophisticated statistical analysis methods in understanding consumer preferences.
The ratings labels obtained on a hedonic scale may be affected by many factors other than the
quality of the test samples. Factors such as character of the subjects, the test situation, attitudes or
expectations of the subjects can all have a profound impact on results (ASTM, 1968). Determining
the objective of the test, and the type of evaluation that is needed is very crucial in obtaining
accurate results from a sensory project. A consumer acceptance test was used to evaluate the
overall acceptability, appearance, flavor, texture of cooked ground beef patty supplemented with
four different concentrations of cranberry concentrate using a nine-point hedonic scale (1 =dislike
extremely; 5= neither like nor dislike; 9= like extremely) (Wu et a!., 2009). It was found that there
was no significant difference for appearance and texture among the burger patties supplemented
with four different concentrations of cranberry concentrate. The flavor and overall acceptability
ratings of burgers with 7.5% cranberry concentrate were lower with mean scores of 5.06 and 5.42
than the control burger (p<O.OS) which had flavor and overall acceptability scores of 6.5 and 6.4,
50
respectively. Burgers with 2.5% cranberry concentrate had the highest score of7.1, 6.6, 6.46, 6.78
for appearance, flavor, texture, and overall acceptability, respectively, among all the four kinds of
burgers. Hence, cooked ground beef patties supplemented with 2.0 % w/w cone. cranberry powder
were evaluated for color, sweetness, cooked beef flavor, cardboard flavor, grainy texture, juiciness,
after taste, overall acceptability, and preference of cooked ground beef patties containing with and
without cranberry powder in the current study.
51
Chapter III: Methodology
The purpose of the study was to investigate the antimicrobial effect of 2% w/w cranberry
powder on E coli ATCC 25922 in concentrated pasteurized apple cider and 95% lean ground beef, to
detect and quantify E coli ATCC 25922, and to evaluate the sensory properties of 95% lean ground
beef supplemented with 2% w/w concentration cranberry powder.
RT -PCR was used to quantify E coli A TCC 25922 in concentrated pasteurized apple cider and
95% lean ground beef. Sensory evaluation was carried out to evaluate ground beef patty supplemented
with 2% w/w cranberry powder for color, sweetness, cooked beef flavor, cardboard flavor, grainy
texture, juiciness, after taste, overall acceptance and preference.
Sample Selection and Description
Concentrated pasteurized apple cider and fresh, raw, 95% lean ground beef were chosen for the
study. Cranberry powder at 2% w/w concentration was chosen based on a preliminary sensory study
carried out on ground beef patties mixed with different cranberry powder concentrations (0%, 2%, 4%
and 8% w/w). The ground beef patties containing different concentrations of cranberry powder were
evaluated for color, sour taste, cooked beef flavor, cardboard flavor and grainy texture. Beef patties
with 2% w/w cranberry powder added had better scores that were just about right for panelists
compared to all other concentrations. The duration of the microbial study was chosen to be 6 days
based on a previous research that evaluated the possible use of cranberry concentrate (2.5%, 5% and
7.5% w/w) on the growth of Ecoli 0157:H7 inoculated in ground beef that was stored at 4°C for 5
days (Wu et aI., 2009). Figure 5 shows concentrated pasteurized apple cider packaged in plastic
container and the four ground beef treatments sealed in sterile stomacher bags namely treatment 1 as
control; treatment 2 as ground beef mixed with 2% w/w cranberry powder; treatment 3 as ground beef
inoculated with 1x109 CFU/g and 2% w/w cranberry powder, and treatment 4 as ground beef mixed
52
with 1 x 1 09 CFU/g E. coli A TCC 25922. The concentrated pasteurized apple cider was bought locally
(Menomonie, Wisconsin, USA) and stored in the refrigerator at 4°C. The 95% lean ground beef was
purchased from the local grocery store based on availability (Menomonie, Wisconsin, USA) and stored
in the freezer at -20°C.
Figure 5. Apple cider (concentrate) and ground beef treatments
Bacterial Strain. The E. coli A TCC 25922 strain used in this research was purchased from
Modem Laboratories Services, Inc., (Bakersfield, California, USA). The strain was available in the
form of disks and stored at a refrigeration temperature of 4°C. A disk was inserted in 10 mL Tryptic
Soy Broth and incubated at 37°C overnight based on label instructions and used for the experiment. The
identity of the strain was confirmed by the gram staining method used to differentiate Gram positive and
Gram negative bacterial species. The appearance of pink colonies confirmed the presence of E. coli
ATCC 25922.
Reagents. Tryptic Soy Broth (Becton, Dickinson and Company, Sparks, Maryland, USA) was
used for growing the E. coli A TCC 25922 disks for usage in ground beef and apple cider while 0.1 %
peptone water (Becton, Dickinson and Company, Sparks, Maryland, USA) was used as a diluent for
microanalysis using the serial dilution technique. MacConkey agar (Becton, Dickinson and Company,
Sparks, Maryland, USA) was used to selectively isolate E. coli ATCC 25922 colonies. Butterfield
buffer (Nelson- Jameson, Inc., St. Paul, Minnesota, USA) was used as a diluent for the antimicrobial
disk assay. Muellar Hinton Agar (Becton, Dickinson and Company, Sparks, Maryland, USA) was used
53
for growing microbial colonies for antimicrobial disk assay. A solution of 100 % v/v methanol was
used to make the cranberry extract for usage in the antimicrobial disk assay.
Preparation of Mueller Hinton Agar. Mueller Hinton Agar was prepared as per instructions
on the container by dissolving 38 g of the agar powder into 1 L of distilled water. The mixture was
heated on a hot plate and stirred with a magnetic stirrer until all the agar was dissolved into the water.
The mixture was then autoc1aved at 121 °C for 45 minutes. The agar media was then allowed to cool at
45°F in a water bath before pouring onto petriplates. The agar plates were refrigerated for future use.
Methanol Extraction and Vacuum Filtration
AI: 10 dilution of cranberry-methanol solution was made by dissolving approximately 1 g of
weighed cranberry powder into a beaker containing 10 mL of 100 % v/v pure methanol. The
beaker containing the solution was sealed with foil paper to avoid evaporation of methanol. The
cranbelTy-methanol solution was then incubated overnight at room temperature of 27°C in a shaker.
Following incubation, vacuum filtration of cranberry-methanol solution was carried out using a
Buchner funnel and 55 mm thick filter paper (ChemLab, 2008) to obtain the filtered cranberry
methanol extract.
Paper disks 6 mm in diameter were incubated overnight in the cranbelTy-methanol extract.
A total of 4 disks were inserted per plate. Controls consisted of disks with distilled water only.
Kirby Bauer Disk Diffusion (Antimicrobial Disk Method)
Working cultures of E. coli ATCC 25922, s'aureus ATCC 25923 (Staphylococcus aureus),
and S.typhimurium (Salmonella typhimurium) were prepared prior to the experiment. One mL of
each of the cultures was pipetted into 9 mL of Butterfield buffer to 0 btain a 1: 10 dilution. The mix
was thoroughly vortexed after addition of the microbe. One mL of the mixture was pipetted onto
Mueller Hinton agar plates (Kelley & Post, 2002). A sterile glass swab was rotated on the agar
54
plate at 360° to allow uniform distribution of the culture. The plates were incubated overnight at
37°C in an incubator. Following overnight incubation, the plates were observed for microbial
growth. The four disks that were in the cranberry-methanol extract and the disks in the distilled
water (control) were randomly impregnated onto the agar plate containing microbial growth. The
plates were incubated for 24 hat 3]DC. The zone of inhibition was observed and the diameter was
measured. Each experiment consisted of two replicates and was repeated two times.
Microanalysis for Apple Cider
Apple Cider Preparation. Table 1 shows the four different treatments developed for
concentrated pasteurized apple cider and 95% lean ground beef. The following treatments were
developed for the current study in order to study Ecoli inhibition with and without cranberry powder.
One hundred milliliters of concentrated, pasteurized apple cider was measured out into four sterile
containers and labeled into four treatments. The first treatment was un inoculated apple cider (without
E coli A TCC 25922) which was chosen as control in order to check for presence of background
microbiota. The second treatment was uninoculated apple cider thoroughly vortexed with 2 g of
cranbelTY powder (2% w/w concentration) which was chosen to detelmine if cranberry powder had the
ability to suppress background microbiota. The third treatment was apple cider with 2 g of cranberry
powder, added and inoculated with 1 mL of E coli A TCC 25922 at the concentration of 109 CFU/mL to
obtain a final concentration of 107 CFU/mL. The concentration of Ix 109 CFU/mL was determined
through serial dilution and plating prior to experiment. The fourth treatment was apple cider inoculated
wi th 1 mL of E coli at a concentration of 109 CFU/mL. The treatments were developed based on a
previous study on the application of cranberry concentrate on E. coli 0157: H7 in ground beef (Wu et
aI., 2008). Similar treatments were developed for ground beef as shown in Table 1.
55
Table 1
Apple Cider and Ground Bee/Treatments
Treatments Apple Cider Ground Beef
Apple cider (uninoculated) 95% lean ground beef (uninoculated)
2 Apple cider + 2 % w/w cranbeny powder 95% lean ground beef +2% cranbeny powder
3 Apple cider + 2% cranbeny powder + (lx 109 CFU/mL) Ecali ATCC 25922
95% lean ground beef + 2% w/w cranberry + (Ix 109 CFU/g) Ecali ATCC 25922
4 Apple cider + (1 x 109 CFU/g) Ecali ATCC 259: 95% lean ground beef + (1 x 109 CFU/g) Ecali ATCC 25922
Each treatment was divided into eight sterile tubes . The tubes were labeled as Days 0, 2, 4 and
6. Duplicates of all samples were prepared. All the tubes were stored at 4°C for microanalysis except
on Day O.
On each day the samples stored at 4°C in tubes were serially diluted in 0.1 % sterile peptone
water (Difco, USA).
Serial dilution of the samples was canied out by the following procedure. A decimal
dilution of each of the sample was prepared by pipeting 1 mL of the sample into the tube containing
9 mL of 0.1 % peptone water to obtain a dilution factor of 10-1• The 10-1 tube was vortexed and 1
mL was transfened using a new pipet into the second tube containing 9 mL of diluent. The steps
were repeated until 10-6 total dilution was reached.
Dilutions were prepared until a dilution factor of 10-6. The dilution factor for the sample
was calculated using equation 1 (Kelley & Post, 2002).
Dilution factor = Final volume Sample Volume + Diluent volume
Duplicate petri plates containing MacConkey agar selective for E. coli A TCC 25922 were
labeled for each dilution prepared. Approximately 100 I-lL of the dilutions were pipetted into the
56
agar plates and spread plated using a sterile bent glass rod spreader (Figure 6). All the plates were
incubated at 37°C for 24-48 h and the colonies were counted using colony counter following
incubation.
Figure 6. Serial dilution and spread plating technique
pH Measurement. The pH of each treatment was taken following serial dilution in order to
study the effect of pH on E coli inhibition on days 0,2,4 and 6. The pH of each treatment was
measured using a pH meter (Fisher Scientific, Pittsburg, Pennsylvania, USA) at day O.
Microanalysis for Ground Beef
Ground Beef Preparation. One hundred grams of 95% lean ground beef was measured
out into four sterile stomacher bags and labeled into four treatments. The first treatment was
uninoculated ground beef. The second treatment was uninoculated ground beef thoroughly mixed
with 2 g of cranbelTY powder to make a 2% w/w concentration. The third treatment was ground
beef thoroughly mixed with 2% w/w cranbelTY powder and inoculated with 1 mL of Ecoli ATCC
25922 culture at the concentration of 109 CFU/g to get approximately 7 log CFU/g . The fourth
treatment was ground beef inoculated with 1 mL of Ecoli culture to get approximately 7 log
CFU/g. Ten grams of each treatment was further weighed out into sterile stomacher bags and
diluted with 100 mL 0.1 % peptone water to obtain a 1: 1 0 dilution and homogenized in stomacher
(Lab Blender 400, Tekmar, Cincinnati, OH) for 120 s to allow uniform mixing and distribution of
Ecoli (Figure 7). The final concentration of Ecoli after diluting with 0.1 % peptone was 106 CFU/g
57
in the treatments that were inoculated with the microbe. The content of the stomacher bag was 10-1
dilution of the original sample. The supernatant was transferred to sterile tubes and stored at 4°C.
Microanalysis was carried out on days 0, 2, 4 and 6.
Figure 7. Dilution of sample and stomaching in stomacher
On each day the treatments stored in tubes at 4°C were serially diluted in 0.1 % peptone
water (Difco, USA) and spread plated on MacConkey agar. The plates were incubated at 37°C for
24-48 h and the colonies were counted using colony counter following incubation.
pH Measurement. The pH was measured in the present study as per procedure followed by
Wu et al. (2009). A 109 portion of each treatment was mixed well with 90 mL distilled water in a
sterile stomacher bag and was blended by a stomacher (Lab Blender 400, Tekmar, Cincinnati,
Ohio) for 2 minutes. The pH of the suspension was then measured with a pH meter (Fisher
Scientific, Pittsburg, Pennsylvania, USA) at day O.
Sensory Evaluation
Sensory analysis was carried out after permission was granted from Institutional Review
Board (IRB). The consumer panelists were at least 100 students who were recruited through class
announcements, emails and fliers posted on campus. All the participants signed a consent form,
which indicated dietary restrictions, time commitment, risks and benefits of the study,
58
confidentiality and willingness to participate in the study. Participants were instructed to taste
cooked ground beef patties supplemented with and without cranberry powder (2% w/w
concentration). Lean ground beef (95%) was mixed with 2% w/w concentration cranberry powder
and ground in a meat grinder to ensure homogenization of mixture for sensory analysis. Patties
weighing 50 g were formed using a burger mold and cooked on a commercial broiler to an internal
temperature of 160 OF that was monitored continually by a thermometer. Patties were cooked as
scheduled and cut into sample size and kept at 131°F in a food warmer approximately 20 minutes
prior to the sensory test. Each of the samples was assigned a three digit code that were randomized
and balanced to each panelist (Table 2). Each panelist received two samples simultaneously on a
single tray and their palate was rinsed using room temperature bottled water (Figure 8). Panelists
were not identified by any means and were asked to answer the questionnaire(Appendix B) using
Compusense on the computer linked to every workstation. The cooked ground beef patties were
tested for color, sweetness, cooked beef flavor, cardboard flavor, grainy texture, juiciness, after
taste using intensity rating scale of 1 to 5; where, 1 =Low; 3=Moderate; 5=High, overall acceptance
using a five-point hedonic scale of 1 to 5; where, 1= dislike very much; 3= neither like nor dislike;
5=like very much and preference. The sensory test carried out was an affective test and overall
acceptability and preference were rated.
Table 2
Samples and Three Digit Codes Assigned
Samples
Control
2% w/w cranberry powder added-beef patty
Codes
432
568
Figure 8. Sample preparation and taste testing in sensory booth
Genomic Deoxyribonucleic acid (DNA) Extraction
59
FAST ID Genomic DNA Extraction kit (Fast ID, Fairfield , Iowa) was used to extract genomic
bacterial DNA from apple cider and ground beef. The genomic DNA was extracted according to
manufacturer's instructions. Genomic Lyse buffer of a volume of 1,000 ilL was premixed with 10 ilL
of Proteinase K solution. In a labeled 2 mL vial , 1 mL of inoculated (E. coli A TCC 25922) apple cider
was mixed with 1,000 ilL of the premixed Genomic Lyse buffer. The vial containing the apple cider
sample was vortexed thoroughly until a homogenous slurry was obtained. The slurry was then
incubated at 65°C for 10 to 30 minutes. After incubation the slurry was spun at 10,000 rpm for five
minutes in a microcentrifuge. The supernatant of a volume of 500 ilL was transferred into a new
labeled 2 mL vial. An equal amount of Genomic Bind buffer was added to the supernatant and
vortexed briefly. The sample was then spun at 10,000 rpm for five minutes in a microcentrifuge. The
supernatant was passed through the DNA Binding Column and washed with 800 ilL of Genomic Wash
buffer ifusing centrifugation technique. The column was washed three times with 800 ilL of75%
ethanol. The column was dry spun for few seconds at high speed of 10,000 rpm in a microcentrifuge.
The column was then placed into a 1.5 mL vial. Approximately 100 ilL of 1 xTE buffer (l0 mM Tris
HCl, 1 mM Na-EDTA, pH 8.0) was added depending on the downstream application. The column was
incubated for 5 to 10 minutes at 65°C and spun at 10,000 rpm for 5 to 30 seconds in a microcentrifuge.
60
The eluted DNA was collected in the 1.5 mL vial and the column was discarded. A similar procedure
was followed for inoculated ground beef samples.
Real Time Polymerase Chain Reaction (PCR) Analysis
The Real Time PCR was used to quantify microbial population and was equipped with a CFX96
optical reaction module and the C 1 000 ™ Thermal Cycler connected to a laptop through a USB
cable (Figure 9). The CFX Manager software is installed in the laptop and processes real-time PCR
data automatically at the end of the each run and opens the data analysis window in the laptop.
Figure 9. CIOOO thermal cycler
The genes sequences coding for V3 and V 4 regions of the 16S rRNA for non-pathogenic strain
of E.coli ATCC 25922 (Tsen et ai, 1998) were selected for the RT-PCR quantitative study. Gene
specific primers; forward primer 16 E1 (GGGAGTAAAGTTAATACCTTTGCTC) sequence with 25
base number and a fragment size ranging from 452-476 base pair (bp) and reverse primer 16 E2
(TTCCCGAAGGCACATTCT) sequence with 18 base number and a fragment size ranging from 1018-
1035 bp (Tsen et ai., 1998) was designed by IDT (Integrated DNA technology). Specificity and
efficiency of gene-specific primer were determined by a dilution series of genomic DNA using RT
PCR (Bio-Rad, Hercules, California). A melting curve analysis was can-ied out, to ensure that the
EvaGreen dye used is detecting only the desired gene and not any double stranded DNA such as
primer-dimers, contaminating DNA, and PCR product from misannealed primers. Amplification of the
61
specific target genomic DNA was performed in a 96-well-quick plate-SYBR in a reaction cocktail
comprised of the following: 1 fJL of genomic DNA, 0.5 fJL of 20 fJM forward primer, 0.5 fJL of 20 fJM
of reverse primer, 11.5 fJL of EvaGreen Reaction Mix, and 11.5 fJL of nuclease free water.
Amplification was performed with an initial denaturation temperature of 94°C for 5 minutes, followed
by 45 cycles of amplification with the following parameters: Step-denaturation at 95°C for 1 minute,
primer annealing and synthesis 53.3°C for 1 minute with a single fluorescence measurement, extension
step at 72°C for 2 minutes, denaturation step at 72°C for 10 minutes, annealing step at 55°C for 30
seconds, and melting curve program (55°C - 95°C with a temperature increment of 1.0°C/cycle for 5
seconds).
Data Analysis
For microbiological analysis, the means within treatment were compared with days as
factors using multiple comparison test: Tukey Honestly Significant Difference (HSD). Paired T
test was used to compare means between treatments. The apple cider and ground beef experiments
were individually repeated two times. The means, standard deviations, and graphs for plate counts
were plotted using Microsoft Excel version 2007. Statistical significance was defined as p<0.05.
For sensory analysis, data were analyzed by Compusense version 4.6. The means were
compared using the multiple comparison test: Tukey HSD with a significance level of 0.05. The
graphs were plotted using Microsoft Excel 2007. The optimum primer concentration and melting
temperature for RT-PCR experiment was detelmined using the CFX Manager software and the
quantified DNA was compared using a standard curve plotted using Microsoft Excel 2007. The
data for RT-PCR experiment was analyzed with a significance level of 0.05.
62
Chapter IV: Results and Discussion
The antimicrobial property of 2% w/w cranberry powder against E coli A TCC 25922 was
investigated using the Standard Plate Counting technique and quantified using Real Time
Polymerase Chain Reaction (RT-PCR). Samples chosen for microbiological analysis were
concentrated apple cider and 95% lean ground beef. The antimicrobial properties of the cranberry
powder in apple cider and ground beef were studied for a period of 6 days at refrigeration (4°C)
conditions. Microanalysis was carried out on days 0, 2, 4, and 6; and the Ecoli ATCC 25922
colonies characterized by pink color were counted following 24-48 h incubation at 37°C.
MacConkey Sorbitol agar, a selective media used for growing Gram positive and Gram negative
bacteria, was used for growing E coli A TCC 25922. The pink color is caused due to the
fermentation of Sorbitol present in MacConkey agar. The number of colonies counted using a
colony counter was transformed into colony forming units (CFU/mL) for apple cider and (CFU/g)
for ground beef. In order to quantify results obtained by RT-PCR, a standard curve was plotted
from the Deoxyribonucleic acid (DNA) of known concentration by plotting Ct (Threshold value) on
X -Axis and CFU/mL on Y-Axis using Microsoft Excel 2007. Quantification of DN A was
determined by interpolation of data against the corresponding standard curve.
Methanol Extraction
Table 3 shows the diameter of the zone of inhibition (mm) of cranbeny .. methanol extract in
two different dilutions (1: 10 and 1: 100) on Staphylococcus aureus ATCC 25923 (S aureus),
Escherichia coli A TCC 25922 (E coli), and Salmonella typhimurium (S typhimurium) at 3 rc after
24 h incubation. The antimicrobial activities are measured based on the zone of inhibition
obtained. It is indicated that larger zone of inhibition demonstrates greater antimicrobial activity.
No zone of inhibition was found after disks containing cranberry-methanol extract in the two
63
dilutions (1 : 1 0 and 1: 1 00) were placed in a culture of S aureus A Tee 25923. Thus, indicating that
cranberry powder at the current level may not cannot be as effective as an antimicrobial agent
against S aureus A Tee 25923 as other levels . At 1: 1 0 dilution a large diameter of zone of
inhibition, 9.3 mm was observed for Ecoli ATee 25922 compared to Styphimurium which was
8.6 mm, although statistically not significant (p>0 .05) (Table 3). Compared to 1: 1 0 dilution, the
diameters of the zone of inhibition at 1: 100 dilution were slightly lower with 9.1 mm for Ecoli and
8.3 mm for Styphimurium but statistically insignificant (p>0.05) indicating that diluting the
cranberry powder (1: 1 00) did not significantly change the zone of inhibition.
Table 3
Diameter o/Zone o/Inhibition (mm) o/Cranberry-Methanol Extract on S aureus ATCC 25923,
Ecoli ATCC 25922 and Styphimurium
Dilution
1: 1 0
1: 100
Control (water only)
o
o
S.aureus ATCC* 25923
o
o
Note. * ATCC is American Type Culture Collection.
E.coli ATCC 25922 S.typhimurium
9.3Aa ± 0.9 1 8.6Ba ± 1.1
9.1Aa±0.3 8.3Ba ± 1.4
'Means followed by different lower case letters for the same dilution are significantly different p<0.05; means followed by different upper case letters in the same column between dilutions are significantly different (p<0.05)
One study investigated the antimicrobial properties of cranberry extracts (press cake) by
diffusion to agar method and showed that E coli A Tee 25922, S typhimurium and S aureus A Tee
25923 were least sensitive with zone of inhibition of 15 mm, 17 mm, and 18 mm, respectively
(Viskelis et aI., 2009). The present study showed surprising results for Saureus with no zone of
inhibition and slightly smaller zones of inhibition for Ecoli and Styphimurium in comparison to the
previous study; thus, indicating that cranberry press cakes have better antimicrobial activity
compared to the investigated levels used of cranbeny powder. The Kirby Bauer diffusion test
64
showed that E coli and S. typhimurium was less sensiti ve to the cranbelTy-methanol extract thus
justifying the reason for insignificant difference in the inhibition of E coli A TCC 25922 after
adding cranberry powder to ground beef and apple cider in comparison to the controls (no cranberry
powder added-ground beef and apple cider). The diffusion test also failed to detennine the
antimicrobial propeliies of methanol against all the microbes which could have confinned whether
cranberry and methanol in the cranberry-methanol extract synergistically contributed to the
antimicrobial effect or if cranberry powder alone helped inhibit the microbes.
Antimicrobial Effect Of Cranberry Powder In Apple Cider
On Day 0, microanalysis was carried out for all the four apple cider treatments (Treatment
I-apple cider (control); Treatment 2- apple cider and cranbelTY powder; Treatment 3- apple cider,
cranberry powder and Ecoli; Treatment 4- apple cider and Ecoli). Serial dilutions up to 10-6 were
prepared for each of the treatment-based trial results obtained and 0.1 mL of each of the diluted
samples was plated and colonies were counted following incubation for 24 h. Colonies above 300
were regarded as too many to count (TMTC). The presence of E coli ATCC 25922 was confinned
by Gram staining. The experiment was carried out in replicates.
Table 4 shows the Colony Forming Units (CFU/mL) for inoculated apple cider with and
without cranberry powder on days 0, 2, 4 and 6. The colony fonning units were calculated using
equation 2:
Colony forming units (CFU/mL) = Number of colonies counted (CFU) Volume plated (mL) x Dilution factor
2
No colonies (background micro biota) were found for both Treatments 1 and 2 for all the
dilutions due to which both the treatments were eliminated for microanalysis for the remaining
days. The apple cider that was used for the study was pasteurized thus justifying the reason for
absence of colonies in Treatment 1. For Treatments 3 and 4, a dilution factor of 10-6 was eliminated
65
for microanalysis on day 4 and 6 due to no colonies being observed on day 2. Colonies above 300
were regarded as 'Too Many To Count' for Treatments 3 and 4.
Table 4
Colony Forming Units (CFUIII7L) of Ecoli ATCC 25922 in Apple Cider with and without C/'ClI1beny
Powder at different Dilution.)' on Day 0, Day 2, Day 4, and Day 6
Days Replicate 10-1 10-2 10-3 10-4 10-5 10-6
Day 0 A" I 0 0 0 0 0 0
2 0 0 0 0 0 0
A+Cb I 0 0 0 0 0 0 2 0 0 0 0 0 0
A+C+ Ee" I TMTC" TMTC 3.4 x 106 7.8 X 106 1.2 X 107 1.0 X 107
2 TMTC TMTC 4.2x106 5.9 x 106 6.0 X 106 l.0 x 107
A+ECd 1 TMTC TMTC l.3 x 106 7.6 X 106 l.2 X 107 0 2 TMTC TMTC l.5 x 106 1.4 x 106 6.0 X 106 0
Day2 A+ C+EC 1 TMTC TMTC 9.3xl05 l.3xl06 0 0
2 TMTC TMTC l.0 x 106 I .Oxl06 LOx 106 0
A+EC I TMTC TMTC 1.8 x 106 2.1 x 106 2.0 X 106 0 2 TMTC TMTC 1.6 x 106 l.6 x 106 1.0 x 106 0
Day 4 A+C+EC I TMTC 2.7 x 105 3.5xl05 9.0 X 105 0 na
2 TMTC 2.5x105 2.5 x 105 3.0 X 105 0 na
A+EC 1 TMTC 2.3 x 105 3.9 X 105 3.0 X 105 1.0 x 106 na 2 TMTC 3.2 x 105 2.3 X 105 0 1.0 X 106 na
Day 6 A+C+EC I 3.6 x 104 9.4 X 104 l.0 X 105 0 0 na
2 3.0 x 104 9.0 X 104 1.0 X 105 0 0 na
A+EC I 3.2 x 104 5.0 X 104 2.0 x 104 LOx 105 0 na 2 1.7 x 104 5.1 x 104 2.4 X 105 LOx 105 0 na
Note. aA = Apple cider; bA+C= Apple cider + Cranbeny powder; cA+C+EC = Apple cider + Cranbeny powder + Ecoli ATCC 25922; dA+EC = Apple cider + Ecoli ATCC 25922; eTMTC= Too many to count; na= not applicable
66
A factorial decrease in the number of colonies was observed with increasing dilutions for
both treatments. It was important to note that the number of E. coli colonies were lower for apple
cider with cranberry powder compared to apple cider without the powder. There was an overall
decrease in the number of colonies for both the treatments from day 0 to day 6.
The average of the colony forming units in Table 4 including the replicates for each day and
each treatment was calculated and convelied in log CFU/g and listed on Table 5. Using Microsoft
Excel 2007 the confidence intervals (a=0.05) and standard deviations between all the colony
forming units for all the dilutions within each day were also calculated.
Table 5
Means and Confidence Intervals of Colony Forming Units (log CFUlmL) for Apple Cider with and
without Cranberry Powder on Day 0, Day 2, Day 4 and Day 6
Days Apple cider + cranberry + E.coli Apple cider + E.coli
Mean 95% Conf. Interval Mean 95% Conf. Interval
Day 0 6.87Aa ± 0.08 1 6.32 6.57 Aa ± 0.262 6.48
Day 2 5.81 Ba ± 0.08 5.58 6.10Aa ± 0.11 5.77
Day4 5.46Ba ± 0.20 5.29 5.63Aa ± 0.06 5.41
Day 6 4.65Ca ± 0.01 4.45 4.78Aa ± 0.22 4.65
Note. lMeans followed by different lower case letters in the same row are significantly different p<0.05; means followed by different upper case letters in the same column across days are significantly different
. 2 p<0 .05. Data expressed as mean ± SD
The initial mean level of E.coli on day 0 in apple cider supplemented with and without
cranbeny powder was 6.87 and 6.57 log CFU/mL, respectively, which was not significantly
different (p>0.05) ..
The log reduction was calculated from the data in Table 5 using equation 3:
Log reduction = Initial concentration (log CFU/mL) - Final concentration (log CFU/rnL) 3
67
There was an approximately 1.06 log CFU/mL reduction of E coli popUlation from day 0 to
day 2 in the cranberry powder added-apple cider that was statistically significant (p=0.00). The
apple cider without cranberry powder in comparison, did not significantly reduce the population of
Ecoli as only a 0.47 log CFU/mL was achieved from day 0 to 2 (p>0.05); thus demonstrating better
cranbelTY antimicrobial activity between day 0 and 2. In apple cider with cranberry powder, the
population of E. coli continued to decline slowly, and was not statistically significant (p=0.06) from
day 2 to day 4, as only 0.35 log reduction was achieved; and in apple cider without cranbeny
powder there was a steady reduction of 0.47 log CFU/mL which was however not statistically
significant (p>0.05). The popUlation of E coli continued to reduce from day 4 to day 6 in both the
treatments with a significant reduction (p<0.05) of 0.81 log CFU/mL for cranbelTY powder added
apple cider and 0.85 log CFU/mL for apple cider with no cranberry powder. Though the reduction
in apple cider without cranberry powder was slightly larger, compared to the reduction from day 2
to day 4, it was not significant (p>0.05). The E coli population on day 0 was significantly different
in comparison to the population on days 2, 4 and 6 in cranbelTY powder added-apple cider which
was contrary to that observed in apple cider without cranbelTY powder. The results indicate that
among each day, the E coli population decreased, but not steadily for apple cider with cranberry
powder, whereas for apple cider without cranbelTY powder there was a steady decrease in
population. It was interesting to note that cranberry powder showed the best antimicrobial activity
during the first two days, after which the activity slowed somewhat which was contrary to what was
observed in the case of apple cider without cranbelTY powder where the decline of E coli was
greater between the 4th and 6th day compared to all other days. Overall, cranbelTY powder reduced
the E coli population by 2.22 log CFU/mL from day 0 to day 6 which was statistically significant
p<O.05 (Table 5) while only a 1.79 log CFU/mL reduction was achieved for apple cider without
68
cranberry powder which was not statistically significant (p>0.05). Between the two treatments
there was no statistically significant difference (p>0.05) in the E. coli population on all days.
Figure 10 shows the inhibition of E.coli ATCC 25922 (log CFU/mL) in apple cider with and
without cranberry powder on days 0, 2, 4 and 6. The graphs were plotted using the means
calculated in Table 5 and confidence intervals were used to create the error bars . Approximately a
0.43 log CFU/mL difference in the reduction of E. coli between the apple cider with and without
cranberry powder was observed by day 6 (Figure 10) which was however not statistically
significant (p>0.05).
M .....
7.00
E .......... 6.00 ::J u.. U Q.O o .....
5 .00
4.00
6.87Aa
Day 0 Day 2 Day 4
Duration (Days)
4.65 Ca
Day 6
~Cranberry powder-apple cider
Apple cider
Figure 10. Inhibition of E. coli A TTC 25922 in apple cider with and without cranberry powder on day 0, day 2, day 4, and day 6 iMeans followed by different lower case letters between different treatments on the same day are significantly different p<0.05; means followed by different upper case letters for the same treatment across days are significantly different p<0.05.
The apple cider without cranberry powder helped inhibit E. coli population over the duration
studied indicating that time could have played a role in inhibition of the microbe. Time and
69
concentration are noted to have a synergistic effect on the reduction of Ecoli 0157:H7 at p<0 .05
(Wu et aI., 2009). The pH of apple cider was approximately 3.5, and the pH of the cranberry
powder itself was 3.7 . The pH of apple cider with cranberry powder added was 3.5. There was no
change in the pH of the apple cider after adding cranberry powder over a period of 6 days at 4°e as
it remained to be 3.5.
Although pH is found to playa major role in inhibiting microbial growth according to
previous research, the present study did not address the influence of pH on antimicrobial properties
of cranberry powder as both apple cider with and without cranberry powder were of similar pH and
the pH did not change over the course of the study. The study suggests that pH may not playa role
in the inhibition of E coli over the duration studied, which was 6 days.
Although cranbelTY powder at the designated level (2% w/w) resulted in significant
reduction (p=O .OOl) of Ecoli in apple cider from day 0 to day 6, Ecoli ATee 25922 in apple cider
was not significantly (p>0.05) suppressed by adding cranberry powder at the level studied, in
comparison to apple cider without the powder at 4°e for 6 days. Thus indicating that cranberry
powder at 2% w/w concentration cannot be used as an antimicrobial agent against E coli A Tee
25922 in apple cider. Hence, other levels of cranberry powder should be evaluated for their use as
an antimicrobial agent to suppress E coli ATee 25922 in apple cider.
Antimicrobial Effect of Cranberry Powder In Ground Beef
On Day 0, microanalysis was carried out for all the four ground beef treatments (Treatment
I-ground beef (control); Treatment 2- ground beef and cranberry powder; Treatment 3- ground
beef, cranberry powder and E coli ; Treatment 4- ground beef and E coli). Serial dilutions up to 10-5
were prepared for each of the treatments based on trial results obtained, and 0.1 mL of each of the
diluted sample was plated and colonies were counted following incubation for 24 h. The
experiment was carried out in replicates .
Table 6 shows the Colony Forming Units (CFU/g) for inoculated ground beef with and
without cranberry powder on days 0, 2, 4 and 6. The colony forming units were calculated using
equation 2 that was utilized for the apple cider experiment.
70
The mean level of background microbiota in fresh control ground beef (without pathogen
inoculation) was noted to be 3.5 log CFU/g (Wu et aI., 2009). The results obtained for Treatment 1
in the CUlTent study however contradicts the previous study. It was surprising to find that no
colonies (background microbiota) were observed for both Treatments 1 and 2 for all the dilutions
due to which both the treatments were eliminated for microanalysis for the remaining days. A
factorial decrease in the number of colonies was observed with increasing dilutions for both
Treatments 3 and 4. It was important to find that the number of E. coli colonies were lower for
ground beef with cranberry powder compared to ground beef without the powder. There was an
overall decrease in the number of colonies for both the treatments from day 0 to day 6.
71
Table 6
Colony Forming Units (CFU/g) of E.coli ATCC 25922 in Ground Beef With and Without Cranbeny Powder
at Di[ferent Dilutions on Da;t 0, Da;t 2, Da;t 4, and Day 6 Days Replicate 10-1 10-2 10-3 10-4 10-5
Day 0 Ga 0 0 0 0 0
2 0 0 0 0 0
G+Cb 1 0 0 0 0 0 2 0 0 0 0 0
G+C+ECc 1 TMTCe TMTC 1.5 x 106 2.5 X 106 l.2 X 106
2 TMTC TMTC 7.4 x lOs 8.0 x lOs 0
G+ECd TMTC TMTC 1.4 x 106 1.8 X 106 2.0 X 106
2 TMTC TMTC 1.2 x 106 2.3 X 106 0 Day 2 G+C+EC TMTC TMTC 1.4 x 106 2.1 x 106 1.0 X 106
2 TMTC TMTC 7.6x lOS 5.0 x lOS 0
G+EC TMTC TMTC 1.6 x 106 2.3 x 106 2.0 X 106
2 TMTC TMTC 6.3 x 105 4.0 X 105 1.0 X 106
Day 4 G+C+EC TMTC TMTC 2.0 x lOS 3.0 X 105 0
2 TMTC TMTC 1.2 x 106 2.9x106 0
G+EC TMTC TMTC 1.2 x 106 1.6 x 106 1.0 x 106
2 TMTC TMTC 6.0 x 105 4.0x105 1.0 x 106
Day 6 G+C+EC TMTC 1.3 x 105 2.8 X 105 5.0 X 105 0
2 TMTC 2.2 x 105 2.5 X 105 3.0 X 105 0
G+EC TMTC 2.6 x 105 2.0 X 105 2.0 x lOS 1.0 X 106
2 TMTC 3.0x 105 2.9 X 105 5.0 x lOS 0 Note. aG = Ground beef; bG+C= Ground beef + Cranberry powder; cG+C+EC= Ground beef + Cranberry powder + E.coli; dG+EC= Ground beef + E.coli; eTMTC= Too Many To Count
The average of the colony forming units (CFU/g) in Table 6 including replicates for each
day and treatment was calculated, converted to log CFU/g and listed in Table 7. Using Microsoft
Excel 2007 the confidence intervals (a=0.05), and standard deviations among the colony forming
units for all dilutions within each day were also calculated.
Table 7
lv/eans and Confidence Intervals of Colony Forming Units (log CFUlg) in Grollnd Beef With and Witholl/
Cranberry Powder on Day 0, Day 2, Day 4 and Day 6
Days Ground Beef + cranbe .... y + E.coli Ground beef + E.coli
Mean 95% Conf. Interval Mean 95% Conf. Interval
Day 0 6,03Aa ± 0.041 5.83 6.16Aa ± 0.122 5.81
Day 2 5.98Aa ± 0.03 5.76 6.12Aa ± 0.32 5.79
Day4 5.89Aa ± 0.35 5.96 5.98Aa±0.19 5.53
Day 6 5.32Aa ± 0.01 5.06 5.53Aa ± 0.12 5.29
Note. IMeans followed by different lower case letters in the same row are significantly different p<0.05; means followed by different upper case letters within the column are significantly different for same treatments among days. 2Data expressed as Mean ± SD
The initial mean level of E. coli on day 0 in ground beef supplemented with and without
72
cranberry powder was 6.03 and 6.16 log CFU/g, respectively, which was not significantly different
(p>0 .05).
The log reduction was calculated from the data in Table 7 using equation 3.
There was approximately 0.05 log CFU/g reduction of E. coli population from day 0 to day 2 in the
cranbeny powder added-ground beef, which was not statistically significant (p>0.05). Similarly
ground beef without cranbeny powder, did not significantly reduce in population as a very slight
reduction of 0.04 log CFU/g was achieved from day 0 to 2 (p>0.05), thus demonstrating no
difference after adding cranbeny powder to ground beef and a weak antimicrobial activity between
day 0 and 2.
In ground beef with cranberry powder, the population of E. coli continued to reduce from
day 2 to 4 with a decline slightly higher than from day 0 to 2, however it was not statistically
73
significant (p>0.05), as only 0.09 log reduction was achieved ; similarly in ground beef without
cranbelTY powder there was a 0.14 log CFU/g reduction of E coli that was also not statistically
significant (p>0.05). The population of Ecoli in ground beef with and without cranbelTY powder
continued to decline from day 4 to day 6 with 0.57 log CFU/g and 0.45 log CFU/g reduction,
respectively, which was however not statistically significant (p>0.05) . The Ecoli population on
day 0 was not significantly different in comparison to the population on days 2, 4 and 6 for both
ground beef with and without cranberry powder.
Overall, from day 0 to 6 cranbelTY powder reduced the Ecoli population by 0.71 log CFU/g
while only 0.63 log CFU/g reduction was achieved for ground beef without cranbeny powder.
Between these two treatments there were no statistically significant differences (p>0.05) in the
Ecoli population on days 0,2,4, and 6.
Figures 11 and 12 show petriplates containing pink colonies of E coli ATCC 25922 isolated
from ground beef supplemented with and without cranberry powder ananged in increasing order of
serial dilutions of up to 1 0-6 on day 2. There was a factorial decrease in the E coli population with
increasing dilutions.
-~/~ Figure 11. Plate counts of E coli ATCC 25922 in ground beef with cranberry powder in different serial dilutions on day 2 Top row represents Replicate 1; Bottom row represents Replicate 2
Figure J 2. Plate counts of E coli ATCC 25922 in ground beef without cranberry powder in different serial dilutions on day 2 Top row represents Replicate 1; Bottom row represents Replicate 2
74
Figure 13 shows the inhibition of Ecoli ATCC 25922 (log CFU/g) in ground beef with and
without cranberry powder on days 0, 2, 4 and 6. The graphs were plotted using the means
calculated in Table 7 and confidence intervals were used to create the error bars.
..... b.O .........
::::>
7.00
b 6.00 b.O o
...J
6.16Aa 6.12Aa
5.00 -1---- - --.-- - - - .-- - - ----.--- ------.
Day 0 Day 2 Day 4 Day 6
Duration (Days)
Cranberry powder-ground beef
_ Ground beef
Figure J 3. Inhibition of E coli ATTC 25922 in ground beef with and without cranberry powder on day 0, day 2, day 4 and day 6 [Means followed by different lower case letters between different treatments on the same day are significantly different p<0.05; means followed by different upper case letters for the same treatment across days are significantly different p<0.05.
75
The E coli population in ground beef without cranberry powder declined over the duration
studied indicating that time could have played a role in inhibition of the microbe. Time and
concentration have been rep0l1ed to have a synergistic effect on the reduction of E coli 0157 :H7 at
p<0.05 (Wu et aI. , 2009). Ground beef harbors a large population of microbes under normal
conditions; hence the decrease of E coli in ground beef could have been possibly due to the
refrigeration temperature used for storage (4°C) of the treatments. Microorganisms are generally
more physiologically active at room temperature than refrigeration temperature (Wu et aI. , 2009).
Temperature could also have influenced the antimicrobial activity of the cranberry powder. At
refrigeration temperature, the biological reactions in bacterial cells slow down; therefore, bacteria
are not sensitive to antimicrobial compounds (Yuste and Fung, 2003).
The pH of ground beef was approximately 5.5 and the pH of the cranbelTY powder itself was
3.7. The addition of2% w/w cranberry powder reduced the pH of ground beef to 5.1. There was
no change in the pH of the ground beef after adding cranberry powder over a period of 6 days at
4°C as it remained to be 5.1. Although pH is found to playa major role in inhibiting microbial
growth according to research, the present study did not address the influence of pH on the
antimicrobial properties of cranberry powder as there appeared to be no change due to a pH
difference of 0.4 (5 .5 to 5.1). The present study suggests that pH may not have a role in the
inhibition of Ecoli over the duration of 6 days.
Although no significant differences in the E coli population was found between treatments
on each day and no significant differences in the reduction of E coli was 0 bserved in cranberry
powder added-ground beef among days as shown in Figure 13, an approximately 0.08 log CFU/g
difference in the reduction of E coli by day 6 was observed between the ground beef with and
without cranberry powder, which was statistically significant (p=0.02). The present study thus
76
demonstrates that cranberry powder significantly suppressed E coli A TCC 25922 in ground beef at
the designated level of 2% w/w concentration in comparison to ground beef without the powder at
4°C for 6 days. Thus indicating that at this level, cranbelTY powder may be used as an antimicrobial
agent to control E coli A TCC 25922 in ground beef.
Comparison of E.coli Population in Cranberry Powder Added Apple Cider and Ground Beef
Figure 14 compares the inhibition of Ecoli ATCC 25922 in log CFU/mL for apple cider and
in log CFU/g for ground beef both supplemented with cranbeny powder on days 0, 2, 4, and 6. The
E coli population on day 0 was found to be 6.03 log CFU/g for cranberry added-ground beef. This
was comparatively lower than the population found in the cranbeny powder added-apple cider
which was 6.87 log CFU/mL (Figure 14) and was significantly different (p=0.00). The population
of Ecoli on day 2 was greater in ground beef with 5.98 log CFU/g compared to that in apple cider
with 5.81 log CFU/mL but there was no significant difference between them (p>0.05). There was a
very slight difference in the population of Ecoli in ground beefwith 5.89 log CFU/g and 5.46 log
CFU/mL in apple cider on day 4 although not statistically significant (p>0.05). There was however
a significant difference in the population of Ecoli on day 6 for ground beef (5.32 log CFU/g) and
apple cider (4.65 log CFU/mL).
Although significant difference in the reduction of E coli was observed in cranberry powder
added-apple cider (2.2 log CFU/mL) from day 0 to day 6 (0.001) and significant differences in the
E coli population was found between the treatments on day 0 and day 6; overall there was no
significant difference in the E coli population in apple cider compared to ground beef from day 0 to
day 6 (p>0.05) thus indicating that cranberry powder showed similar antimicrobial properties in
both apple cider and ground beef.
7.00
.-<
:::? E ........ 6.00 ::>
L.L. U '-0
Beef + cran + E.coli b.O ........ ::> L.L. 5.00 ~ Apple cider + b.O cranberry + E.coli 0
...J
4.00 -f-----..,-----..,-----.,..---------,
Day 0 Day 2 Day 4 Day 6
Duration (Days)
Figure 14. Inhibition of E.coli ATCC 25922 in both apple cider and ground beef having added cranberry powder on day 0, day 2, day 4 and day 6
77
iMeans followed by different lower case letters are significantly different between the treatments within the same day p<0.05
Quantification by RT -peR
The specificity of the primers was confirmed by the melting curve analysis . The
(forward and reverse) primers showed a single amplification product with a single amplicon peak in
the melting curve graph as shown in Figure 15. An additional peak separate from the desired
. amplicon peak would indicate contamination caused due to detection of pJimer-dimers,
contaminating DNA, and peR products from misannealed products. The melting temperature of
the DNA was observed to be 86°C.
M < Q
~ ::> ~
18
16
14
12
10
8
,~-~-;-. ....... ....:. . .:.-:---.....
-----."-.
Melt Curve
• • I'-..... .:.-.:.-..:.~_. • : • • • • • :'T . ...:..._:.. ... ___ . . . . . . . .
----- ....... --.. ~-:--""-"-. . .. :--: . .;,._-< 10'1 : .. . . .. .. . .. .. .. .... . .. . .... .
--.... ..... -....-- ......... - ..... --""". ....--....-.-.... .
. . . . . . . . . . . . . . . . . . . . . . . -:':-;.-.<.~.~~-~.~ .. '-_ ... , . . ..... . , . . .. . . , ... ... . .
~-~------- .... ....... ... 1:--0~~~-::.-~:::~ ......... 1.0:1
. ...... ..... ~~~~»-~~~ ~
5 ..... .. . . . . . . . . . . . . ..... , ..... : . . ---:-.""--: ..... ...:. .... >"~~\' .......... . .
'''-. \\. · ·-~~:~i;. ... 4
60 70 80 90 Temperature, Celsius
Figure J 5. Melting curve for E coli ATCC DNA sample at 10- dilution
A serial dilution of bacterial DNA of E coli ATCC 25922 with and without addition of
78
cranberry powder was quantified using SsoFastTiv' EvaGreen® Supermix (Hercules, Califomia). The
CT values and related cell numbers were detennined in the Real-Time PCR. The recorded gradual
increase in the sample's fluorescence above an established baseline value is proportional to the
amount of accumulated product up to this point. E coli A TCC 25922 was serially diluted upto 10-8
in 0.1 % peptone water with and without cranberry powder. Genomic DNA of the diluted samples
were extracted using FastID Genomic DNA Extraction kit and known concentrations of DNA were
quantified using RT -PCR. Figure 16 shows the amplification with CT on X-Axis and relative
fluorescence unit on Y-Axis. The CT values depend on the intial template copy number of the target
sequence and is inversely proportional to the log of the copy number. The colored curves represent
quantification for the different serial dilutions. High fluorescence and low Threshold values (CT)
were obtained for samples with large concentrations of Ecoli DNA.
10
8 .... . .. .... .
M " c <:= 0
4 .... .. .. .
2
-jS"BR : o~2 . 5H I : o
o 10
Amplification
20 30 40
Cycles
Figure 16. Amplification of serially diluted E.coli DNA with and without cranberry powder
A standard curve was plotted by plotting CT values (Threshold value) obtained from RT-
PCR analysis on the X-Axis and log CFU/mL of known concentrations of DNA on the Y-Axis
79
using Microsoft Excel 2007. The line of regression was created and using the equation of the slope,
the unknown concentrations of cells were calculated. The equation for the slope used was y =
mx+b; where m=slope, b=intercept, x=CT values (obtained from the quantification data) .
Figures 17 and 18 show the standard curves plotted for the different serial dilutions of E coli
(10,1 to 10'8) with and without cranberry powder. The concentrations of the quantified Ecoli DNA
were determined by interpolating the conesponding CT values against the standard graphs (E coli
with and without cranberry powder). The obtained concentrations from the standard graph are in
log CFU/mL.
8
7
6 -' E 5 -'-. :J
4 u... -U tl.O
3 0 -'
2
1
0
15
· ............................... ----------.... --.. ... .
T~ ...
~ T~.,
\.1 \ : ~
20 25 30
Threshold value (Cr)
35
(> Seriesl
Series2
-- Linear (Seriesl)
- - Linear (Series2)
y 1= -0.2679x + 12.264 R2 = 0.9981
y2 = -1.138x + 37 .245
R2 = 0.9866
Figure 17. Standard curve for E. coli A TCC 25922 with cranbeny powder yl= equation of slope for series 1; l =equation of slope for series 2
8
7
6
...J
E 5 -:::> b4 M o
...J 3
2
~ ~ -
T~
\ 1 - \:
: 1-----,----.----.----, 15.00 20.00 25.00 30.00 35.00
Threshold value (Cr)
V Series 1
• Series 2
-- Linear (Seriesl)
-- Linear (Series 2)
yl = -0.2946x + 12.997 R2 = 0.9931
y2 = -0.9845x + 34.232
R2 = 0.9973
'--------- - - - - - - - - ---- _ ._- --------- - - - -Figure 18. Standard curve for E. coli A TTC 25922 without cranbeny powder yl=equation of slope for series 1; l=equation of slope for series 2
Tables 8 and 9 show the concentrations calculated using the equation of the slope (log
80
CFU/mL) for the .serially diluted E. coli ATCC 25922 samples with and without cranberry powder.
81
Table 8
Concentrations of serially diluted E coli DNA with adding cranberry powder
Threshold M Calculated Concentrations value (Ct) log(CFU/mL) (Slope) b log (CFU/mL)
19.59 7 - 0.268 12.264 7.023
23.57 6 - 0.268 12.264 5.949
27 .01 5 - 0.268 12.264 5.028
29.16 4 - 1.138 37.245 4.060
30.12 3 - 1.138 37.245 2.968
31.14 2 - 1.138 37.245 1.807
31.71 1 -1.138 37.245 1.159
Table 9
Concentrations of serially diluted E coli DNA without adding cranbeny pO'wder
Threshold M Calculated Concentration value (Ct) log(CFU/mL) (Slope) b log (CFU/mL)
20.39 7 - 0.295 12.997 6.982
24.02 6 - 0.295 12.997 5.911
26.62 5 - 0.295 12.997 5.144
30.76 4 - 0.984 34.232 3.964
31 .63 3 - 0.984 34 .232 3.108
32.79 2 - 0.984 34.232 1.966
33.75 - 0.984 34.232 1.022
The concentrations of E coli DNA present in apple cider with and without cranberry powder
for days 0, 2, 4 and 6 are displayed in Table 10. The equation of the slope from standard curves
Figures 17 and 18 were used to calculate the unknown concentrations (log CFU/mL) of Ecoli DNA
quantified using RT-PCR in apple cider with and without cranberry powder, respectively, on days
0,2, 4 and 6. The equation of the slope y=mx+c was used where, x=threshold values (CT) obtained
for each of the quantified samples; m= slopes from standard curves; b=intercept from standard
curves .
Table 10
lvlean Concentrations of E. coli ATCC 25922 DNA in Apple Cider 'with and without
Cranberry Powder
Days Apple cider + Cranberry+ E.coli
Day 0
Day2
Day 4
Day 6
Log (CFU/mL) 5.32Aa ± 0.06 1
5.25Aa±0.16
4 .65Ba ± 0.01
4 .00Ba± 0.13
Apple cider + E.coli Log (CFU/mL~ 6.08Ab ± 0.11
5.91ABb ± 0.03
5 .64Bb ± 0.07
5.59Bb ± 0.16
Note. 'Means followed by different lower case letters in the same row are significantly different p<0.05; means followed by different upper case letters in same column are significantly different (p<0.05). 2Data expressed as Mean ± SD
Looking at the data in Table 10, it is interesting to note that the results obtained from RT-
82
PCR varied in comparison to the standard plate counts. The mean level of E. coli on day 0 in apple
cider supplemented with and without cranbeny powder was 5.32 and 6.08 log CFU/mL,
respectively, which was significantly different (p<0.05).
A 0.07 log CFU/mL reduction was achieved from day 0 to day 2 for apple cider with
cranbelTY powder and was statistically not significant, whereas in apple cider without cranbeny
powder, a larger E. coli reduction (0.17 log CFU/mL) was observed compared to apple cider without
cranbelTY powder, however it was not statistically significant (p>0 .05). In apple cider with
cranbeny powder, the population of E. coli declined significantly, from day 2 to day 4, as a 0.6 log
CFU/mL reduction was achieved; whereas in apple cider without cranbelTY powder there was a
steady reduction of 0.27 log CFU/mL, which was not statistically significant (p>0.05). A reduction
of 0.65 log CFU/mL was achieved in cranbelTY powder added-apple cider from day 4 to day 6
which was slightly larger compared to the reduction from day 2 to day 4 but was not statistically
significant (p>0.05). The inhibition was slow and not statistically significant in apple cider without
83
cranberry powder as only 0.06 log CFU/mL was achieved from day 4 to day 6. The results indicate
that among each day, the E.coli population declined much better in apple cider supplemented with
cranberry powder, compared to apple cider without cranberry powder.
Cranberry powder showed the best antimicrobial activity during the last two days, which
was contrary to what was observed in the case of apple cider without cranberry powder where the
decline of E. coli was slow during the days. There \-vas significant difference in the E. coli
population between the two treatments on all days (p<0.05). Cranberry powder reduced the E. coli
population by 1.32 log CFU/mL from day 0 to day 6 which was statistically significant p<0.05
(Table 10) and a 0.49 log CFU/mL reduction was achieved for apple cider without cranberry
powder from day 0 to day 6 which was also statistically significant (p=0.02).
The addition of cranberry powder at 2% w/w concentration resulted in a 0.83 log CFU/mL
difference in the reduction of E. coli in apple cider compared to apple cider without cranberry
powder by day 6, that was found to be statistically significant (p<0.05). This was contrary to the
results obtained using the standard plate counts, which showed that adding cranberry powder at the
2% w/w did not significantly inhibit E. coli compared to apple cider without cranberry powder. The
difference in results between RT-PCR and standard plate counts may have been due to experimental
errors during serial dilution and plate counting technique.
Figure 19 shows the inhibition of E.coli ATCC 25922 in apple cider with and without
cranberry powder on days 0, 2, 4 and 6.
7 6.08Ab
6
5 ...... E
4 ........ :J u.. u
3 b.O 0 ......
2
1
0
DayO
5.59Bb
Day 2 Day 4 Day 6
Duration (Days)
Apple cider + Cranberry + E.coli
Apple cider + E.coli
- - - - - Log. (Apple cider + Cranberry + E.coli)
-- Log. (Apple cider + E.coli)
Y J= -0.978In{x) + 5.8269
R2 = 0.7943
y2 = -0.315In{x) + 6.3555
R2 = 0.9734
84
Figure 19. Concentrations of E coli A TCC 25922 in apple cider with and without cranbelTY powder on day 0, day 2, day 4 and day 6 using RT-PCR Where y' = equation of slope for Apple Cider + Cranberry Powder + E coli; y2 =equation of slope for Apple Cider + E coli 'Means followed by different lower case letters in the same day are significantly different p<0.05; means followed by different upper case letters in same column are significantly different p<0.05.
The trend lines represent a logarithmic decrease in the population of E coli with a larger
slope of -0.978 for apple cider with cranberry powder and a smaller slope of -0.315 for apple cider
without cranberry powder (Figure 19). This indicates a larger decrease in the population of E coli
when adding cranberry powder compared to apple cider without cranberry powder thus indicating
better antimicrobial activity against E coli after adding the designated level (2% w/w) of cranberry
powder to apple cider. The line of regression is found to diverge which means that the inhibition
rate is increasing with the number of days which was contrary to the results obtained in the standard
plate counts.
The addition of cranbelTY powder at the designated level of2% w/w did significantly reduce
Ecoli population in apple cider (p>0.05) for the duration of 6 days. The RT-PCR results thus
showed that cranbelTY powder at the tested concentration may be used as an antimicrobial agent
against E coli ATCC 25922 in apple cider.
85
The calculated concentrations of Ecoli DNA present in ground beef with and without
cranbeny powder for days 0, 2, 4 and 6 are displayed in Table 11. The equation of the slope from
Figures 17 and 18 were used to calculate the unknown concentrations (log CFU/mL) of Ecoli DNA
quantified using RT-PCR in ground beef with and without cranberry powder, respectively on days
0, 2,4 and 6. The equation of the slope y= mx+c was used where: x=threshold values (Cr) obtained
for each of the quantified samples; m= slopes from standard curves; b=intercept from standard
curves.
Table 11
Mean Concentrations of Ecoli ATCC 25922 DNA in Ground Beefwith and without Cranberry
Powder
Days Beef + Cranberry + E.coli Beef + E. coli Log(CFVlg) Log (CFU/g)
Day 0 6.18Aa± 0.38 1 6.62Ab ± 0.542
Day2 6.14Aa ± 0.35 6.42Ba ± 0.49
Day 4 6.10Aa ± 0.35 6.34Bb ± 0.52
Day 6 5.96Ba ± 0.47 6.27Bb ± 0.52
Note. IMeans followed by different lower case letters for each day are significantly different between different treatments on the same day p<0.05; means followed by different upper case letters in the same column among different days are significantly different (p<0.05). 2Data expressed as Mean ± SD
Table 11 shows the mean CFU/g of Ecoli in ground beef with and without cranbeny
powder on days 0, 2, 4 and 6. The mean level of E coli on day 0 in ground beef supplemented with
and without cranbeny powder was 6.18 and 6.62 log CFU/g, respectively, which was significantly
different (p<0.05).
There was approximately a 0.04 log CFU/g reduction of E coli from day 0 to day 2 in
ground beef supplemented with cranbeny powder, which was lower in comparison to the reduction
in ground beef without the powder (0.2 log CFU/g) , however the difference was not statistically
86
significant (p>0.05). A steady reduction of 0.04 log CFU/g was observed in the Ecoli population
from day 2 to day 4 in ground beef with cranbeny powder, whereas in ground beef without
cranberry powder, the population of Ecoli declined slowly (0.08 log CFU/g) and was lower
compared to the decline from day 0 to day 2, but was statistically not significant (p>0.05). The
population of Ecoli declined significantly (p<0.05) from day 4 to day 6 (0.14 log CFU/g) for
ground beef with cranberry powder, and a 0.07 log CFU/g reduction was observed in ground beef
without cranberry powder which was not statistically significant. Though there was a steady and
slow decline of E coli initially; a larger decline was observed during the last two days for ground
beef supplemented with cranberry powder whereas for ground beef without cranberry powder there
was an unstead y decrease in E coli population.
There was a significant difference in the E coli population between the two treatments on all
days except day 2. Overall, cranbelTY powder significantly reduced the E coli population by 0.22
log CFU/g from day 0 to day 6 (Table 11), however a larger reduction of 0.35 log CFU/g was
achieved in ground beef without cranberry powder which was statistically significant (p<0.05).
There was a 0.13 log CFU/g difference in the reduction of E coli A TCC 25922 between ground
beef with and without cranberry powder by day 6, with better overall reduction observed in ground
beef without cranberry powder.
- ---------_ ................... _ ....... _---_ .•........................•.. - .. _ . .... ..... ... .. _ .. .... ... _ .. __ ._ .. _._._ .. _ .. _-_ ............ .
6.80 I---------------- --r-----------,
6.60
6.40 -\-- --f
6.20 -\-- -t -- -
6.00
5 .. 80
5.60 -j--.......... __ "--,--........ __ '-,--...I...;._--I'-.,...--___ -'--,
Day 0 Day 2 Day 4 Day 6
Beef + Cranberry + E.coli
Beef + E.coli
Log. (Beef + Cranberry +
E.coli)
-- Log. (Beef + E.coli)
yl = -0.139In(x) + 6.2053 R2 = 0.7593
y2 = -0.251In(x) + 6.6118 R2 = 0.9936
Figure 20. Concentrations of Ecoli ATCC 25922 in ground beef with and without cranberry powder on day 0, day 2, day 4 and day 6 where yl=equation of slope for Ground Beef + CranbelTY Powder + E coli; l =equation of slope for Ground Beef + E coli
The trend lines (Figure 20) showed a larger slope of -0.251 for ground beef without
87
cranbeny powder and a smaller slope bf -0 .139 for ground beef with cranbeny powder; indicating a
better decline in population in ground beef without cranberry powder. The results obtained using
RT-PCR was contrary to that observed in the standard plate counts which showed that adding
cranbelTY powder at the designated level (2% w/w) did not result in better antimicrobial activity
compared to ground beef without cranberry powder. This could have been due to elTors during
DNA extraction and possible contamination in the PCR reaction mix.
Since adding cranbeny powder at the tested concentration did not show better antimicrobial
activity compared to ground beef without cranberry powder, it cannot be considered as an
antimicrobial agent to control E coli A TCC 25922 in ground beef.
Sensory Evaluation
The participant size for this sensory evaluation was 104 untrained panelists. Table 12 shows
the mean sensory attributes of control and 2% w/w cranbeny powder added-ground beef patties .
88
The mean intensity ratings (5-point intensity rating scale, where 1 =Low, 3=Moderate, 5=High)
shown in Table 12 indicate that there was no significant difference in the color, cooked beef flavor,
cardboard flavor, grainy texture and afieliaste (p>0.05) of the control and cranberry powder added-
beef patties.
Table 12
Jvlean Sensory Attribute!/ of Control and Cranberry Powder added-Ground Beef Patties
SensOlyattribute Ground Beef Ground Beef + Cranbeny Powder Meanb Mean
Color 3.70a ± 0.98 3 .46a ± 1.04c
Sweetness 1.45b ± 0.78 1.94a ± 0.98
Cooked Beef flavor 2.71a ± 0.84 2.54a ± 1.0 I
Cardboard flavor 2.72a± 1.17 2.86a± 1.38
Juiciness 1.55b ± 0.78 1.76a ± 0.83
Grainy texture 2.77a ± 0.95 2.75a ± 1.26
Aftertaste 2.54a ± 0.83 2.36a ± 1.03
aMeans followed by different lower case letters within the same row are significantly different
p<0.05. bFive-point intensity rating scale (1 = Low; 3=Moderate; 5= High)
CData represented as Mean ± SD; n=1 04
The mean scores for color for both control and cranberry powder added-beef patties were
3.70 and 3.46, respectively, indicating that the control was slightly darker compared to the
cranberry powder added-beef patty. Cranberry powder had a bright reddish-purplish color which
could impali the distinct color when blended with beef. Foods manufactured with heat retain the
color and nutritional qualities of the cranberry powder (Sojitz Corporation, 2007). Broiling did not
affect the color of the cranberry powder, but retained the powder color in the beef patty. Also it
89
was observed that the control required more time to cook, approximately 10 minutes compared to
the powder-added beef which took 6 minutes. The approximate cooking times for 0%, 2.5%, 5%,
and 7.5% cranberry concentrate added burger patties to reach an internal temperature of 160°F have
been previously recorded to be 13 minutes, 11 minutes, 10 minutes, and 9 minutes, respectively
(Wu et al., 2009). The duration of heat exposure could have increased the browning of the meat
thus imparting a darker color. The mean scores for cooked beef flavor were 2.71 for control and
2.54 for cranbelTY powder added-ground beef patty. Cooking the beef could have masked the actual
flavor of the powder thus not impacting cooked beef flavor in the cranberry powder added-ground
beef patty. The mean cardboard flavor was 2.72 and 2.86 for the control and the cranberry powder
added-beef patty, respectively. Although the cranberry powder had a distinct cranberry seed-like
flavor, which could have impacted the flavor of the beef patty, it did not produce a cardboard-like
flavor on adding it to the beef. The mean scores for grainy texture were 2.77 and 2.75 for the
control and cranberry powder added-beef patty, respectively. It was surprising to find that
consumers found the control to be slightly grainjer compared to the cranberry powder added-beef
patty, since the gritty and grainy texture of the powder due to it being composed of seed, pulp, peel
and stalks of the fruit was not noticeable.
The cranberry powder added-beef patty had a significantly larger (p=O.OO) mean of 1.94 for
sweetness compared to the control with mean of 1.54. The cranberry powder is composed of
fructose, glucose and maltose (Sojitz Corporation, 2007), which justifies the higher level of
sweetness of the cranbeny powder supplemented-ground beef. The juiciness was higher in the
cranberry powder added-sample (1.76) which was significant (p=O.OO) compared to control (1.55).
The mean scores for aftertaste were 2.54 for control and 2.36 for cranberry powder added-beef
patty. This demonstrates no adverse impact on the mouth feel of these patties when cranberry
90
powder was incorporated. The cranberry powder was slightly juicier which could be due to the
lesser time required for cooking that helps retains the moisture in the meat. Another factor
contributing to the juiciness could be the moisture content of the cranberry powder (79%) (Soj itz
Corporation,2007). The dryness of the beef patties could have been due to the beef being 95% lean
which removes all the moisture in the beef while cooking.
Figure 21 shows the overall acceptability of control and cranberry powder added-beef patty.
Overall Acceptance!
5
N 4 tlJ) c . .;:; 2.42a ± 1.09 ro 2.41a ± 1.23 Control
2% Cran-beef
0:: 3 u ·c ~~~~~~---------~
0 "0 OJ 2 I
1
Control 2% Cran-beef
Figure 21. Overall acceptance of control and 2% w/w cranberry powder added-beef patties ! Bars having different letters are significantly different (p<0.05); 2 Five-point hedonic rating scale (1 = dislike very much; 3= neither like nor dislike; 5= like very much); n=1 04
The overall acceptance means of the control and cranberry powder added-beef patty were
2.42 and 2.41, respectively and were not significantly different (p=0.94), (5-point hedonic rating
scale, where 1 = dislike very much, 3= neither like nor dislike, 5= like very much) that were in the
neither like nor dislike range which may suggest that the consumers were neutral on both samples.
The results obtained for overall acceptability was lower for ground beef supplemented with
and without 2 .0% w/w cranberry powder compared to the scores obtained by Wu et ai. , (2009) for
burgers supplemented with 2.5% w/w cranberry concentrate and without cranberry concentrate
91
which were 6.78 and 6.4, respectively, on a 9-point hedonic scale. The results thus show that
adding 2% cranberry powder to beef did not significantly affect the overall sensory attributes of the
beef patty.
The preferences of the control and cranbeny powder added-beef patty are shown in Figure
22. According to the critical number of COlTect responses (Meilgaard et aI., 1991), there was no
significant difference (p>0.05) in the preference of the control (51 %) over the 2% cranberry powder
added-beef patty (49%) even though more people preferred the control. Thus demonstrating that
cranbelTY powder at the designated level of2% w/w can be considered an ideal concentration to be
added into ground beef.
o Control
02% cran-beef
Figure 22. Preference of control and 2% w/w cranberry powder added-beef patties n=104 (p>0.05)
92
Chapter V: Conclusion
The objective of the study was to explore the antimicrobial properties of2% w/w conc.
cranberry powder against E coli A TCC 25922 in concentrated apple cider and 95% lean ground
beef stored at 4°C for a duration of 6 days. The population of Ecoli ATCC 25922 in both apple
cider and ground beef with cranberry powder was counted by Standard Plate Count Technique and
quantified using the RT-PCR. The sensory characteristics of cooked ground beef patty with and
without cranberry powder were evaluated. The microbiological analysis was carried out in
duplicates for all serial dilutions.
The Kirby Bauer antimicrobial test showed that E coli A TCC 25922 was less sensitive to
the cranberry-methanol extract with an average zone of inhibition of 9.3 mm at 1: 1 0 dilution
indicating that cranberry powder did not significantly help suppress the growth of E coli A TCC
25922 (p>O.05). Investigation of the antimicrobial propeliies of cranbelTY extracts by the diffusion
to agar method showed that L. monocytogenes was found to have average resistance, and E coli
was the least sensitive with an average zone of inhibition of 15 mm (Viskelis et aI., 2009).
The highest inhibition was observed in cranbelTY powder added-apple cider between day 0
and 2 which was statistically significant (p<0.05), in comparison to the remaining days where the
inhibition was found to be slow. Overall, even though E coli population decreased gradually over
the duration of 6 days for apple cider supplemented with cranbelTY powder, the decrease was not
statistically significant when compared to the control (apple cider without cranbelTY powder) on
day 6. Hence, cranbelTY powder at the CUlTent level is not effective as an antimicrobial agent
against E coli A TCC 25922 in apple cider.
93
Though there was statistically no significant difference (p>0.05) in the inhibition of Ecoli
among days for cranberry powder added-ground beef; a 0.08 log CFU/g difference in the reduction
of E coli was observed between the ground beef with and without cranberry powder by day 6
(Figure 13), which was statistically significant (p=0.02). Thus indicating that cranberry powder at
the designated level (2% w/w) possesses antimicrobial benefits against E coli ATCC 25922 in
ground beef.
The initial Ecoli population was significantly (p<0.05) larger in apple cider containing
cranberry powder compared to cranberry powder added-ground beef. Though cranberry powder
showed better reduction of Ecoli population in apple cider from day 0 to day 6 in comparison to
ground beef, the difference was not statistically significant (p>0.05). Thus indicating that, textural
differences between the two food samples did not seem to have a significant influence on the action
of cranbelTY powder on E coli.
Temperature could have been a contributing factor for the inhibition of E coli apart from
cranberry powder. Microbes are generally more physiologically active at room temperature than at
refrigeration temperatures (Wu et a!., 2009). The low temperature could have helped slow down
grovvth of the microbe over the duration of 6 days.
Both ground beef and apple cider with and without cranberry powder inhibited Ecoli,
however the inhibition of E coli by cranberry powder was less noticeable with increasing number of
days for both ground beef and apple cider probably due to the resistance offered by the microbe.
Previous research indicated that cranberry concentrate has greater antimicrobial effects on
food borne pathogens at 21°C than 7°C (Wu et a!., 2008). At refrigeration temperature the bacterial
cells slow down; therefore, bacteria are not sensitive to antimicrobial compounds (Yuste and Fung,
2003). Also as pathogens get exposed to the cold temperature, they adapt and change their cell
surface composition thus reducing the antimicrobial effectiveness of cranberry concentrate on
pathogens (Nair et aI., 2005).
94
There was no significant difference (p>0.05) in the pH of apple cider supplemented with
and without cranberry powder over the duration of 6 days. In ground beef, the addition of
cranbelTY powder reduced the pH from 5.5 to 5.1, however the pH remained to be 5.1 during the 6
days. Thus concluding that cranbelTY powder did not influence the pH properties of apple cider and
ground beef thereby pH did not seem to be a contributing factor for the decrease in E. coli
population.
The RT -PCR was used to quantify the E. coli population in apple cider and ground beef after
supplementation of the cranberry powder. The results obtained using RT-PCR was contrary to that
observed in the standard plate counts in the case of apple cider. Overall, there was signiflcant
difference (p<0.05) in the inhibition of E. coli for apple cider with cranbelTY powder in comparison
to apple cider without cranberry powder on day 6. In the case of ground beef, cranberry powder
showed poor antimicrobial activity compared to ground beef vvithout cranberry powder on day 6
(p<0 .05). However, in the standard plate counts ground beef with cranbeny powder showed better
antimicrobial activity on day 6 compared to ground beef without cranberry powder. The difference
in results obtained for ground beef may be due to experimental errors during DNA extraction and
contamination of the PCR reaction mix.
The study also aimed to evaluate the sensory properties of ground beef supplemented with
cranberry powder. There was no significant difference (p>0.05) in the color, cooked beef flavor,
cardboard flavor, grainy texture and after taste of the cranberry added cooked ground beef patty in
comparison to the cooked ground beef patty (control). There was however a significant increase
(p<0.05) in the sweetness and juiciness in the cranberry powder-added beef patty compared to the
95
cooked ground beef patty. This difference could have been due to the higher degree of sweetness
impatied by the cranberry powder itself which can be further justified with the high mean scores
obtained in the study. The mean score for juiciness was also higher for the cranberry powder
added ground beef patty compared to the control which indicates that the control patties were
significantly drier. There was no significant difference (p>O.05) in the overall acceptance of the
two products. The preference ratings show that the control was favored slightly higher than the
cranberry powder added-ground beef patty but the preference was not significantly different
(p>O.05). The sensory study concludes that 2% w/w concentration of cranberry powder could be
considered an ideal concentration for adding into ground beef. However, evaluating the
antimicrobial effect of cranberry powder showed that 2% w/w cranberry powder was not successful
in achieving a significant reduction of E coli A TCC 25922 in apple cider based on standard plate
counts but helped significantly suppress Ecoli in apple cider and ground beef based on RT-PCR.
Cranberry powder significantly reduced E coli in ground beef based on the standard plate counts,
whereas RT-PCR results showed better reduction of Ecoli in ground beef without cranberry
powder for the duration of 6 days . Hence, it is uncertain whether cranberry powder at the current
level can be used an ideal preservative or additive in controlling E coli A TCC 25922 in apple cider
and ground beef.
Based on the research fUliher steps are recommended to understand more about the
antimicrobial properties of the cranberry powder and the components that contribute to this
property.
Recommendations
The following steps are recommended for further research
96
1. Evaluate the antimicrobial propel1ies of the cranberry powder at different concentrations
and at different temperature conditions.
2. Compare the antimicrobial properties of cranbelTY powder and cranbelTY concentrate in
ground beef with different fat contents.
3. Identify and extract the components that may contribute to the antimicrobial effect of the
cranberry powder.
4. Determine if cranberry powder will have synergistic effects if blended with other
various nutraceuticals to give the added health benefits .
97
References
Allanson, A., Curry, R., Unklesbay, N., Iannotti, E., Ellersieck, M. (2000). Effect of soluble
polylactic acid during refrigerated storage of ground meats inoculated with Escherichia coli
0157:H7. J FoodSajety, 20, 13-25. doi: 10.11111j.1745-4565.2000.tb00285.x
Amakura, Y., Umino, Y. , Tsuji, S., & Tonogai, Y. (2000). Influence of jam processing on the
radical scavenging activity and phenolic content in berries. J Agric. Food Chern, 48, 6292-
6297. doi: 10.1 0211jfO00849z
Amerine, M. A., Pangborn, R. M., & Roessler, E. B. (1965). Principals of sensory evaluation of
food. New York: Academic Press.
Anderson, S., & Bailey. (2001). Recent FDA juice HACCP regulations. Food Sa! kJag N15 : 18-
25.
Aref, G. M., & Charles, W. N. (1986). Microbial inhibitors of cranberries. J Food Sci. 51, 1009 -
10l3. doi: 10.11111j .1365-2621.1986.tbl1220.x
Aref, G. M., & Nagel, C. W. (2006). Characterization of cranberry benzoates and their
antimicrobialpropelties. JFoodSci., 51(4), 1069-1070.doi: 10.11111j.1365-
2621.1986.tb 11236.x
ASTM. (1968). Manual on sensory testing methods, no. 434. Philadelphia, PA: American Society
for Testing and Materials .
Barbara, C. (1994). Cranberry scare of 1959. Retrieved from
http://www.eisenhower.archives.gov/ResearchiSubject_ GuidesIPDFsl1959 _Cranberry_Scar
e.pdf
Barbaste, M., Berke, D., Dumas, M., Soulet, S., Delaunay, J. C. , Castagnino, c., Arnaudinaud,
V., Cheze, C. , & Vercauteren, J. (2002). Dietary antioxidants, peroxidation and
cardiovascular risks, J NutI'. Health Aging, 6, 209-223.
Beighton, D. (2005). The complex oral microflora of high-risk individuals and groups and its
role in the caries process. Community Dent Oral Epidemiol, 33, 248-255. doi:
10.11111j.1600-0528.2005.00232.x
Besser, R. E., Lett, S. M., Weber, J. T., Doyle, M. P., BalTett, T. J., Wells, J. G., & Griffin, P. M.
(1993) . An outbreak of dian-hea and hemolytic uremic syndrome from Escherichia coli
01 57:H7 in fresh-pressed apple cider. JAm Med Assoc., 269, 2217-2220.
Bilyk, A., & Sapers, G. M. (1986). Varietal differences in the quercetin, kaempferol, and
98
myricetin contents of high bush blueberry, cranberry , and thornless blackberry. J Agric Food
Chern., 34, 585-588. doi: 10.1021/jfO0070a001
Border, P. M., Howard J. J., Plastow, G. S., & Siggens, K. W. (1990). Detection oflisteria
species and listeria monocytogenes using polymerase chain reaction. Letters in Applied
Microbiology, 1, 158-162. doi: 10.1111/j.1472-765X.1990.tb00149.x
Bowen, W. H. (2002). Do we need to be concerned about dental caries in the coming
millennium? Crt! Rev Oral BiolMed. ]3,126-131. doi : 10.11771154411130201300203
Bravo, L. (1998) Polyphenols: Chemistry, dietary sources, metabolism, and nutritional
significance. Nutr Rev. , 56, 317-333. doi: 1 O.llll/j .1753-4887.1998 . tbO 1670.x
Brittany L. W. , Luke R. H., & Ronald L. P. (2009). Proximate and polyphenolic characterization
of cranberry pomace. J Agric. Food Chern., 58(7): 4030-4036. doi: 10.1 0211jf902829g
Burlington County Library System. (2007). Cranberries in New Jersey. Retrieved from
http://www.burlco.lib.nj.us/pinelands/cranber.shtml
Cao, R., Russell, R. M., Lischner, N., & Prior, R. L. (1998). Serum antioxidant capacity is
increased by consumption of strawben-ies, spinach, red wine or vitamin C in elderly
women. J Nut!'., 128, 2383-2390.
Cape Code Cranberry Growers Association. (2010). History 0/ cranberries. Retrieved from
http://www . cranberries. org/ cranbelTies/history. html
Catherine, C. N. (2007) . Cranberry and Its Phytochemicals : A Review ofln Vitro Anticancer
Studies. Journal/or Nutrition, 137, 186S- 1935.
Centers for Disease Control and Prevention. (1975). Salmonella typhimurium outbreak traced to
a commercial apple cider-New Jersey. lvlorb. lvlortal. Wkly. Rep., 24, 87-92.
Centers for Disease Control and Prevention. (1996). Outbreak of Escherichia coli 0157:H7
infections associated with drinl<;:ing unpasteurized commercial apple juice- British
Columbia, California, Colorado, and Washington. lvlorbid lvlortal Wkly Rep., 45, 975.
Centers for Disease Control and Prevention. (1997). Outbreak of Escherichia coli 0157:H7
infection and cryptosporidiosis associated with drinlGng unpasteurized apple cider -
Connecticut and New York, October, 1996. Morbid Mortal Wkly Rep. 46(1) :4-8.
Centers for Disease Control and Prevention. (2005). Foodborne illness. Retrieved from
http://wwvv.cdc.gov/ncidod/dbmd/diseaseinfo/foodbomeinfections_g.html
Centers for Disease Control and Prevention. (2010). Multistate outbreak 0/ E. coli
0157:H7 injections associated 1-vith beef.from national steak and poultfY. Retrieved from
http://www.cdc.gov/ecoli/20 1 Olindex.html
Chambers, E., & Wolf, M. B. (1996). Sensory testing methods. Philadelphia: CRC Press.
Chao, 1., Li, H., Cheng, K., Yu, M ., Chang, C. R., & Wang, M. (2009). Protective effects of
pinostilbene, a resveratrol methylated derivative, against 6-hydroxydopamine-induced
neurotoxicity in SH-SY5Y cells. J Nutri. Biochem., 21(6), 482-489.
99
ChemLab. (2008). Vaccum filtration. Retrieved from
http://'v,,"ww . dartmouth . ed ll/~chemla b/techn iq ues/vfil tra ti on.html
Chen, H., Zuo, Y., & Deng, Y. (2001). Separation and determination offlavonoids and other
phenolic compounds in cranberry juice by high performance liquid chromatography. J
Chromatogr., 913, 387-395. doi: 10.1 016/S0021-9673(00)01 030-X
100
Chicago Tribune. (2008). Beef recall is largest in history. Retrieved from Chicago Tribune:
http ://articles.chicagotribune.com/2008-02-18/news/0802170492 _1_ground-beef-usda-recall
Choi, J. A., Kim, J. Y., Lee, J. Y., Kang, C. M., Kwon, H. J., Yoo, Y. D., Kim, T. W., Lee, Y. S., &
Lee, S. J. (2001). Induction of cell cycle arrest and apoptosis in human breast cancer cells by
quercetin . Int. J Oncol., 19, 837-844.
Chopra, M . (2000). Nonalcoholic red wine extract and quercetin inhibit LDL oxidation without
affecting plasma antioxidant vitamin and carotenoid concentrations. Clinical Chemistry, 46,
1162-1170.
Comes, J. E. , & Beelman, R. B. (2002). Addition of fumaric acid and sodium benzoate as an
alternative method to achieve a 5-log reduction of Escherichia coli 0157 :H7 populations
in apple cider. J Food Prot, 65, 476-83.
Conner, D . E., Scott, V. N., & Bernard, D . T. (1990). Growth, inhibition and survival of Listeria
monocytogenes as affected by acidic conditions. J Food Prot., 53, 652-655.
Cunningham, D. G., Varmozzi, S. A. , Turk, R., Roderick, R ., O'Shea, E., & Brilliant, K. (2004).
Cranberry phytochemicals and their beneficial health benefits. In: Shahidi, F ., Weerasinghe,
D.W. , Nutraceutical, Beverages, Chemistry, Nutrition, and Health Effects. ACS,
Washington, DC, 35-51.
101
Cunningham, D. G., Krueger, C. G., Porter, M.L., Reed, J. D., & Wiebe, A D. (2001). Cranberry
proanthocyanidins associate with low-density lipoprotein and inhibit in vitro Cu2+ -induced
oxidation . Journal of the Science of Food and Agriculture, 81(14): 1306-1331. doi:
10.1002/jsfa.940
David, R. P. (2009). Cranberry and Urinary Tract Infections. lournalfor Drugs, 69(7), 775-807.
Denise, R., Eblenbassama, A A, & Gerald, M. S. (2005). Studies to select appropriate
nonpathogenic surrogate Escherichia coli strains for potential use in place of Escherichia
coli 0157:H7 and Salmonella in pilot plant studies. J Food. Prot, 68,282-291.
Diane, M. B., Laszlo, P. S., & Hosahalli, S. R. (Eds). (2004). Processing offruits: Plums and
Prunes. Boca Raton: CRC Press.
Duarte, S., Gregoire, S., Singh, A P., Vorsa, N., Schaich, K., William, H. B., & Koo, K. (2005).
Inhibitory effects of cranbeITY polyphenols on formation and acidogenicity of
Streptococcus mutans biofilms. FEMS kJicrobiol Lett, 257(1): 50-56.
Eschenbecher, F., & Josh, P. (1977). Research on the inhibitors in cranberries. Acta Hort.
61,255.
Fellers, C. R., Redmon, B. c., & PaITott, E. M. (1933). Effect of cranberries on urinary acidity
and blood alkali reserve. lournal 0.1 Nutrition, 6(5),455-463.
Ferguson, PJ., Kurowska, E., Freeman, D. J., Chambers, A F., Koropatnick, D. J. (2004). A
flavonoid fraction from cranberry extract inhibits proliferation of human tumor cell lines.
Journal 0.1 Nutrition, 134(6), 1529-35.
Ferro-Luzzi, A, Maiani, G., & Serafini, M. (1997). Effect of ethanol on red wine tannin- protein
(BSA) interactions. 1 Agric Food Chern., 45, 3148-51. doi: 10.1 0211jf960864x
Foo, L. Y , & Porter, L. J. (1980). The phytochemistry of proanthocyanidins polymers.
Phytochemistry, 19,1747-1754. doi: 10.1016/S0031-9422(00)83807-8
Foo, L. Y, Lu, Y, Howell, A B. & Vorsa, N. (2000). A-Type proanthocyanidin trimers from
cranbelTY that inhibit adherence of uropathogenic P-fimbriated Escherichia coli. J Nat
Prod, 63,1225-1228. doi : 10.10211np000128u
Food Safety Risk Assessment. (2001). Unpasteurized apple cider risk assessment
102
introduction and summC/ly. Retrieved from
hUp://www.omafra.gov.on.ca/englishlfoodlinspectionifruitvegirisk_assessmentydf/applecid
erl30ra.pdf
Frankel, E. N. (1993). Inhibition of oxidation of human low-density lipoprotein by phenolic
substances. The Lancet, 341,454-457. doi: 10.1016/0140-6736(93)92472-6
Francis, F. 1. (1957). Color and pigment measurement in fresh cranbenies. Proc. Am. Soc.
Hortic. Sci., 69, 296-301.
Frenzen, P. D., Drake, A, & Angulo, F. 1. (2005). The emerging infections program foodnet
working group: Economic cost of illness due to Escherichia coli 0157 infections in the
United States. J Food Prot. 68, 2623-2630.
Fruit Essentials. (2006). Fruit forward: Official newsletter of fruit essentials, Inc. Retrieved
August 8, 2009, from http://fruitessentia1s.comLdocuments/fruitforward.pdf
Germon, P., Ray, M. c., Vianney, A, & Lazzaroni, 1. C. (2001) . Energy-dependent
conformational change in the TolA protein of Escherichia coli involves its N-terminal
domain, ToIQ, and ToIR. JBacteriol, 183, 4110-4114. doi: 1 0.1128/JB.183 .14.411 0-
4114.2001
Ghaedian, R., & Shetty, K., Vattem, D. (2005). Enhancing health benefits of berries through
phenolic antioxidant enrichment: focus on cranberry. Asia Pacific Journal of Clinical
103
Nutrition, 14(2), 120-130.
Graf, B. (2005). Flavonols, flavones, flavanones, and human health: Epidemiological evidence.
Journal of Medicinal Food, 8, 281-290.
Groff, 1., Groupper, S. S., & Smith, 1. L. (2005). Advanced nutrition and human metabolism.
Belmont, CA: Thomson WadswOlih.
Gotteland, M., Andrews, M., Toledo, M., Munoz, L. , Caceres, P., Anziani , A. , Wittig, E., Speisky,
H. , Salazar, G. (2008). Modulation of Helicobacter pylori colonization with cranberry juice
and Lactobacillus jolmsonii La 1 in children. Nutilion Journal, 24(5),421-6
Gu, L., Keirn, M., Hammerstone, J. F., Beecher, G., Cunningham, D., Vannozzi, S., & Prior, R.
L. (2002). Fractionation of polymeric procyanidins from lowbush bluebelTY and
quantification of procyanidins in selected foods with an optimized normal-phase HPLC
MS fluorescent detection method. J Agric. Food Chern., 50, 4852-4860. doi:
10.1021/jfD20214v
Gupta, K., Chou, M., Howell, A., Wobbe, C., Grady, R., & Stapleton, A. (2008). Cranberry
products inhibit adherence of P-fimbriated Escherichia coli to primary cultured bladder
and vaginal epithelial cells. The Journal of Urology, 177(6),2357-2360. doi:
10.10 16/j juro.2007.0 1.114
Hale, M. L., Francis, F. J., & Fagerson, L. S. (1986). Detection of enocyanin in cranbeny juice
cocktail by HPLC anthocyanin profile. Food Chern., 51,1511-1513. doi: 10.111l/j.1365-
2621.1986.tb13847.x
HalTis, D . M., Besselink, E., Henning, S. M., Go,V. L. W., & Heber, D. (2005). Phytoestrogens
induce differential estrogen receptor alpha- or beta-mediated responses in transfected
breast cancer cells. Exp Bioi ivJed., 230, 558-568.
Haslam, E. (1996). Natural polyphenols (vegetable tannins) as drugs: Possible modes of action.
J Nat Prod., 59,205-215. doi: 10.10211np960040
Hayatsu, H., Arimoto-Kobayasru, S., & Negishi , T. (1998). Methodologies for testing food anti
mutagens. Sixth Int. Congress on Mechanisms of Antimutagenesis and
Anticarcinogenesis. France, Arcachon. p. 64.
104
Herrmann, K. (1976). Flavonols and flavones in food plants: A review. J Food Te c!mo I. , 11,433-
448 . doi: 10.11111j.1365-2621.1976.tb00743.x
Herrmann, K. (1988). On the occurence of flavonol and flavone glycosides in vegetables: A
review. ZLebensm-UntersForsch. , 186, 1-5. doi: 10.10071BF01027170
HeImann, K. (1989). Occurrence and content of hydrocinnamic and hydrobenzoic acid compounds
in food. CRC Crit. Rev. Food Sci. Nutl'., 28,315-347.
Heltog, M. G. L., Feskens, E. J. M., Hollman, P. C. H., Katan, M. B., & Kromhout, D. (1993)
Dietary antioxidant flavonoids and risk of coronary heart disease: The Zutphen elderly
study. Lancet, 342,1007-1011. doi: 10.1016/0140-6736(93)92876-U
Heltog, M. G., Kromhout, D., Aravanis, C., Blackburn, H., Buzina, R., Fidanza, F., Giampaoli, S.,
Jansen, A, Menotti, A, & Nedeljkovic, S. (1995). Flavonoid intake and long-term risk of
coronary heart disease and cancer in the seven-countries study. Arch. Intern. kied. 155,
381 - 386.
Hoelzl, C., Bichler, J., Ferk, F., Simic, T., Nerseyan, A, Elbling, L., Elulich, V ., ChakrabOlty,
A, & Knasmuller, S. (2005). Methods for the detection of antioxidants which prevent age
related diseases: A critical review with pmticuiar emphasis on human intervention studies. J
of Physiology and Pharmacology, 56(2),49-64.
Hollman, P. C. H., & Katan, M. B. (1997). Absorption, metabolism and health effects of dietary
flavonoids in man. Biomed & Pharrnacother, 51,305-310. doi: 10.1016/S0753-
3322(97)88045-6
Hong, Y., & Wrolstad, R. E. (1986). Cranberry and juice composition. J.Assoc. Off. Anal. Chern.
69, 199-207.
Howell, A. B., Reed, 1. D., Krueger, C. G., Winterbottom, R., Cunningham, D. G., & Leahy, M.
(2005). A-type cranberry proanthocyanidins and uropathogenic bacterial anti-adhesion
activity. Phytochemistry, 66,2281-2291. doi: 10.1016/j.phytDchem.2005.05.022
Hrudey, S. E., Payment, P., Huck, P. M., Gillham, R. W., & Hrudey, E. 1. (2003). A fatal
waterborne disease epidemic in Walkerton, Ontario: Comparison with other waterborne
outbreaks in the developed world. Water Sci. Technol., 47, 7-14.
105
Hui, Y H., Barta, 1., Cano, M. P., Gusek, T., Sidhu, 1. S., & Sinha, N. K (2006a). Cranberry,
blueberry, currant, and goosebeny. In K K Girard & N. K. Sinha, Handbook of Fruits and
Fruit Processing (369-380). Iowa: Blackwell.
Hui, Y H., Ba11a, 1., Cano, M. P., Gusek, T. W., Sidhu, 1. S., & Sinha, K N.(2006b). Handbook
of Fruit and Fruit Processing. Blackwell: Danvers .
Hui, W. H., Culbertson, 1. D., Duncan, S., Langaretta-Guerrero, Lui-Chan, E. C. Y, Ma, C. Y.
Manley, C. H., McMeekin, T. H., Nip, W. K, Nollet, L. M. L., Rahman, M. S., Toldra,
F., & Xiong, Y L. (2006c). Handbook offood science, technology and engineering:
Fruits. Boca Raton: CRC Press.
Ingham, S. C., Schoeller, E. L., & Engel, R. A. (2006). Pathogen reduction in unpasteurized
apple cider: Adding cranberry juice to enhance the lethali ty of warm hold and freeze-thaw
steps. J. Food Prot., 69(2), 293-298 .
Injury Alert. (2010). FOODBORNE ILLNESSES - PART 11: A Survival Guide. Retrieved from
http://www.yourlawyer.comlnewsletterlread/23
Jang, M. (1997). Cancer chemopreventive activity of resveratrol, a natural product derived from
grapes. Science, 275,218-220. doi: 10.1126/science.275.5297.218
Johnson-White, B., Buquo, L., Zeinali, M., & Ligler, F. S. (2006). Prevention of nonspecific
bacterial adhesion in immunoassays by use of cranbeny juice. Anal. Chern., 78, 853-857.
doi: 10.1 0211ac05 1700v
Kampa, M., Hatzoglou, A., Notas, G., Damianaki, A, Bakogeorgou, A, Gemetzi, C.,
106
Kouroumalis, C., Martin, P., & Castanas, E. (2000). Wine antioxidant polyphenols inhibit
the proliferation of human prostate cancer cell. Nutrition and Cancer, 37 (2),223-233. doi:
10.1207/S15327914NC372 16
Kandil, F. E., Smith, M. A L., Rogers, R. B., Pepin, M. F., Song, L. L., Pezzuto, 1. M., &
Seigler, D. S. (2002). Composition of a chemopreventive proanthocyanidin-rich fraction
from cranberry fruits responsible for the inhibition of 12-0 tetradecanoyl phorbol-13-
acetate (TPA)-induced ornithine decarboxylase (ODC) activity. J Agric. Food Chern.,
50,1063-1069. doi: 10.10211jfD11136z
Kassenborg, H. D., Hedberg, C. W., Hoekstra, M., Evans, M. C., Chin, A E., Marcus, R., Vugia,
D. J., Smith, 1(., Ahuja, S. D., Slutsker, L., & Griffin, P. M. (2004). Farm visits and
undercooked hamburgers as major risk factors for sporadic Escherichia coli 0157:H7
infection: Data from a case-control study in 5 FoodNet sites. Clin. Infect. Dis., 38 (Suppl. 3),
S271-S278.
107
Katsube, N., Iwashita, K., Tsushida, T., Yamaki, K., & Kobori , M. (2003). Induction ofapoptosis in
cancer cells by bilberry (Vaccinum myrtillus) and the anthocyanins. J Agric. Food Chern.,
51,68-75. doi: 10.10211jfD25781x
Kelley, S. G., & Post, F. 1. (2002). Basic microbiology techniques. CA:Star Pub Co
Kim, D.O., & Lee, C. Y. (2005) . HPLC separation of polyphenolics. Handbook of Food Analytical
Chemisfly, 3, 483-498.
Kondo, K., Kurihawa, M. , Fukuhara, K ., Tanaka, T., Suzuki, T. , Miyata, N., & Toyoda, M.
(2000). Conversion of pro cyanidin B-type (catechin dimeI') to A-type: Evidence for
abstraction of C-2 hydrogen in catechin during radical oxidation. Tetrahedron Letters, 41,
485-488. doi: 10.1016/50040-4039(99)02097-3
Kontiokari , T., Sundqvist, K., Nutinen, M., Pokka, T., Koskela, M., & Uhari, M. (2001).
Randomized trial of cranberry-lingonberry juice and lactobacillus GG drink for the
prevention of urinary tract infections in women. Biv!], 322, 1571-1573 . doi:
10.1136/bmj.322.7302.1571
Koo, H., Pedro, 1. R., Jaime, A. C., Yong, K. P., & William, H. B. (2002). Effects of
compounds found in propolis on streptococcus mutans growth and on
glucosyltransferase activity. Antimicrobial Agents and Chemotherapy, 46(5), 1302-
1309. doi: 10.1128/AAC.46.5.1302-1309.2002
Koo, H. , Duarte, S. , Murata, R. M. , Scott-Anne, K., Gregoire, S., Watson, G. E., Singh, A. P., &
Vorsa, N. (2010). Influence of cranberry proanthocyanidins on formation ofbiofilms by
streptococcus mutans on saliva-coated apatitic surface and on dental caries
development in vivo. Caries Res., 44(2), 116-126.
Kiihnau, 1. (1976). The flavonoids. A class of semi-essential food components: Their role in
108
human nutrition. World Rev Nutl' Diet, 24, 117-191.
Lacombe, A., Wu, V. C. H., Tyler, S., & Edwards, K. (2010). Antimicrobial action of the American
cranbeny constituents; phenolics, anthocyanins, and organic acids, against Escherichia coli
0157:H7. IntI J of Food Microbiol, 139, 102-107. doi : 10.1016/j.ijfoodmicro.2010.01.035
Lee, H. S. (2002). Characterization of major anthocyan ins and the color of red-fleshed Budd
blood orange. J Agric. FoodChem.,50, 1243-1246. doi : 10.1021/jfDl1205
Lee, J., Finn, C. E., & Wrolstad, R. E . (2004) . Anthocyanin pigment and total phenolic content
of three Vaccinium species native to the Pacific Northwest of NOlih America.
HortScience, 39, 959-964 .
Loesche, W. J. (1986). Role of Streptococcus mutans in human dental decay . NJicrobiological
Reviews, 50(4),353-380.
Macheix, J. J. , Fieuriet, A., & Billot, J. (1990). Fruit phenolics. Boca Raton: CRC Press.
Machlin, L. J., & Bendich, A. (1987). Free radical tissue damage: Protective role of antioxidant
nutrients. The FASEB Journal, I, 441-445.
Mahony, M. (1986) . Sensory evaluation of food. New York: Marcel Dekker, Inc.
Mariani, H., Polidori, M. c., Cherubini, A., & Mecocci , P. (2005).Oxidative stress in brain
aging, neurodegenerative and vascular diseases: An overview. J Chl'omatogl' B., 82 7,
65-75. doi: 10.1016/j.jchromb.2005.04.023
Mariani , C. (2008). Flavonoid characterization and in vitro antioxidant activity of Aconitum
anthora L. (Ranunculaceae). Phytochemistry, 69, 1220-1226.
doi:1 0.1 016/j.phytochem.2007.12.009
Marwan, A. G., and Nagel , C. W . (1982). Identification of the hydroxycinnamic acid derivatives in
cranberries. Journal of Food Science, 4 7, 774-782.
109
Mazza, G., & Miniati, E. (1993). Anthocyanins infruits, vegetables, and grains. Boca Raton:
CRC Press.
Mazzotta, A. S. (2000) . Thermal inactivation of stationary-phase and acid-adapted Escherichia coli
o 157:H7, Salmonella, and Listeria monocytogenes in fruit juices. JFood Prot. , 64, 315-320.
McClendon, J. F. (1930). Iodine in cranberries. American Cranberry Exchange Report.
McHarg, T., Rodgers, A., & Charlton, K. (2003). Influence of cranberry juice on the urinary
risk factors for calcium oxalate kidney stone fonnation . BlU Int. 92(7),765-768 .
doi: 10.1 046/j .1464-41OX.2003 .04472.x
Meilgaard, D. , Civille, G. Y. , & Carr, R. T. (1991) . SensOlY evalualion techniques. Boca Raton:
CRC Press.
Middleton, E. J. (1998). Effect of plant flavonoids on immune and inflammatory cell functions.
Adv EXPJvJed BioI., 439, 175-182.
Millard , P. S., Gensheimer, K. F. , & Addiss, D, G. (1997) . An outbreak of cryptosporidiosis
from fresh-pressed apple cider. lAMA , 272, 1592-1596.
Morrow, D. M. P., Fitzsimmons, P. E. E., Chopra, M., & McGlynn, H. (2001). Dietary
supplementation with the antitumor promoter quercetin: Its effects on matrix
metalloproteinase gene regulation. j\1ulal Res., 480, 269-276 . doi: 10.10 16/S0027-
5107(01 )00184-1
Morse, F. W. (1932) . A chemical study of cranberries, Mass. Agri. Expel'. Sta. Bull. , 265,
89-102.
Murota, K., & Terao, J. (2003). Antioxidative flavonoid quercetin: implications of its intenstinal
absorption and metabolism. Archives of Biochemistry and Biophysics, 417, 12-17.
doi: 10.1 016/S0003-9861(03)00284-4
110
Murphy, B. T, Mackinnon, S. L., Yan, x., Hammond, O. B., Vaisberg, A. 1., & Neto, C. C. (2003).
Identification of triterpenes hydroxycinnamates with in vitro antitumor activity from whole
cranberry fruit (Vaccinium macrocarpon). J Agric. Food Chem. 51,3541-3545.
doi: 10.1021/jfD34114g
MUlihy, K., Singh, R., & Jayaprakasha, O. (2002). Antioxidant activities of grape (Vilis vinifera)
pomace extracts. J Agri and Food Chemistry, 50, 5909-5914. doi: 10.1 021/jfD257042
Nair, M., Abouelezz, H., Hoagland, T , & Venkitanarayanan, K. (2005). Antibacterial effect of
monocarprylin on Escherichia coli 0157 :H7 in apple juice. J Food Prot. 68, 1895-1899.
Naczk, M., & Shahidi, F. (2005) .lvlethods of analysis of food components and additives.
Analysis of polyphenols infood. Boca Raton: CRC Press.
Neto, C. C. (2007). Cranben'y and its phytochemicals: A review of in vitro anticancer
studies. J Nutr., 13 7, 186-193.
Nicholas, 1. S. (2005). Improving the safety offresh meat. Boca Raton: Wood head.
Ocean Spray®. (2007). What's Ci bog. Retrieved from
http ://www.oceanspray.com/about/bog.aspx
Ohnishi, R., Ito, H. , Kasajima, N., Kaneda, M., Kariyama, R., Kumon, H., Hatano, T., &
Yoshida, T (2006). Urinary excretion of anthocyanins in humans after cranberry juice
ingestion. Biosci Biotechnol Biochem., 70, 1681-1687.
Osawa, T , Ide, A., Su, 1. D., & Namiki, M. (1987). Inhibition of lipid peroxidation by ellagic
acid. J Agric Food Chem. , 35, 808-812. doi: 10.1 021/jfD0077a042
Pages,1. M., James, C. E., & Winterhalter, M. (2008). The porin and the pelmeating antibiotic:
A selective diffusion balTier in gram-negative bacteria. Nat. Rev., 6, 893-903. doi:
10.103 8/rumicro 1994
Pascual-Teresa, Diego, A. M., Cristina, G. V. (2010). Flavanols and Anthocyanins in
Cardiovascular Health: A Review of Cunent Evidence. International Journal Molecular
Sciences, 11,1679-1703. doi: 10.3390lijms11041679
Pedersen, S. (2000). Vitamin E" Anti-anging anti-oxidant. New York: Dorling Kindersley
Publishing, Inc.
Pollard, D. R., Johnson, W. M., Lior, H., Tyler, S. D., Rozee, K. R. (1990). Rapid and specific
detection of verotoxin genes in Escherichia coli by the polymerase chain reaction. J Clin
kiicrobiol., 28, 540-545.
Prior, R. L., Lazarus, S. A., Cao, G., Muccitelli, H., & Harrunerstone, 1. F. (2001). Identification
of procyanidins and anthocyanins in bluebenies and cranbeITies (Vaccinium spp.) using
high-performance liquid clU'omatography/mass spectrometry. J Agric Food Chern.,
49(3),1270-1276. doi: 10.10211jfD01211q
Puski, G., & Francis, F. (1967) . Flavonol glycosides in cranbelTies. J Food Sci., 32, 527-530.
doi: 10.1111 /j .1365-2621.1967.tb00824.x
111
Puupponen-Pimia, R., Nohyek, L., Meier, C., Kahkonen, M., Heinonen, M., Hopia, A., & Oksman
Candentey, K. M. (2001). Antimicrobial properties of phenolic compounds from berries. J
Appl. kJicrobiol., 90, 494-507. doi: 10.1 046/j .1365-2672.2001.0 1271.x
Puupponen-Pimia, R., Nohyek, L., Alakomi, H, L. & Oksman-Candentey, K. M. (2005). Bioactive
beny compounds-novel tools against human pathogens. Appl. kiicrobiol. Biotechno.l, 67, 8-
18.
Rahn, K. , De Grandis, S. A., Clarke, R. C., McEwen, S. A. , Galan, 1. E., Ginocchio, C., Curtiss, R.,
& Gyles, C. L. (1992). Amplification of an invA gene sequence of Salmonella typhimurium
112
by polymerase chain reaction as a specific method of detection of Salmonella. Salmonella.
j\;lol. Cell. Probes 6, 271-279.
Ranelletti, F. 0., Maggiano, N., & Sen-a, F. G. (2000) . Quercetin inhibits p21-ras expression in
human colon cancer cell lines and in primary colorectal tumors. In! J Cancer., 85,
438-445. doi: 10.1 002/(SICI) 1 097 -0215(20000201 )85:3 <438::AID-lJC22>3.0.CO;2-F
Ramos, S., Alia, M., Bravo, L., & Goya, L. (2005) . Comparative effects of food-derived
polypheno1s on the viability and apoptosis of a human hepatoma cell line (HepG2). J
Agric Food Chern., 53, 1271-1280.
Rangel, J. M. , Sparling, P . H., Crowe, C., Griffin, P. M., & Swerdlow, D . L. (2005).
Epidemiology of Escherichia coli 0157:H7 outbreaks, United States, 1982-2002.
Emerging Infectious Diseases, 11(4), 603-609 .
Rice-Evans, C. A. , Miller, N. 1., & Paganga, G. (1996). Structure antioxidant activity relationships
offlavonoids and phenolic acids. Free Rad. Bio!. and Med., 20, 933-956.
doi: 10.1016/0891-5849(95)02227-9
Richter, M., Ebermann, R., & Marian, B. (1999). Quercetin-induced apoptosis in colorectal
tumor cells: Possible role of EGF receptor signaling. Nutr Cancer, 34, 88-99.
doi: 10.1207/S15327914NC340113
Riley, L. W. , Remis, R. S. , Helgerson, S. D., McGee, H . B., Wells, 1. G., Davis , B. R. , Hebel1, R. 1.,
Olcott, E. S. , Johnson, L. M. , Hargrett, N. T. , Blake, P. A., & Cohen, M. L. (1983).
Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Eng!. J j\;Jed., 308,
681-685.
Robards, K., Prenzler, P. D. , Tucker, G. , Swatsitiang, P. , & Glover, W. (1999). Phenolic
compounds and their role in oxidative processes in fruits. Food Chern. 66,400-436 .
Ruel, G., Pomerleau, S., Couture, P., Lamarche, B., & Couillard, C. (2005) . Changes in plasma
antioxidant capacity and oxidized low-density lipoprotein levels in men following short
term cranbeny juice consumption. Metabolism, 54, 856-861. doi :
10.10 16/j.metaboI.2005.0 1.031
Salah, N., Miller, N. 1., Pagaga, G., Tijburg, L., Bolwell, G. P., & Rice-Evans, C. (1995).
Polyphenolic flavanols as scavengers of aqueous phase radicals and as chain breaking
antioxidants. Arch. Biochem. Biophys., 322, 339-346.
Salmond, C. V., Kroll, R. G., & Booth, 1. R. (1984). The effect of food preservatives on pH
homeostasis in Escherichia coli. J Gen Microbiol., 130, 2845-50.
Sapers, G. M., Jones, S. B., & Maher, G. T. (1983a). Factors affecting the recovery of juice and
anthocyanin from cranberries. JAm Soc Hort Sci., 108, 246-249.
Sapers, G. M., Phillips, 1. G., Rudolf, H. M., & DiVito, A. M. (1983b). Cranberry quality:
Selection procedures for breeding programs. JAm Soc Hortic Sci ., 108, 241-246.
Sapers, G. M., & Hargrave, D. L. (1987). Proportions of individual anthocyanins in fruits of
cranberry cuttivars. J of Horticultural Science. The Amer. Soc. for Horticultural
Science. Alexandria, VA. 112 (1),100-104.
Schuster, B., & Hen'mann, K. (1985). Hydroxybenzoic and hydroxycinnamic acid derivatives in
soft fruits . Phytochemistry, 24, 2761-2764. doi: 10.10 16/S0031-9422(00)80722-0
Science Daily. (2009). Hm\! cranberry products prevent urinary tract irifections. Retrieved from
http://www.sciencedaily.com/releases/2009/03/090309121937.htm
Seeram, N. P., Adams, L. S., Hardy, M. L., & Heber, D. (2004) . Total cranbelTY extract versus
its phytochemical constituents: Antiproliferative and synergistic effects against human
tumor cell lines. J Agric Food Chem, 52, 2512-2517. doi: 10.1 0211jfD352778
113
Shahidi, F., & Naczk, M. (2004). Phenolics in/ood and nlltracellticals: Sources, applications
and health effects. Boca Raton: CRC Press.
114
Shahidi, F., & Naczk, M. (Eds.) . (2006). Phenolics in/ood and nutraceuticals. Boca Raton: CRC
Press.
Sharma, V., Mishra, M., Ghosh, S., Tewari, R., Basu, A., Seth, P., & Sen, E. (1994) . Modulation
of interleukin-l beta mediated inflammatory response in human astrocytes by f1avonoids:
Implications in neuroprotection. Brain Res. Bull., 73, 55-63.
doi: 10.10 16/j .brainresbull .2007.0 l.0 16
Shetty, K. (2006). Food biotechnology. Boca Raton: CRC Press.
Sheryl, A., & Hanis, 1. J. (2001). The effects of freezing and thawing on the survival of
Escherichia coli 01 57:H7 in apple juice. In!. J Food Microbial. 67, 89-96.
doi: 10.10 16/S0 168-1605(0 1 )00438-X
Shrnuely, H., Yahav, J. , Samra, Z. , Chodick, G., Koren, R. , Niv, Y. , & Ofek, 1. (2007) . Effect of
cranbeny juice on eradication of Helicobacter pylori in patients treated with antibiotics
and a proton pump inhibitor. Niol Nutr Food Res . doi: 10.1 002/mnfr.200600281
Sivapalasingam, S., Friedman, C. R., Cohen, 1., & Tauxe, R. V. (2004). Fresh produce: A growing
cause of outbreaks offoodbome illness in the United States, 1973 through 1997. J Food
Prot. , 67, 2342-2353.
Sojitz Corporation of America. (2007). Cranberry protein pmvder. Retrieved from
http://www.us.soj i tz.comJupload _ houston/07 -20080 122-Cranberry _Protein _Powder. pdf
Soleas, G. J., Diamandis, E. P., & Goldberg, D. M. (1997). Resveratrol: A molecule whose time
has come? And gone? Clin. Biochem. 30, 91-113.
Stavric, B. (1994). Quercetin in our diet: From potent mutagen to probable anticarcinogen. Clin
Biochem., 27, 245-248.
Steinberg, D., Feldman, M., Ofek, I. , & Weiss, E. 1. (2004) Effect of a high-molecular-weight
component of cranberry on constituents of dental biofilm. J Antimicrob Chemother., 54,
86-89. doi: 10.1093/jac/dkI220
Stone, H. , & Sidel, 1. 1. (2004). Sensory evaluation practices. San Diego: Elsevier Academic
Press.
115
Strube, M. , Dragsted, 1. 0., & Larsen, 1. C. (1993). Naturally occurring antitumourigens. I. Plant
phenols. Nordiske Seminar- og Arbejdsrapporter 605. Copenhagen, Denmark: Nordic
Council of Ministers.
Sugihara, K ., Kitamura, S., Tamada, T., Ohta, S. , Yamashita, K ., Tasuda, M., & Fujii
Kuriyama, Y. (1999). Aryl hydrocarbon receptor (AhR)-mediated induction of xanthine
oxidase/xanthine dehydrogenase activity by 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Biochem. Biophys. Res. Commun., 281, 1093-1099. doi: 10.1 006/bbrc.2001.4464
Sun, 1., Chu, Y. F. , Wu, X., & Liu, R. H. (2002). Antioxidant and antiproliferative activities
of common fruits . J Agric. Food Chem., 50, 7449-7454. doi: 10.1 021/jfD207530
Swartz, 1. H., & Medrek, T. F. (1968). Antifungal properties of cranberry juice. Appl Microbio!.,
16, 1524-1527.
Terrance, M. A., Joseph, M. B., Xiangwu, N., & Mohammad, K. (2005). Evaluation of culture- and
PCR-based detection methods for escherichia coli 0 157:H7 in inoculated ground beef. J
Food Prot., 68, 1566-1574.
Tramonti, A., Canio, M., Delany, I., Scarlato, V., & de Biase, D. (2006). Mechanisms of
transcription activation exerted by GadX and GadW at the gadA and gadBC gene
promoters of the Glutamate based acid resistance system in Echerichia coli. J Bacteriol.,
116
188,8118-8127. doi: 10.1128IJ8.01044-06
Tsen, H. Y, Lin, C. K., Chi, W. R. (1998). Development and use of 16S rRNA gene targeted PCR
primers for the identification of Escherichia coli cells in water. Journal of Applied
Jvlicrobiology, 85,554-560.
Tuttle, 1. , Gomez, T , Doyle, M.P ., Wells, 1. G. , Zhao, T , Tauxe, R. V. , & Griffin, P. M . (1999).
Lessons from a large outbreak of Escherichia coli 0157:H7 infections: Insights into the
infectious dose and method of widespread contamination of hamburger patties.
Epidemiol.!nfect. , 122, 185-192 .
United States Dep31iment of Agriculture. (2005) , Economic Research Service. Livestock, dairy, and
poultry outlook. LDP-M -131. Retrieved from
http: //www.ers.usda.gov/publications/ldpiMay05/LDPMI3ITpdf
United States Department of Agriculture. (2007) . Cranberries. Retrieved from
http://usda.mannli b.comell.eduJusda/current/Cran/Cran-08-21-2007. pdf
United States Department of Agriculture. (2009). Audit report. Retrieved from
http://origin-www.fsis.usda.gov/PDF/Audit RepOli Hallmark-Westland Recall.pdf
Vassallo, N. (2008). Polyphenols and Health: New and Recent Advances. New York, NY: Nova
Science Publishers.
Vattem, D. A., & Shetty, K. (2002). Solid-state production of phenolic antiox idants from
cranbelTY pomace by Rhizopus oligosporus. Food Biotech. , 16(3): 189-210. doi:
10.1 0811FBT -120016667
Vattem, D . A. , Lin, Y T , Labbe, R.G ., & Shetty, K. (2003) . Antimicrobial activity against select
food borne pathogens by phenolic antioxidants emiched in cranbeny pomace by solid
state bioprocessing using the food grade fun gus Rhizopus oligosporus. Process
Biochemistry., 39: 1939-1946. doi: 10.1 016/j.procbio.2003.09.032
Vattem, D. A., Shetty, K. (2003). Ellagic acid production and phenolic antioxidant activity in
cranberry pomace (Vaccinium macrocarpon) mediated by Lentinus edodes using
solidstate system. Proc Biochem., 39(3),367-379.
Vattem, D. A., Lin, Y. T., Labbe, R. G., & Shetty, K. (2005a). Enrichment of phenolic
antioxidants and anti-Helicobacter pylori properties of cranberry pomace by solid-state
bioprocessing. Food Biotechol1ology, 19(1), 51- 68. doi: 10.1 0811FBT -200049065
117
Vattem, D. A., & Shetty, K. (2005b) Functional phytochemicals from cranberries: Their
mechanism of action and strategies to improve functionality. In: Food biotechnology, 2nd
Edition [Shetty, K., Paliyath, G., Pometto, A.L. III and Levin, R.E. (eds)]. Boca Raton, FA:
CRC Press, 789-823.
Vattem, D. A., & Shetty, K. (2005c). Biological functionality of ellagic acid: A review.
Journal of Food Biochemistry, 29(3), 234-266. doi: 10.llll1j.1745-4514.2005.00031.x
Vinson,1. A., Su, x., Zubik, L., & Bose, P. (2001). Phenol antioxidant quantity and quality in
foods: Fruits. J Agric. Food Chem., 48, 5315-5321. doi: 10.1 0211jfD009293
Vinson, 1. A. (2003). Cranberry juice increases plasma antioxidant and HDL cholesterol levels.
Research presented at the 225th national meeting of the American Chemical Society,
March 24,2003.
Viskelis, P., Rubinskiene, M., Jasutiene, 1., Sarkinas, A., Daubaras, R., & Cesoniene, L. (2009).
Anthocyanins, antioxidative, and antimicrobial properties of american cranberry
(vaccinium macrocarpon Ait.) and their press cakes. J Food. Sci., 74(2),157-161. doi:
1 O.llll/j .1750-3 841.2009.0 1 066.x
Vorsa, N., & Welker, W. V. (1985). Relationship between fruit size and extractable anthocyanin
content in cranberry. Hort-Science, 20, 402-403.
118
Wang, S. Y, & Stretch, A. W. (2001). Antioxidant capacity in cranbeny is influenced by cultivar
and storage temperature. J Agric Food Chern., 49(2) :969-74. doi: 10.10211jfO01206m
Wang, Y, Catana, F ., Yang, Y., Roderick, R. & van Breemen, R. B. (2006). An LC-MS method
for analyzing total resveratrol in grape juice, cranberry juice, and in wine. J Agric. Food
Chem., 50, 431-435. doi : 10.1021/jf010812u
Watson, R. R. (2001). Vegetables, fruits, and herbs in health promotion. Boca Raton: CRC Press.
Weiss, E. I., Lev-Dor, R., Kashamn, Y, Goldhar, J., Sharon, N., & Ofek, 1. (2002).
Inhibiting interspecies coaggregation of plaque bacteria with a cranbeny juice constituent
J Am. Dent. Assoc., 129, 1719-1723.
Wen, A., Pasacal, D., Stanich, K., & Toivonen, P. (2003) . Antilisterial activity of selected
phenolic acids. Food Microbiol. , 20, 305-311. doi: 10.10 16/S0740-0020(02)00 135-1
Williams, G., & Craig, J. C. (2009) . Prevention of recurrent urinary tract infection in children.
Cur,. Opin Infect Dis., 22(1), 72-6.
Wilson, 1. G. (2001). Food microbiology protocol. Danvers: Humana Press.
Wisconsin State CranbelTY Growers Association. (2010). Background. Retrieved from
http://'vvww. wiscran.org/about_ cranberries_ 0002IBackground _ 0006.htmL
World Health Organization. (2007). Food safety and foodborne illness. Retrieved from
http://www.who.int/mediacentre/factsheets/fs237/en/
Wu, V. C. H., Qiu, X., Reyes, B. G., Lin, Y., & Pan, Y. (2009). Application of cranberry
concentrate (Vaccinium macrocarpon) to control Escherichia coli 0157:H7 in ground beef
and its antimicrobial mechanism related to the downregulated sip, hdeA and cfa. Food
Microbiol, 1-7. doi: 10.1016/j.fm.2008.07.014
Wu, v.c. H., Qui, X., Bushway, A., & Harper, L. (2008). Antibacterial effect of American
cranberries (Vaccinium macrocarpon) on food borne pathogens. L WT -Food Sci. Techno!.
41, 1834-1841. doi: 10.1016/j.lwt.2008.01.001
Yamanaka, A., Kimizuka, R, Kato, T., & Okuda, K. (2004) Inhibitory effects of cranberry juice
on attachment of oral streptococci and biofilm formation. Oral JvJicrobiollmmllno!., 19,
150-154. doi: 10.11111j.0902-0055.2004.00130.x
Yan, X., Murphy, B. T., Hammond, G. B., Vinson, J. A., & Neto, C. C. (2002). Antioxidant
activities and antitumor screening of extracts from cranberry fruit (Vaccinium
macrocarpon). J Agric. Food Chern. 50, 5844-5849. doi: 10.1021/jf0202234
119
Yuste, J., & Fung, D. Y. C. (2003). Evaluation of Salmonella Typhirnurium, Yersina enterocolitica
and Staphylococcus aureus counts in apple juice with cinnamon, by conventional media and
thin agar layer method. Food JvJicrobiol. 20,365-370. doi: 10.1016/S0740-0020(02)00130-2
Zafriri, D., Ofek, I., Adar, R, Pocino, M., & Sharon, N. (1989). Inhibitory activity of cranberry
juice on adherence of type 1 and type P-fimbriated Escherichia coli to eukaryotic cells.
Antimicrob.Agents Chemother., 33, 92-98.
Zapsalis, c., Francis, F. J. (1965). Cranberry anthocyanins. J Food Sci. 30, 396-399.
Zhang, L., Ma, J., Pan, K., Liang, V. W., Chen, J. G., & You, W. (2005). Efficacy of cranberry
juice on helicobacter pylori Infection: A double-blind, randomized placebo-controlled trial.
Helicobacter, 10(2), 139-145. doi: 10.11111j.1523-5378.2005.00301.x
Zhao, T., Doyle, M. P., & Besser, R E. (1993). Fate of enterohemorrhagic Escherichia coli
o 157:H7 in apple cider with and without preservatives. Appl Environ JvJicrobiol.
59, 2526-2530.
Zheng, W., & Wang, S.Y. (2003). Oxygen radical absorbing capacity of phenolics in blueberries,
cranberries, choke berries, and lingonbenies. J Agric Food Chem., 51(2),502-509. doi:
10. 10 211jfD20728u
Zuo, Y., Wang, C., & Zhan, J. (2002). Separation, characterization, and quantitation of benzoic
and phenolic antioxidants in American cranberry fruit by GC-MS. J Agric. Food Chem.
50, 3789-3794. doi: 10.10211jf058057y
120
Appendix A: Sensory Advertisement
B ef t
WJf.J\.T, SENSORY EVALUATION OF BEEF PATTIES
WJf'E'R'E? HOME ECONOMICS 252
WJfy? TO GATHER DATA FOR A THESIS PROJECT
WJf'E:N7 Monday, December Th, 11:00AM-3:OOPM
WJfO? ALL STUDENTS, FACULTY AND PUBLIC ARE INVITED TO
PARTICIPATE
*Taste testing takes ayyroximate(y 5 - 10 minutes
* .Jt(( yarticiyants wire receive a treat!
For more info contact: [email protected]
121
Appendix B: Beef Patty Scorecard
Instructions
1. Place a mark in the box which you feel best describes how you like the product.
Overall Acceptance D Dislike
very much
D Dislike slightly
D Neither like nor dislike
D Like
slightly
D Like
very much
2. Indicate by placing a mark how you feel the product rates in each category below.
Color D D D D D Light Moderate Dark
Sweetness D D D D D Not at all sweet Moderate Very sweet
Cooked beef flavor D D D D D Much too weak Moderate Much too strong
Cardboard flavor" D D D D D No cardboard Moderate Strong cardboard
flavor flavor
Grainy texture D D D D D Not at all grainy Moderate Very grainy
Juiciness D D D D D Too dry Moderate Too moist
After taste D D D D D Unpleasant Moderate Pleasant
3. Which of the two sam pIes do you prefer?
D D 432 568
122