at SciVerse ScienceDirect

Biomaterials 33 (2012) 8802e8811

Contents lists available

Biomaterials

journal homepage: www.elsevier .com/locate/biomateria ls

Angiogenic and osteogenic potential of platelet-rich plasma and adipose-derivedstem cell laden alginate microspheres

Yi Man a,b,c,1, Ping Wang a,b,c,1, Yongwen Guo a,d,1, Lin Xiang a,b, Yang Yang a,b, Yili Qu a,Ping Gong a,b,*, Li Deng c,**

a State Key Laboratory of Oral Diseases, Sichuan University, Chengdu 610041, ChinabDental Implant Center, West China School of Stomatology, Sichuan University, Chengdu 610041, Chinac Laboratory of Stem Cell and Tissue Engineering, Regenerative Medicine Research Center, West China Hospital, Sichuan University, No. 1, Keyuan Fourth Road, Chengdu 610041, ChinadDepartment of Orthodontics, West China School of Stomatology, Sichuan University, Chengdu 610041, China

a r t i c l e i n f o

Article history:Received 16 July 2012Accepted 23 August 2012Available online 12 September 2012

Keywords:Adipose-derived stem cellsAlginate microspheresAngiogenesisBone tissue engineeringMineralizationPlatelet-rich plasma

* Corresponding author. Dental Implant Center, Weogy, Sichuan University, No. 14, 3rd Section, Renmin SChina. Tel.: þ86 13088090513.** Corresponding author. Tel.: þ86 18980601811.

E-mail addresses: dentistping@gmail.com (P. G(L. Deng).

1 These authors contributed equally to this work.

0142-9612/$ e see front matter � 2012 Elsevier Ltd.http://dx.doi.org/10.1016/j.biomaterials.2012.08.054

a b s t r a c t

Improving vascularization of tissue-engineered bone can advance cell performance in vivo and furtherpromote bone regeneration. How to achieve a functional vascular network within the construct is one ofthe biggest challenges so far. We hypothesized that a mixture of platelet-rich plasma (PRP) and adipose-derived stem cells (ADSCs) could endue the alginate microspheres with osteogenic and angiogenicpotential. In vitro and in vivo studies were performed to investigate the potential of the PRP-ADSC-ladenmicrospheres. Two intriguing observations were made in this study. First, we demonstrated that PRPsustained cell viability and meanwhile promoted cell migration from the interior of alginate micro-spheres to the surface. This phenomenon indicated that encapsulated cells have the potential to directlyand actively participate into the regeneration process. Second, in vivo, a blood vessel network was foundwithin the 10% PRP and 15% PRP-ADSC implants, which was associated with a significant increase inmineralization. It suggested that the PRP-ADSC-laden microspheres did enhance the vascularization andmineralization. In summary, this strategy not only provides a micro-invasive therapy for bone regen-eration, but also could be incorporated with other matrices for extended application.

� 2012 Elsevier Ltd. All rights reserved.

1. Introduction

In the field of orthopedics, oral and maxillofacial surgery, boneregeneration remains to be a clinical challenge, despite the intro-duction of various bone augmentation techniques and bone graftmaterials. In recent decades, development of bone tissue engi-neering brings great excitement through the combination of engi-neered scaffolds, cells, and biologically active molecules or micro-environment [1,2]. Extensive experimental and clinical researcheshave been done in the field, and considerable progress has beenachieved [3e5]. However, its clinical success was mainly impededby the poor vascularization in tissue-engineered constructs. Thelack of vascular networks throughout constructs leads to insuffi-cient oxygen and nutrients supply, and in no doubt compromises

st China School of Stomatol-outh Road, Chengdu 610041,

ong), dengli2000@21cn.com

All rights reserved.

the survival rate of implanted cells and their final performance. Toensure the viability of seeded cells, a distance of less than 200 mm isrequired between cells and a blood vessel [6]. However, from theperspective of clinical application, 200 mm is such a short distancefor any bone defect that the inner pre-seeded cells’ viability ishardly to be maintained, not to expect these cells to participate inthe regeneration process. Thus, a scaffold, seeded with appropriatepluripotent cells, providing a favorable micro-environment andnutrient for cells’ prolonged viability, and with angiogenic andosteogenic potential, could be an inspiring strategy for bone tissueengineering.

Recently, adipose-derived stem cells (ADSCs) have beenproposed by some researchers as a promising alternative for bonemarrow stem cells (BMSCs) in bone tissue engineering [7]. Withcomparable multilineage capability to BMSCs, ADSCs are muchmore easily harvested in high yield using simpler, less expensiveand less invasive procedures with a lower incidence of donor sitemorbidity. As an autologous cell-based therapy, ADSCs transplanthave been successfully used in both soft tissue and bone regener-ation [8e10]. A recent research showed that ADSCs, originatingfrom pericytes, could contribute to vascularization both in vitro and

Table 1Specific primers for Q-PCR.

Gene Primers

OPN Forward: 50- GAGGAAAAGCAGCTTTACCACA-30

Reverse: 50- AGGAGATTCTGCTTCTGAGAT-30

RUNX2 Forward: 50- CAAGAGTTTCACCTTGACCAT -30

Reverse: 50- GTCATCAAGCTTCTGTCTGTG -30

GAPDH Forward: 50- AACCACGAGAAGTATGACAACT -30

Reverse: 50- CGTGCACCGTGGTCATGAG -30

Y. Man et al. / Biomaterials 33 (2012) 8802e8811 8803

in vivo [11]. All the evidence enumerated above indicates thatADSCs might be a promising seeding cell for vascularized tissueengineering.

The speed and degree of vascularization plays a critical role in theefficiency and integration of the tissue-engineered bone. The mainmechanism involved is angiogenesis with new blood vesselssprouting from existing ones [12]. It is a complex process, whichinvolves the participation of endothelial cells (ECs) and pericytesaffected by multiple growth factors functioning in different stages ofthe process, such as vascular endothelial growth factor (VEGF),angiopoietin, fibroblast growth factor (FGF), platelet-derived growthfactor (PDGF), and the family of transforming growth factors (TGF)[13]. It is tempting topredict thata synergisticeffect couldbeachievedby combining all these factors into the bioengineered bone, however,is extremely hard and expensive to be accomplished. While Platelet-rich plasma (PRP), a concentrated blood-derived product containinghigh quantities of various autogeneic growth factors, meets thiscriterion [14]. Ever since its initial report in 1980s, PRP quickly caughtattentions of clinicians for its easy obtainability, autologous origin,safety, cost-effectiveness, and functions in promoting both angio-genesis and bone regeneration [15].

Microencapsulation technique, an attractive approach to delivercells or bioactive molecules, can provide a protection shell for cells[16,17], and act as a controlled release system of growth factors ordrugs [18,19]. The constructed microspheres can be readily injectedinto tissues with minimal invasion [20] or evenly distributedthroughout tissue engineering matrices as adjuncts for extendedapplications [21]. Alginate, a natural polysaccharide extracted fromseaweed, is one of the most common cell and drug delivery vehi-cles. When exposed to divalent cation, alginate solution quicklycrosslinks to form a hydrogel under mild and physiological condi-tions [22]. From the perspective of preserving viability of incor-porated cells and proteins, the gentle gelling condition is ofsuperior advantage to minimize detrimental effects. Besides, algi-nate has been favored by researchers for several other merits, suchas good biocompatibility, a high porosity and interconnectedporous structure for nutrients and oxygen diffusion [23,24].

Consequently, we hypothesized that a mixture of growth factorscontained in PRP and ADSCs could endue the alginate microsphereswith osteogenic and angiogenic potential. The objectives of thestudy were to develop a PRP-ADSCs-laden alginate microsphere,and to investigate its potential application for bone regeneration.In vitro studies evaluated the effects of PRP on encapsulated ADSCsfrom perspectives of key cellular functions associated with woundhealing and bone regeneration, namelymigration, proliferation anddifferentiation. In vivo studies further examined whether thismicrosphere system could accelerate mineralization and vascular-ization when subcutaneously implanted in nude mice.

2. Materials and methods

2.1. Cell isolation and culture

All animal experiments were approved by the Animal Care and Use Committeeof Sichuan University. Fresh subcutaneous adipose tissue was obtained from theinguinal fat pad of one-week-old rabbits. The fat pads were washed with sterilephosphate-buffered saline (PBS), then minced into small pieces and incubated in0.075% type I collagenase in PBS for 60 min at 37 �C with intense stirring. Cells werefiltered and centrifuged at 1200 rpm for 10 min to obtain a high-density pellet. Thepellet was resuspended with DMEM/F12 medium, containing 10% (v/v) fetal bovineserum,100 U/ml penicillin and 100 mg/ml streptomycin, and then cultured in 25-cm2

flasks. The culture media was changed every other day. The third-passage ADSCswere used in following experiments.

2.2. Preparation of PRP

PRP was obtained from blood drawn through cardiac puncture in healthy adultNew Zealand rabbits, weighing between 2.5 and 3 kg. Each time, 30 ml blood was

collected into vacuum test tubes and mixed with anticoagulant citrate dextrosesolution A. PRP was prepared following the previous protocol [25]. Blood wasinitially centrifuged at 300 g for 10 min to remove red blood cells (RBCs). The upperlayer platelet-poor plasma (PPP) and themiddle thinwhite layer, including some redblood cells at the very top of the RBC layer, were pipetted out and centrifuged againat 5000 g for 5 min to separate the PRP from the PPP. The platelet concentration ofPRP and whole blood was counted by an automated hematology analyzer. PRP wasthen diluted in PPP to a 4-fold increase in platelet concentration over the wholeblood and used in the following experiments within 3 h. PRP was activated bythrombin activators (500 U bovine thrombin in 1 ml 10% calcium chloride) imme-diately after the microsphere preparation.

2.3. ADSCs and PRP encapsulation

Calcium alginate microspheres were produced with an electrostatic beadgenerator designed by the Textile School of Sichuan University. The 1.2% (w/v)alginate solution was prepared by dissolving sodium alginate power (Sigma) insaline with continuously stirring at room temperature. ADSCs were trypsinized,counted, centrifuged and then homogenized with the sterile alginate solution. Totest the potential effects of PRP on the encapsulated ADSCs, PRP was added into themixture at the concentration of 0%, 5%, 10%, and 15% (v/v), respectively. The final celldensity in the alginate solution was 1 � 106 cells/ml. This solution was placed ina medical syringe connected with a metal needle with an inner diameter of 0.24mmand mounted into a pump. Under an electrical potential of 12 kV, alginate dropletswere extruded at a flow rate of 20 ml/h and dropped into the gelling bath containing100 mmol/L calcium chloride. The distance between the needle tip and gelling bathwas 3 cm. Microspheres without cells were used as blank control. Alginate beadswere washed three times with saline, once with DMEM/F12 medium and thendynamically cultured in spinner flasks (Cellspin, IBS Integra Biosciences,Switzerland) for three weeks. The culture medium was half-renewed every fourdays.

2.4. Viability of encapsulated cells

The ADSCs in the microspheres were examined by live/dead assay at 1, 7, 14 and21 days. At the designated time-points, microspheres were pipetted from thespinner flasks into 24-well culture plates. Microspheres were washed three timeswith saline, incubated in Calcein-AM (2 mM, Dojindo, Kumamoto, JAPAN) andEthidium Homodimer-1 (4 mM, Invitrogen, Paisley, UK) for 30 min at 37 �C, and thenwashed three times with saline. The result was imaged by fluorescence microscopy(Olympus IX71-F22FL, Japan) and confocal microscopy (Nikon A1, Melville, NY, USA).Photos were captured from a series of horizontal sections and then combined for “z-stacked” compilation images of the microspheres. 50 beads per group were countedfor the number of green (alive) and red (dead) cells per bead.

2.5. Quantitative real-time polymerase chain reaction (Q-PCR)

Samples of microspheres were retrieved to isolate cells at 1, 7, 14, and 21 days. Todissolve the alginate, they were incubated for 30 min at 37 �C with 500 ml ofa 250 mg/ml alginate lyase solution (Sigma). Cells were then washed in PBS bycentrifugation. The total cellular RNA of the cells was extracted with TRIzol reagent(Invitrogen) and reverse-transcribed into cDNA using a RevertAid� H Minus FirstStrand cDNA Synthesis Kit (Fermentas, Burlington, Ontario). SYBR GREEN I real-timePCR were used to amplify and simultaneously quantify targeted genes on orycto-lagus cuniculus runt-related transcription factor 2 (RUNX2, XM_002714704.1) andosteopontin (OPN, D16544.1). The specific primers were listed in Table 1. Each Q-PCRwas performed in triplicate for PCR yield validation. Data were analyzed by the2�DDCt method, with normalization by the Ct of the housekeeping gene GAPDH.Results were expressed relatively to gene expression level of ADSC-laden group atday 1.

2.6. ALP of encapsulated ADSCs

At 1, 7, 14, 21 days, alkaline phosphatase (ALP) activity of encapsulated cells wasmeasured according to an ALP substrate kit (Nanjin-Jiancheng, Nanjin, China). Thecollected microspheres were washed with PBS, and then cells were lysed by

Y. Man et al. / Biomaterials 33 (2012) 8802e88118804

ultrasonication. After a 10 min centrifugation, supernatant was collected for ALPassay using p-nitrophenyl phosphate (p-NPP) as a phosphatase substrate. Theabsorbance was measured at 405 nm. ALP activity was normalized to the totalprotein level. Protein level was quantified using a Bio-Rad protein assay kit(Hercules, CA, USA) following the manufacture’s instruction. This test was repeatedthree times.

2.7. In vivo subcutaneous injection of the microspheres

Twelve eight-week-old male athymic nu/nu mice underwent subcutaneousinjections of microspheres on the dorsum. Freshly prepared microspheres wereinjected through 1-mL syringes and 22-gauge needles. Each mouse received foursubcutaneous injections into the bilateral fore- and hind-flanks. Each spot wasinjected with 0.5 ml microspheres. Five groups were prepared for the in vivo study,namely empty alginate microspheres (group I, n ¼ 8), ADSC-laden microspheres(group II, n ¼ 10), 5%PRP-ADSC-laden microspheres (group III, n ¼ 10), 10% PRP-ADSC-laden microspheres (group IV, n ¼ 10), and 15% PRP-ADSC-laden micro-spheres (group V, n ¼ 10). Animals were maintained in sterile microisolator cagesunder specific pathogen free condition in the Animal Center of Sichuan University.Samples were retrieved at 1 and 3 months.

2.8. Microcomputed tomography (micro-CT) scanning

Samples harvested at 3 months were scanned with micro-CT (Scanco MedicalAG, mCT-80, Switzerland). The parameters were set with a voltage of 55 kV, anintensity of 145 mA, and an isotropic resolution of 18 mm. A three-dimensional regionof interest (ROI) was defined precisely to reconstruct and analyze each specimen.The volume of ROI was measured as the total tissue volume (TV). A threshold valueof 220 mg HA/ccmwas set to distinguish mineralized tissue from the unmineralizedtissue [26]. The mineralization of the tissue was evaluated by calculating the meandensity of the total tissue volume, mean density of the mineralized tissue volume(MV), and the percentage of mineralized tissue to total tissue volume (MV/TV). Dueto poor mineralization, samples of the group I, II, III were not visible through themicro-CT scanning. Group IV and V were included in data analysis.

2.9. Histological analysis

All samples were fixed in 10% buffered formalin, dehydrated, and embedded inparaffin. Serial sections were obtained by cutting at 100 mm intervals with at leastfive layers of a sample. Every slide was stained with hematoxylin and eosin. Thesesections were observed by optical microscope (Olympus, IX 70, Japan). The micro-vascular density was defined as vascular number per field. A tubule with endothelialcells lined and red blood cells inside was counted as a microvessel. It was measuredby viewing 15 fields of each group (four to five samples of a group, with three to fourrandomly selected fields of each sample) at the 100 � magnification.

2.10. Statistical analysis

Statistical analysis was performed with SPSS 17.0 (SPSS, USA). All data wereexpressed as mean� standard deviation. Datawere analyzed by one-way analysis ofvariance (ANOVA), followed by StudenteNewmaneKeuls test. A 2-tailed Student ttest was used to calculate differences between binary variables. The value of p< 0.05was considered statistically significant.

3. Results

3.1. In vitro

The microspheres had an average diameter of 352 mm, rangingfrom 133 mm to 418 mm (Fig. 1A). Generally, the microspheresshowed good sphericity and narrow diameter distribution.

The viability of ADSCs was not adversely affected by the elec-trostatic microencapsulation process as shown by the live/deadstaining (Figs. 1 and 2). An average 35 ADSCs were encapsulated inone microsphere and 95% � 0.5% cells remained alive at the initialtime-point. The 3D reconstruction images of the microspheres(Video 1 and Video 2) showed that ADSCs were round in shape andevenly dispersed inside the beads at first. At 7 days, in the PRP-ADSC-laden groups, cells migrated onto the surface of somemicrospheres demonstrating a spreading morphology and motilecapability (Fig. 2B, H, J; Video 3 and Video 4). These migrated cellsexhibited a characteristic flat and polygonal shape with radialextensions capping on the microspheres. Once cells attached to thesurface, they aggregated in layers and densely packed, indicating

these cells proliferated rapidly. This brought great difficulty for thequantitative analysis of cell number per bead. Alternatively, thepercentage of cell-migrated microspheres at day 7 was counted byselecting nine fields each group (three randomly selected fields inone well and three wells for each group). 10% PRP-ADSC-ladengroup demonstrated a significant higher ratio (20.5%) than othergroups (8.3% in 5%PRP and 7.5% in 15% PRP group, p< 0.05, data notshown). At 14 and 21 days, images of Live/dead staining micro-spheres revealed that cells preserved good viability in all groups.Dead cells (stained red) were few and sparse in all groups. However,no cell migration was observed in the ADSC-laden groups duringthe three week in vitro culture. These results suggested that PRPsustained cell viability and even promoted cell migration.

Supplementary video related to this article can be found athttp://dx.doi.org/10.1016/j.biomaterials.2012.08.054.

The expression of two specific osteoblastic markers, RUNX2 andOPNwere examined in Q-PCR. The RUNX2 gene expressionwas lowin the ADSC-laden and 5%PRP-ADSC-laden groups from 1 to 21days. For the 10% PRP-ADSC-laden and 15% PRP-ADSC-ladengroups, the RUNX2 level was low at 1 and 7 days, but increasedgreatly at 14 days, and then decreased at 21 days (p < 0.05). Theexpression of OPN gene was elevated dramatically in the lateculture phase from 14 days to 21 days. PRP significantly enhancedits expression level in a dose-dependent way, with the 15% PRP-ADSC-laden group expressing the highest OPN level at day 21(Fig. 3). ADSCs-laden group expressed low ALP activity over thetime until the end of culture (Fig. 4). The ALP activity of PRP-ADSCs-laden group was significantly elevated over the ADSCs-laden group(p < 0.001). The addition of PRP promoted a significant increase ofALP (p < 0.001) just in 7 days, then decreased at 14 days. Collec-tively, these data indicated that PRP induced osteogenic differen-tiation of encapsulated ADSCs.

3.2. In vivo

When injected percutaneously into nude mice, there were nosigns of rejection, infection, or skin necrosis during the wholeinspection period. At 1 and 3 months, only 10% PRP-ADSC-ladenmicrospheres (group IV) and 15% PRP-ADSC-laden microspheres(group V) hardened at the harvest, presented as solid clumps withwhite calcified matrix. The other three groups (group I, II, III)remained as semi translucent gels and were barely visible underthe micro-CT scanning (Fig. 5).

Micro-CT results showed that mineralized area were moreabundant in group V than group IV (Fig. 6). In group V, significantmineralization was found around and inside the injected material.While in group IV, peripheral areas were more intensely mineral-ized than central alginate matrix presenting as a small amount ofhigh-density granules surrounding a low-density core. The statis-tical analysis indicated that the mineralized tissue volumepercentage in group Vwas significantly higher than group IV after 3months (p < 0.01). Group V demonstrated higher density of thewhole tissue and mineralized tissue than group IV (p< 0.01). Theseresults suggested that PRP enhanced mineralization of implants ina dose-dependent way (Fig. 6).

Histological analysis demonstrated appropriate tissue integra-tion of the entire implants with surrounding tissue in all groups.With the exception of the group I, a thin layer of fibrous netencircling individual microbead was detected in other groups. Ingroup IV and group V, a complex anastomosing network of capil-laries infiltrated into the implant and surrounded around micro-spheres. On the contrary, in other groups, few vessels were found atthe periphery (Fig. 5). The quantitative analysis showed a signifi-cant increase of microvasular density in the group IV and group V,over 4-fold higher than the other groups (p < 0.001) (Fig. 7). The

Fig. 1. Microspheres produced by the electrostatic method. The diameter of the generated microspheres was between 133 mm and 418 mm(A). Live/dead staining of ADSC-microspheres at 1(B), 7(C), 14(D) and 21 days(E), respectively. Cells were homogenously suspended inside the microspheres all the while. Scale bar is 500 mm.

Y. Man et al. / Biomaterials 33 (2012) 8802e8811 8805

difference between the two groups (group IV and group V) wassignificant at 3 months (p< 0.05). Histological andmicro-CT resultstogether corroborated the close relationship between angiogenesisand mineralization that the development of vessel networks wasintegral to the bone formation.

4. Discussion

In this study, we developed an injectable alginate-hydrogelmicrosphere as a PRP and stem cell delivery system for thepotential use in tissue engineering. We demonstrated that PRPsupported the viability, migration and differentiation of encapsu-lated ADSCs. Additionally, by injecting the microspheres subcuta-neously, mineralization and vascularization were observed in 10%and 15% PRP integrated groups.

Alginate microsphere system, possessing interconnected porousstructure, is an attractive approach to deliver cells or bioactivemoleculars. The alginate microspheres can be fabricated via needleextrusion/external gelation [27,28], emulsification [29], air injection[21], and electronic injection [30,31]. The needle extrusion/externalgelation, by extruding the alginate droplets into a calcium chloride

solution to gel, is considered one of the simplestmethods. However,beads formed by this approach are in millimeter-scale [27,28], farbeyond the diffusion limit of oxygen. To address this issue, airinjection and electronic injection, which break up the alginatedroplets by air flow or electrostatic force, have been developed.Ideal bead size can be achieved through adjusting the gas pressureor electric potential, and other parameters such as flow speed, sizeof the needle, distance between the needle and the gelling bath[21,31]. The average radius of microspheres in our study, 176 mm(diameter 352 mm), was controlled within the range based onseveral theories. Firstly, maintenance of cell viability is achieved byefficient transportation of nutrients, oxygen andwastes through themicrocapsule matrix. Among these factors, the diffusion limit ofoxygen is no far than 200 mm [32]. As a result, microspheres withinthe 200 mm radius limitation could be more predictable for interiorcells. Secondly, the release of proteins fromhydrogels is related bothto diffusion distances and hydrogel mesh size [33]. Small sizewouldalso facilitate release of growth factors, which is important forinitiating proper response of surrounding tissue. Thirdly, smallersize permits delivery via injection, well in accordance with theprinciple of minimally invasive operation. Beads that are bigger

Y. Man et al. / Biomaterials 33 (2012) 8802e88118806

0 0

OP

N G

en

e E

xp

ressio

n (fo

ld

ch

an

ge)

RU

NX

2 G

en

e E

xp

ressio

n (fo

ld

ch

an

ge)

ADSC

5%

PRP

10%

PRP

15%

PRP

ADSC

5%

PRP

10%

PRP

15%

PRP

2

4

6

8

10

1 day7 day14 day21 day

1 day7 day14 day21 day

20

25

30

35

40

1

2

3

4

5

A

Fig. 3. Quantitative real-time PCR results of relative expression level of RUNX2(A) and OPN(B). RUNX2 increased greatly at day 14, while OPN peaked at day 21 in the PRP-ladengroups. The addition of 10% PRP and 15% PRP, promoted a significant increase of bone marker expressions, compared to ADSC-laden groups (*p < 0.05, **p < 0.01, ***p < 0.001).

Fig. 4. ALP activity of ADSCs cultured in different groups from 1 to 21 days. ALP activitywas significantly elevated at day 7 in PRP-laden groups (*p < 0.05, **p < 0.01,***p < 0.001).

Y. Man et al. / Biomaterials 33 (2012) 8802e8811 8807

than the interior diameter of the needle, could rupturewhen forcedthrough thin needles; meanwhile the generated high pressures andshearing forces could jeopardize cell survival [21,34]. In this study,microspheres could be easily injected through a 22-gauge needle(inner diameter 0.41 mm). Although injection kinetics could becontinuously improved through further reduction of bead size,microspheres smaller than 60 mm do not permit the encapsulationof the minimal number of cells that are needed to allow cell contactand proliferation [34]. Fourthly, beads in proper size can behomogeneously mixed with other biomaterials for extendedapplication. Zhao et al. embedded cell-loaded alginate micro-spheres in calcium phosphate cements (CPC) to improve mechan-ical strength of the hydrogel [35,36]. On the other hand, when CPCgradually hardens in situ, these microspheres serve as provisionalmatrix to maintain the regenerative space. After degradation of thealginate, pores can be formed within densely aggregated crystals.These pores could improve osteo-conduction of CPC by facilitatingingrowth of cells and blood vessels.

Fig. 2. Live/dead staining of 10% PRP-ADSC-microspheres at 1(A), 7(B), 14(C) and 21(D) daysand 7 days(J). Scale bar is 500 mm. At day 1, live cells appeared as green dots scattering evmicrospheres demonstrating a spreading morphology (B, E, H, J). Arrows indicate the cemicrospheres at day 7. For better view of the microspheres, the combination images of the coand D, respectively. A representative picture of dead cells staining at day 21 was shown in F. Dcolor in this figure legend, the reader is referred to the web version of this article.)

It was somewhat surprising that PRP not only benefited to theviability of immobilized cells, but also promoted cell migration tosurfaces of some microspheres. This is the crucial precondition forcells’ active involvement in the regeneration process. Cells werehomogenously suspended within the aqueous environment insidemicrospheres at first in all groups. Herein cell contact was dis-rupted and cell proliferation was halted. Interestingly, with theaddition of PRP, cells migrated through alginatematrix and overlaidthe surface at day 7. The interactions between biomaterial surfacesand cells could promote the biological performance [37]. Subse-quently, cell reproduction and aggregation can be expected [38].From our results, proliferation was greatly enhanced after cellsmoving to the surface. It is worthwhile to note that a considerableamount of literature has been published on cell-based alginatemicroencapsulation [20,21,27,28,30,34,35,39], however, none re-ported cell release except for a rapid-degradable oxidized alginatefibrin research [40,41]. It seems that, on one hand, seeded cells arewell-protected by alginate microsphere, while on the other hand,cells get used to the environment inside the microsphere and darenot take the big step to go out and face the “harsh and strangeoutside world”. The incorporation of PRP not only provides a cell-friendly environment, but also serves as a stimulatory factor oncellular migration [42,43]. It was observed that embedded cellsmoved out of microspheres even at the lowest utilized concentra-tion of 5%PRP. Our study is to the best of our knowledge the first toreport cell migration in natural alginate microspheres throughincorporation of PRP.

Besides, the adjunction of PRP in microsphere stimulated oste-ogenic differentiation of ADSCs characterized by a strong ALPactivity at day 7, and the expression of gene RUNX2 and OPN at day14 and day 21. To date, there are contradictory opinions concerningwhether PRP enhance or inhibit osteogenic differentiation. Severalstudies concluded that PRP exerted a favorable effect on the oste-ogenic differentiation of human periodontal ligament cells andosteoblasts [44,45], while other studies denied the effect [46].Inconsistent concentrations of the platelets in PRP derived fromdifferent protocols, various applied concentrations of PRP, as well asother bias might contribute to the contradiction. Literature reviews

, 5%PRP-ADSC-microspheres at 1(G) and 7 days(H), 15% PRP-ADSC-microspheres at 1(I)enly in the microspheres (A, G, I). By the day 7, cells migrated to the surfaces of somell migrated microspheres. E is the 3D confocal images of one of such cell migratednfocal cross-sections and phase contrast pictures at day 14 and 21 were presented in Cead cells were few and sparse from 1 to 21 days. (For interpretation of the references to

Fig. 5. Macroscopic inspection and histology of subcutaneously implanted alginate microspheres at 1 and 3 months. Note that only 10% PRP-ADSC-laden microspheres (group IV)and 15% PRP-ADSC-laden microspheres (group V) hardened at the harvest, presented as solid clumps with white calcified matrix. The other three groups (group I, II, III) remained assemi translucent gels. Except for the empty microspheres, all other groups demonstrated a host response of fibrous network around individual beads. In group IV and group V,a considerable amount of small capillaries infiltrated into the implant and surrounded around microspheres. Arrows indicate vessels. From A to J, scale bar is 500 mm.

Fig. 6. Micro-CT analysis of the heterotopic bone formation of 10% PRP-ADSC-laden (group IV) and 15% PRP-ADSC-laden microspheres (group V) at 3 months. (A) three-dimensionaland cross-sectional images of the implants, scale bar is 2 mm (B) percentage of mineralized tissue volume, (C) mean density of mineralized volume, and (D) mean density of tissuevolume (*p < 0.05, **p < 0.01, ***p < 0.001).

Y. Man et al. / Biomaterials 33 (2012) 8802e8811 8809

suggested that PRP should reach a 2e6-fold increase in plateletconcentration over the physiological level to achieve positiveeffects [14]. It has also been reported that cultural media containinglower percentage of PRP (10% and 12.5%) resulted in the greatestenhancement of cell proliferation and osteogenic differentiation ofADSCs, while high concentrations did not necessarily result inoptimal outcomes [47]. Therefore, the ratio of platelet concentra-tion for PRP/whole blood was adjusted at 5 fold, and 5e15% PRPwas incorporated into microspheres in this study. 10% PRP was themost beneficial in terms of a migratory stimulus and proliferation

Fig. 7. Higher magnification of small vessels encircling microspheres is showed in A (scalecapillaries penetrate into and surround the microspheres as indicated by the Masson staindensities of group IV and V were significantly higher than other groups (C) (*p < 0.05, **p < 0reader is referred to the web version of this article.)

compared with others. Also, 10% PRP prompted a significant ALPactivity and osteogenic gene expression. Taken together, the resultsof in vitro studies suggest that 10% PRP-ADSC-laden group appearsto be the ideal candidates.

In vivo experiments confirmed that PRP exerted a positive anddose-dependent effect on mineralization and vascularization ofinjected microspheres. The relatively higher concentration of PRP(10% and 15%) resulted in better performance than lower PRP group(5%) and groups without PRP. Capillaries penetrated much deeperin the two groups (10% and 15%) and capillary density of the two

bar is 50 mm). Note that endothelial cells lined the tubules with red cells inside. Twoing slice in B (scale bar is 50 mm). Quantification analysis revealed that microvasular.01, ***p < 0.001). (For interpretation of the references to color in this figure legend, the

Y. Man et al. / Biomaterials 33 (2012) 8802e88118810

groups was significantly higher than other groups. None regressionof capillary density at 3 month indicated that these newly-formedvessels were mature and stable. Concomitant with the develop-ment of vessel networks, prominent mineralization was observedin the two groups. This phenomenon demonstrated that angio-genesis plays an important role in the bone regeneration. In vivo,15% PRP was much more productive in mineralization enhance-ment than 10% PRP as evidenced bymicro-CT analysis. The differentenvironments might explain the paradoxical results of the 10% PRPand 15% PRP-laden-groups in vivo and in vitro. Beneficial effects ofPRP were due to delivering of multiple growth factors related toangiogenesis and bone regeneration, such as VEGF, PDGF, TGF-b,and FGF. These growth factors have multifarious activities:recruiting ECs, osteoblast precursors and monocytes fromsurrounding tissues; regulating cell proliferation, migration anddifferentiation; stimulating sprout formation from existing vessels;accelerating osteoblast deposition of the collagenmatrix; inhibitingosteoclast and bone resorption [14,48]. However, the period ofdirect influence of PRP, when exposed straightly to environment, isless than 7 days due to a high initial burst release and the shortlifespan of growth factors [47]. Alginate beads have been applied tocontrol the release of VEGF [18], and promoted formation ofextensive capillary beds in local regions [49]. In this study, weadopted this method and encapsulated PRP into alginate beads,which prevented enzymatic degradation of growth factors andoptimize the release at a controllable way. However, the effect ofPRP alone is not strong enough to achieve satisfactory healingevents. Blanton et al. used PRP and ADSCs to treat the porcine full-thickness wound. Their results showed that treatments containingADSCs demonstrated increased microvessel densities andimproved wound cosmesis compared with groups without ADSCs[50]. Several literatures reported that the combination of BMSCsand PRP enhanced substantial new bone formation and vasculari-zation, and achieved well-formedmature bone and better hardnessto repair bone defects in rabbits and dogs. The PRP alone groupshad unsatisfactory bone repair [51e53]. Also, tissue-engineeredbone composed of scaffolds, PRP and seeding cells was superiorwith faster bone regeneration and excellent bone quality thangroups without seeding cells [54,55]. Data listed above support thepositive effects of seeding cells in healing processes in differentmodels. Therefore, we incorporated ADSCs into the microspheres,which can react positively to PRP factors, giving further advances inimproving angiogenesis and bone formation [47]. As the PRP fades,induced ADSCs and recruited cells take over the role of PRP as themain source of growth factors [53]. ADSCs can secrete VEGF, FGFand hepatocyte growth factor (HGF), which are of vital importanceto the migration and proliferation of ECs [56,57]. ADSCs coulddifferentiate under appropriate conditions into endothelial cellsand participate in the vessel regeneration directly [58,59]. Besides,ADSCs may also act as pericytes to support and stabilize nascent ECtubes [11,60]. In turn, ECs not only participate in angiogenesis, butalso produce factors like bone morphogenetic proteins (BMPs) thatpromote osteogenesis [61]. This mutually beneficial mechanismmight be the dominant influence enhancing the final performance,in succession to PRP effects. However, the specific mechanismneeds to be elucidated in further studies.

Finally, this study was limited in several ways. First, we did notlabel the encapsulated cells, so that it was hardly to tell theirdestiny in vivo. Based on the in vitro study, we can predict that atleast part of the encapsulated cells, under the influence of PRP, isable to migrate to the outside. And for the same reason, we couldnot tell either encapsulated cells or host cells take a major role inbone minerals and capillary generation. Our further research willconsider labeling cells to answer these questions. Second, since thestudy was aimed at investigating the osteogenic and angiogenic

ability of the PRP-ADSCs-ladenmicrospheres, we have notmodifiedor functionalized alginate to improve its degradability and cellularaffinity. These modifications will be considered in our followingresearch.

5. Conclusions

The combination of PRP and ADSCs microencapsulated in algi-nate appears as a promising strategy in bone engineering. In vitrostudy showed that PRP promoted migration and osteogenicdifferentiation of encapsulated ADSCs, without compromising theirviability. In vivo study demonstrated that the injectable micro-spheres loaded with 10% PRP-ADSC and 15% PRP-ADSC inducedvascularization andmineralization in heterotopic site of nude mice.Safety and efficacy further tested, the PRP-ADSC-laden micro-spheres may not only be applied in the micro invasive engineeringapproach, but also could be incorporated with other matrices forextended application.

Acknowledgments

Contract grant sponsor: This work was supported by Ph.D.Programs Foundation from Regenerative Medicine Research Center,Sichuan University; the National Natural Science Foundation ofChina (project nos. 81101347 and 81170995). The funding sourceshad no involvement in study design, collection, analysis andinterpretation of data, writing of the report, and decision to submitthe paper for publication. We express our sincere thanks to Yi Linfrom the Textile School, Sichuan University, Jidong Li and Jing Zoufrom the Research Center for Nano-Biomaterials, Analytical andTesting Center, Sichuan University for their technique support.

References

[1] O’Keefe RJ, Mao J. Bone tissue engineering and regeneration: from discoveryto the clinicean overview. Tissue Eng Part B Rev 2011;17:389e92.

[2] Pirraco RP, Obokata H, Iwata T, Marques AP, Tsuneda S, Yamato M, et al.Development of osteogenic cell sheets for bone tissue engineering applica-tions. Tissue Eng Part A 2011;17:1507e15.

[3] Holzwarth JM, Ma PX. Biomimetic nanofibrous scaffolds for bone tissueengineering. Biomaterials 2011;32:9622e9.

[4] Meijer GJ, de Bruijn JD, Koole R, van Blitterswijk CA. Cell based bone tissueengineering in jaw defects. Biomaterials 2008;29:3053e61.

[5] Schroeder JE, Mosheiff R. Tissue engineering approaches for bone repair:concepts and evidence. Injury 2011;42:609e13.

[6] Kaully T, Kaufman-Francis K, Lesman A, Levenberg S. Vascularizationetheconduit to viable engineered tissues. Tissue Eng Part B Rev 2009;15:159e69.

[7] Zhu Y, Liu T, Song K, Fan X, Ma X, Cui Z. Adipose-derived stem cell: a betterstem cell than BMSC. Cell Biochem Funct 2008;26:664e75.

[8] Schubert T, Xhema D, Veriter S, Schubert M, Behets C, Delloye C, et al. Theenhanced performance of bone allografts using osteogenic-differentiatedadipose-derived mesenchymal stem cells. Biomaterials 2011;32:8880e91.

[9] James R, Kumbar SG, Laurencin CT, Balian G, Chhabra AB. Tendon tissueengineering: adipose-derived stem cell and GDF-5 mediated regenerationusing electrospun matrix systems. Biomed Mater 2011;6:025011.

[10] Gaetani P, Torre ML, Klinger M, Faustini M, Crovato F, Bucco M, et al. Adipose-derived stem cell therapy for intervertebral disc regeneration: an in vitroreconstructed tissue in alginate capsules. Tissue Eng Part A 2008;14:1415e23.

[11] Cai X, Lin Y, Hauschka PV, Grottkau BE. Adipose stem cells originate fromperivascular cells. Biol Cell 2011;103:435e47.

[12] Moon JJ, West JL. Vascularization of engineered tissues: approaches topromote angio-genesis in biomaterials. Curr Top Med Chem 2008;8:300e10.

[13] Kanczler JM, Oreffo RO. Osteogenesis and angiogenesis: the potential forengineering bone. Eur Cell Mater 2008;15:100e14.

[14] Intini G. The use of platelet-rich plasma in bone reconstruction therapy.Biomaterials 2009;30:4956e66.

[15] Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE, Georgeff KR.Platelet-rich plasma: growth factor enhancement for bone grafts. Oral SurgOral Med Oral Pathol Oral Radiol Endod 1998;85:638e46.

[16] Chen R, Curran SJ, Curran JM, Hunt JA. The use of poly(l-lactide) and RGDmodified microspheres as cell carriers in a flow intermittency bioreactor fortissue engineering cartilage. Biomaterials 2006;27:4453e60.

Y. Man et al. / Biomaterials 33 (2012) 8802e8811 8811

[17] Serra M, Correia C, Malpique R, Brito C, Jensen J, Bjorquist P, et al. Microen-capsulation technology: a powerful tool for integrating expansion and cryo-preservation of human embryonic stem cells. PLoS One 2011;6:e23212.

[18] Gu F, Amsden B, Neufeld R. Sustained delivery of vascular endothelial growthfactor with alginate beads. J Control Release 2004;96:463e72.

[19] Radin S, Chen T, Ducheyne P. The controlled release of drugs from emulsified,sol gel processed silica microspheres. Biomaterials 2009;30:850e8.

[20] Moyer HR, Kinney RC, Singh KA, Williams JK, Schwartz Z, Boyan BD. Alginatemicroencapsulation technology for the percutaneous delivery of adipose-derived stem cells. Ann Plast Surg 2010;65:497e503.

[21] Zhao L, Weir MD, Xu HH. An injectable calcium phosphate-alginate hydrogel-umbilical cord mesenchymal stem cell paste for bone tissue engineering.Biomaterials 2010;31:6502e10.

[22] Pawar SN, Edgar KJ. Alginate derivatization: a review of chemistry, propertiesand applications. Biomaterials 2012;33:3279e305.

[23] Kolambkar YM, Dupont KM, Boerckel JD, HuebschN,MooneyDJ, HutmacherDW,et al. An alginate-basedhybrid system for growth factor delivery in the functionalrepair of large bone defects. Biomaterials 2011;32:65e74.

[24] Tam SK, Dusseault J, Bilodeau S, Langlois G, Halle JP, Yahia L. Factors influ-encing alginate gel biocompatibility. J Biomed Mater Res A 2011;98:40e52.

[25] Andrade MG, de Freitas Brandao CJ, Sa CN, de Bittencourt TC, Sadigursky M.Evaluation of factors that can modify platelet-rich plasma properties. OralSurg Oral Med Oral Pathol Oral Radiol Endod 2008;105:e5e12.

[26] Wang Y, Shi R, Gong P, Li J, Li J, Ao D, et al. Bioelectric effect of a chitosanbioelectret membrane on bone regeneration in rabbit cranial defects. J BioactCompat Polym 2012;27:122e32.

[27] Zhao L, Weir MD, Xu HH. Human umbilical cord stem cell encapsulation incalcium phosphate scaffolds for bone engineering. Biomaterials 2010;31:3848e57.

[28] Weir MD, Xu HH. Human bone marrow stem cell-encapsulating calciumphosphate scaffolds for bone repair. Acta Biomater 2010;6:4118e26.

[29] Heng PW, Chan LW, Wong TW. Formation of alginate microspheres producedusing emulsification technique. J Microencapsul 2003;20:401e13.

[30] Zhang W, He X. Encapsulation of living cells in small (approximately 100microm) alginate microcapsules by electrostatic spraying: a parametric study.J Biomech Eng 2009;131:074515.

[31] Klokk TI, Melvik JE. Controlling the size of alginate gel beads by use of a highelectrostatic potential. J Microencapsul 2002;19:415e24.

[32] Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature 2000;407:249e57.

[33] Olabisi RM, Lazard ZW, Franco CL, Hall MA, Kwon SK, Sevick-Muraca EM, et al.Hydrogel microsphere encapsulation of a cell-based gene therapy systemincreases cell survival of injected cells, transgene expression, and bone volumein a model of heterotopic ossification. Tissue Eng Part A 2010;16:3727e36.

[34] Herrero EP, Del Valle EM, Galan MA. Immobilization of mesenchymal stemcells and monocytes in biocompatible microcapsules to cell therapy. Bio-technol Prog 2007;23:940e5.

[35] Zhao L, Tang M, Weir MD, Detamore MS, Xu HH. Osteogenic media andrhBMP-2-induced differentiation of umbilical cord mesenchymal stem cellsencapsulated in alginate microbeads and integrated in an injectable calciumphosphate-chitosan fibrous scaffold. Tissue Eng Part A 2011;17:969e79.

[36] Theinhan W, Weir MD, Simon CG, Xu HH. Non-rigid calcium phosphatecement containing hydrogel microbeads and absorbable fibres seeded withumbilical cord stem cells for bone engineering. J Tissue Eng Regen Med 2012:1466. http://dx.doi.org/10.1002/term [Epub ahead of print] PubMed PMID:22451091.

[37] Williams DF. The role of short synthetic adhesion peptides in regenerativemedicine; the debate. Biomaterials 2011;32:4195e7.

[38] Markusen JF, Mason C, Hull DA, Town MA, Tabor AB, Clements M, et al.Behavior of adult human mesenchymal stem cells entrapped in alginate-GRGDY beads. Tissue Eng 2006;12:821e30.

[39] Grellier M, Granja PL, Fricain JC, Bidarra SJ, Renard M, Bareille R, et al. Theeffect of the co-immobilization of human osteoprogenitors and endothelialcells within alginate microspheres on mineralization in a bone defect.Biomaterials 2009;30:3271e8.

[40] Zhou H, Xu HH. The fast release of stem cells from alginate-fibrin microbeadsin injectable scaffolds for bone tissue engineering. Biomaterials 2011;32:7503e13.

[41] Chen W, Zhou H, Weir MD, Bao C, Xu HH. Umbilical cord stem cells releasedfrom alginate-fibrin microbeads inside macroporous and biofunctionalized

calcium phosphate cement for bone regeneration. Acta Biomater 2012 [Epubahead of print] PubMed PMID: 22391411.

[42] Creeper F, Lichanska AM, Marshall RI, Seymour GJ, Ivanovski S. The effect ofplatelet-rich plasma on osteoblast and periodontal ligament cell migration,proliferation and differentiation. J Periodontal Res 2009;44:258e65.

[43] Caceres M, Hidalgo R, Sanz A, Martinez J, Riera P, Smith PC. Effect of platelet-rich plasma on cell adhesion, cell migration, and myofibroblastic differentia-tion in human gingival fibroblasts. J Periodontol 2008;79:714e20.

[44] Kawase T, Okuda K, Saito Y, Amizuka N, Suzuki H, Yoshie H. Platelet-richplasma provides nucleus for mineralization in cultures of partially differen-tiated periodontal ligament cells. In Vitro Cell Dev Biol Anim 2005;41:171e6.

[45] Kanno T, Takahashi T, Tsujisawa T, Ariyoshi W, Nishihara T. Platelet-richplasma enhances human osteoblast-like cell proliferation and differentiation.J Oral Maxillofac Surg 2005;63:362e9.

[46] Arpornmaeklong P, Kochel M, Depprich R, Kubler NR, Wurzler KK. Influence ofplatelet-rich plasma (PRP) on osteogenic differentiation of rat bone marrowstromal cells. An in vitro study. Int J Oral Maxillofac Surg 2004;33:60e70.

[47] Liu Y, Zhou Y, Feng H, Ma GE, Ni Y. Injectable tissue-engineered bonecomposed of human adipose-derived stromal cells and platelet-rich plasma.Biomaterials 2008;29:3338e45.

[48] Eppley BL, Pietrzak WS, Blanton M. Platelet-rich plasma: a review ofbiology and applications in plastic surgery. Plast Reconstr Surg 2006;118:147ee59e.

[49] Elcin YM, Dixit V, Gitnick G. Extensive in vivo angiogenesis followingcontrolled release of human vascular endothelial cell growth factor: impli-cations for tissue engineering and wound healing. Artif Organs 2001;25:558e65.

[50] Blanton MW, Hadad I, Johnstone BH, Mund JA, Rogers PI, Eppley BL, et al.Adipose stromal cells and platelet-rich plasma therapies synergisticallyincrease revascularization during wound healing. Plast Reconstr Surg 2009;123:56Se64S.

[51] Cheng X, Lei D, Mao T, Yang S, Chen F, Wu W. Repair of critical bone defectswith injectable platelet rich plasma/bone marrow-derived stromal cellscomposite: experimental study in rabbits. Ulus Travma Acil Cerrahi Derg2008;14:87e95.

[52] Ito K, Yamada Y, Nagasaka T, Baba S, Ueda M. Osteogenic potential of inject-able tissue-engineered bone: a comparison among autogenous bone, bonesubstitute (Bio-oss), platelet-rich plasma, and tissue-engineered bone withrespect to their mechanical properties and histological findings. J BiomedMater Res A 2005;73:63e72.

[53] Yamada Y, Ueda M, Naiki T, Nagasaka T. Tissue-engineered injectable boneregeneration for osseointegrated dental implants. Clin Oral Implants Res2004;15:589e97.

[54] Nair MB, Varma HK, Menon KV, Shenoy SJ, John A. Reconstruction of goatfemur segmental defects using triphasic ceramic-coated hydroxyapatite incombination with autologous cells and platelet-rich plasma. Acta Biomater2009;5:1742e55.

[55] Yoshimi R, Yamada Y, Ito K, Nakamura S, Abe A, Nagasaka T, et al. Self-assembling peptide nanofiber scaffolds, platelet-rich plasma, and mesen-chymal stem cells for injectable bone regeneration with tissue engineering.J Craniofac Surg 2009;20:1523e30.

[56] Borges J, Muller MC, Momeni A, Stark GB, Torio-Padron N. In vitro analysis ofthe interactions between preadipocytes and endothelial cells in a 3D fibrinmatrix. Minim Invasive Ther Allied Technol 2007;16:141e8.

[57] Murohara T, Shintani S, Kondo K. Autologous adipose-derived regenerativecells for therapeutic angiogenesis. Curr Pharm Des 2009;15:2784e90.

[58] Ebrahimian TG, Pouzoulet F, Squiban C, Buard V, Andre M, Cousin B, et al.Cell therapy based on adipose tissue-derived stromal cells promotes phys-iological and pathological wound healing. Arterioscler Thromb Vasc Biol2009;29:503e10.

[59] Miranville A, Heeschen C, Sengenes C, Curat CA, Busse R, Bouloumie A.Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation 2004;110:349e55.

[60] Traktuev DO, Merfeld-Clauss S, Li J, Kolonin M, Arap W, Pasqualini R, et al.A population of multipotent CD34-positive adipose stromal cells share peri-cyte and mesenchymal surface markers, reside in a periendothelial location,and stabilize endothelial networks. Circ Res 2008;102:77e85.

[61] Wang J, Ye Y, Tian H, Yang S, Jin X, Tong W, et al. In vitro osteogenesis ofhuman adipose-derived stem cells by coculture with human umbilical veinendothelial cells. Biochem Biophys Res Commun 2011;412:143e9.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具