JOURNAL OF VIROLOGY, Jan. 2009, p. 687–700 Vol. 83, No. 20022-538X/09/$08.00�0 doi:10.1128/JVI.01281-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Analysis of the Differential Host Cell Nuclear Proteome Induced byAttenuated and Virulent Hemorrhagic Arenavirus Infection�†

Gavin C. Bowick,1,4,5 Heidi M. Spratt,6,7 Alison E. Hogg,3 Janice J. Endsley,3 John E. Wiktorowicz,2,7

Alexander Kurosky,2,7 Bruce A. Luxon,2,4,6 David G. Gorenstein,2,4,7 and Norbert K. Herzog1,3,4,5*Department of Pathology,1 Department of Biochemistry and Molecular Biology,2 Department of Microbiology and Immunology,3

Center for Biodefense and Emerging Infectious Diseases,4 Institute for Human Infections and Immunity,5 Bioinformatics Program,6

and NHLBI Proteomics Center,7 University of Texas Medical Branch, Galveston, Texas

Received 19 June 2008/Accepted 24 October 2008

Arenaviruses are important emerging pathogens and include a number of hemorrhagic fever viruses classified asNIAID category A priority pathogens and CDC potential biothreat agents. Infection of guinea pigs with the NewWorld arenavirus Pichinde virus (PICV) has been used as a biosafety level 2 model for the Lassa virus. Despitecontinuing research, little is known about the molecular basis of pathogenesis, and this has hindered the design ofnovel antiviral therapeutics. Modulation of the host response is a potential strategy for the treatment of infectiousdiseases. We have previously investigated the global host response to attenuated and lethal arenavirus infections byusing high-throughput immunoblotting and kinomics approaches. In this report, we describe the differentialnuclear proteomes of a murine cell line induced by mock infection and infection with attenuated and lethal variantsof PICV, investigated by using two-dimensional gel electrophoresis. Spot identification using tandem mass spec-trometry revealed the involvement of a number of proteins that regulate inflammation via potential modulation ofNF-�B activity and of several heterogeneous nuclear ribonuclear proteins. Pathway analysis revealed a potentialrole for transcription factor XBP-1, a transcription factor involved in major histocompatibility complex II (MHC-II)expression; differential DNA-binding activity was revealed by electrophoretic mobility shift assay, and differences insurface MHC-II expression were seen following PICV infection. These data are consistent with the results of severalprevious studies and highlight potential differences between transcriptional and translational regulation. This studyprovides a number of differentially expressed targets for further research and suggests that key events in patho-genesis may be established early in infection.

The arenaviruses are small, enveloped, bipartite RNA viruseswith a unique ambisense coding strategy. A number of arenavi-ruses are important human pathogens, including the type species,Lymphocytic choriomeningitis virus (LCMV), which has recentlybeen implicated in a number of posttransplant fatalities (3, 13,26), and several hemorrhagic-fever-causing viruses, such as Lassavirus, Junin virus, and Machupo virus. The hemorrhagic arenavi-ruses are NIAID category A priority pathogens and CDC poten-tial biothreat agents. Lassa virus is endemic in West Africa, whereit causes significant morbidity and mortality (58). Currently, theonly treatments available for these infections are supportive careand the broad-spectrum antiviral ribavirin, which must be admin-istered within the first week of infection to be most efficacious(47). Little is known about the molecular basis of the pathology,and this has hindered the design of novel therapeutics.

Pichinde virus (PICV) is a New World arenavirus that infectsguinea pigs, resulting in hemorrhagic fever. Two passage vari-ants of this virus have been developed that cause either a mild,self-limiting infection (the P2 variant) or a severe hemorrhagicfever (the P18 variant) (33). This matched virus pair allows thedifferential signaling events and responses following infectionto be determined. Understanding these events may allow us to

develop novel therapeutic strategies which act to modulate theresponse seen following infection with the virulent virus inorder to simulate the cellular responses seen following infec-tion with the attenuated virus that lead to viral clearance andrecovery.

Previous research suggests that the severity of arenaviruspathogenesis may be due to dysregulation of innate immunesignaling and the cytokine response (6, 8, 9, 16, 17, 24, 59);however, we do not yet fully understand how arenavirusesinduce this dysregulation or how this leads to disease. Modu-lating the host immune response to a pathogen may well proveto be an efficacious form of treatment against a number ofinfections, and current strategies are focused on a broad-spec-trum “boosting” of the immune response to a pathogen (2).However, some infections, in which the disease is immuneresponse mediated, may be exacerbated by this approach, andso a more-complete understanding of specific host-pathogeninteractions is required. Also, as the type of broad-spectrumimmune modulation required may change at different stages ofinfection, an understanding of how host cell signaling changesover time is also needed. Many viruses modulate cell signalingpathways to induce a cellular state that can facilitate produc-tive infection (4, 7) or to evade the immune response (29, 42,62). A more-complete understanding of the interactions be-tween virus and host may allow the development of novelbroad-spectrum antiviral therapeutics that act at the level ofthe host.

We have previously shown a number of differential cell-signaling events in attenuated and virulent PICV infections by

* Corresponding author. Mailing address: 301 University Boulevard,Galveston, TX 77555-0609. Phone: (409) 772-3938. Fax: (409) 772-2400. E-mail: nherzog@utmb.edu.

† Supplemental material for this article may be found at http://jvi.asm.org/.

� Published ahead of print on 12 November 2008.

687

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

using a murine macrophage-like cell line, as a guinea pig mac-rophage cell line is not available. While mice do not succumbto PICV infection, this experimental system has revealed sig-nificant differences between P2 and P18 infections. Our initialglobal study was at the level of the proteome, using high-throughput immunoblotting (8); this was followed by a kinom-ics analysis in which the activities of cellular kinases followinginfection were investigated (9). While both of these ap-proaches have allowed us to determine many of the cellularsignaling events which may be involved in pathogenesis, theassays have an intrinsic bias in the selection of the proteins andsubstrates whose level or activity was measured. A recentlypublished study used genomics arrays to assay gene expressionprofiles following the infection of macaques with a virulent orattenuated variant of LCMV (22). This study has further com-plemented our understanding of the cellular response toarenavirus infection. We sought to expand our knowledge ofthese virus-host interactions in an unbiased fashion by usingtwo-dimensional polyacrylamide gel electrophoresis (2D-PAGE) to assay the differential proteomes induced by theseinfections and over time and to determine the identity of thespots that showed the greatest differences by using tandemmass spectrometry (MS-MS) peptide fragment sequencing. Anunderstanding of the phosphoproteome, proteome, and tran-scriptome will allow us to understand both the transcriptionaland translational regulation of the host response to arenavirusinfection.

For this report, we used 2D-PAGE to investigate the hostcell response to infection with attenuated and virulent isolatesof PICV in vitro over a time course of infection. Protein iden-tification using MS-MS revealed a number of proteins impli-cated in the regulation of the central mediator of inflammationNF-�B. We also show that heterogeneous nuclear ribonuclearprotein (hnRNP) family proteins show significant differentialexpression in attenuated and lethal infections and providepromising avenues for further investigation.

MATERIALS AND METHODS

Cell culture and viruses. P388D1 (murine macrophage-like) cells were main-tained in RPMI medium supplemented with 5% fetal bovine serum and 2 mMglutamine. Cells were infected with purified P2 or P18 PICV at a multiplicity ofinfection of 1 or mock infected with an equivalent fraction of virus purificationmedium. Cells were harvested at various times postinfection, and cytoplasmicand nuclear extracts prepared. Time points are relative to the time of initial virusaddition to the culture medium.

Viruses were from serially spleen-passaged stocks from inbred strain 13 guineapigs infected with PICV Munchique strain CoAn 4763 (72). Virus was quantifiedin a standard plaque assay on Vero cells as described previously (5). Viruses werepurified by using polyethylene glycol gradients to remove potential contamina-tion from cytokines and other soluble factors.

Cell extract preparation. Cytoplasmic and nuclear extracts were preparedfrom P388D1 cells as previously described (23), with the addition of a nuclearpurification step using Optiprep (Axis-Shield) gradients. Briefly, lysates wereunderlayered with 10 ml 30% Optiprep and 5 ml 35% Optiprep and centrifugedat 4°C for 30 min at 4,300 � g. The interface was removed and placed in a freshtube which was filled with sucrose buffer I as previously described (27), plus 1.5mM CaCl2. Following centrifugation at 4°C for 15 min at 1,900 � g, the pellet wasresuspended in sucrose buffer I and the centrifugation repeated. Nuclear lysiswas completed by following the referenced protocol. Protein concentrations weredetermined by using a bicinchoninic acid assay kit (Pierce Biotechnology, Rock-ford, IL).

Electrophoresis and immunoblotting. Protein samples were denatured in so-dium dodecyl sulfate (SDS)-PAGE loading buffer (100 mM Tris, pH 6.8, 4%SDS, 5% 2-mercaptoethanol [vol/vol], 30% glycerol) and boiled for 5 min. A

5-�g sample per lane was loaded onto Invitrogen Novex 10% gels (Invitrogen,Carlsbad, CA); the gels were electrophoresed, and then transferred to polyvi-nylidene difluoride membranes (Millipore, Billerica, MA) and immunodetectedfollowing standard protocols. Antibodies to hnRNP A2/B1 and A1 were pur-chased from Abcam (Kendall, MA).

Separations and differential analysis. Nuclear extracts were used for proteom-ics analysis. Samples with a low protein concentration were concentrated onMicrocon 10-kDa molecular-weight-cutoff (Millipore, Billerica MA) spin filters,according to the manufacturer’s protocol, prior to 2D-gel electrophoresis. Allsamples were desalted on spin desalting columns (Pierce Biotechnology, Rock-ford, IL) prior to isoelectric focusing (IEF). A 200-�g amount of protein wasused for each sample replicate. DeStreak rehydration buffer and 0.5% immobi-lized pH gradient (IPG) buffer, pH 3 to 10, (GE Healthcare) were added to eachreplicate for rehydration of 11-cm, pH 3 to 10 IPG strips (GE Healthcare). IEFwas accomplished in a stepwise fashion by first applying 50 V for 11 h to assist inrehydration of the IPG strips, followed successively by 250 V for 1 h, 500 V for1 h, 1,000 V for 1 h, 8,000 V for 2 h, and, finally, 8,000 for 6 h.

Following IEF, the strips were frozen at �80°C. Strips were then thawed in 4ml 6 M urea, 50 mM Tris, 2% SDS, 20% glycerol, and 5 mM Tris (2-carboxy-ethyl) phosmine for 15 min. The strips were then incubated in the same bufferand 25 mg/ml iodoacetamide for 15 min. The strips were rinsed in running bufferand placed in IPG wells of 8-to-16% Tris Criterion polyacrylamide gels (Bio-Rad, Hercules, CA). Agarose 0.5% was overlaid, and the second dimension wasrun at 150 V for 2.25 h at 4°C. The running buffer was 25 mM Tris, 192 mMglycine, 0.1% SDS, pH 8.3. The gels were fixed overnight in 50% methanol, 10%acetic acid. The gels were stained with Pro Q Diamond stain, followed by Syproruby gel stain (Molecular Probes, Eugene, OR), according to the manufacturer’sprotocol. The gels were imaged either on a Fuji FLA-5100 laser scanner or aPerkin Elmer ProXpress proteomics imaging system.

Forty-five nuclear extracts from mock-, P2-, and P18-infected cells at 2 h, 4 h,8 h, 12 h, and 16 h in triplicate were prepared for 2D electrophoresis. However,five samples had insufficient protein for 2D analysis. This led to the exclusion ofthe 12-h time point from further analysis. The 40 2D gels were analyzed by usingProgenesis Discovery software, version 2005 (Nonlinear Dynamics Ltd., New-castle upon Tyne, United Kingdom). The software automatically detects spots oneach gel based upon a proprietary algorithm. Spot filtering and editing is thenmanually performed to remove those spots whose intensity values are insufficientfor identification via mass spectrometry. Average gels were created from the fourgels of each type of treatment, and the maximum number of gels where the spotsmay be absent was one in four. The automatic matching of spots between the gelswas manually reviewed and adjusted as necessary. Due to the large number ofgels in this experiment, the analysis for each time point was performed separatelyfor all the conditions to ensure that the maximum number of spots were accu-rately matched between gels and conditions. Normalization of spot volumes wasthen performed on the gels based on total spot volume for each gel. The ratio ofnormalized spot volumes was then calculated across all relevant average gels.

Spots for subsequent identification were selected based upon a relative abun-dance of more than twofold. The protein gel spots were excised and prepared formatrix-assisted laser desorption ionization (MALDI) MS-MS analysis by usingProPic and ProPrep robotic instruments (Genomic Solutions, Ann Arbor, MI),following the manufacturer’s protocols. Briefly, dried gel pieces were incubatedwith 20 �g/ml trypsin (Promega, Madison WI) in 25 mM ammonium bicarbon-ate, pH 8.0, at 37°C for 4 h. The peptide solution is drawn through a ZipTip bythe ProPrep robot, and the peptides eluted with 50% acetonitrile–water contain-ing �-cyano-cinnapinic acid and spotted onto an MALDI plate for MS analysis.

MS. MALDI–tandem time-of-flight (TOF-TOF) MS on an Applied Biosys-tems 4800 MALDI TOF/TOF proteomics analyzer (Foster City, CA) was used toanalyze the samples and determine protein identification. The Applied Biosys-tems software package included 4000 series Explorer (version 3.6 RC1) withOracle database schema version (version 3.19.0) and data version (3.80.0) toacquire both MS and MS-MS spectral data. The instrument was operated inpositive ion reflectron mode, the mass range was 850 to 3,000 Da, and the focusmass was at 1,700 Da. For MS data, 1,000 to 2,000 laser shots were acquired andaveraged from each sample spot. Automatic external calibration was performedby using a peptide mixture with reference masses of 904.468, 1,296.685,1,570.677, and 2,465.199 Da.

Following MALDI MS analysis, MALDI MS-MS was performed on several(4–9) abundant ions from each sample spot. A 1-kV positive-ion MS-MS methodwas used to acquire data under post-source decay conditions. The instrumentprecursor selection window was �3 Da. For MS-MS data, 2,000 laser shots wereacquired and averaged from each sample spot. Automatic external calibrationwas performed by using reference fragment masses of 175.120, 480.257, 684.347,1,056.475, and 1,441.635 Da (from a precursor mass of 1,570.700 Da).

688 BOWICK ET AL. J. VIROL.

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

Applied Biosystems GPS Explorer (version 3.6) software was used in conjunc-tion with MASCOT to search the respective protein databases using both MSand MS-MS spectral data for protein identification. Protein match probabilitieswere determined by using expectation values and/or MASCOT protein scores.MS peak filtering included the following parameters: mass range, 800 Da to 4,000Da; minimum signal/noise filter � 10; mass exclusion list tolerance � 0.5 Da; andthe mass exclusion list (for some trypsin- and keratin-containing compounds)included masses of 842.51, 870.45, 1,045.56, 1,179.60, 1,277.71, 1,475.79, and2,211.1. For MS-MS peak filtering, the minimum signal/noise filter was 10.

For protein identification, the mouse taxonomy was searched in either themouse NCBI or SwissProt database. Other selection parameters included thefollowing: enzyme as trypsin; maximum missed cleavages � 1; fixed modificationsincluded carbamidomethyl (C) for 2D-gel analyses only; variable modificationsincluded oxidation (M); precursor tolerance was set at 0.2 Da; MS-MS fragmenttolerance was set at 0.3 Da; mass � monoisotopic; and peptide charges were onlyconsidered as �1. The significance of a protein match, based on both the peptidemass fingerprint in the first MS and the MS-MS data from several precursor ions,is based on expectation values; each protein match is accompanied by an expec-tation value. The expectation value is the number of matches with equal or betterscores that are expected to occur by chance alone. The default significancethreshold is a P value of 0.05, so an expectation value of 0.05 is considered tobe on this threshold. We used a more-stringent threshold of 10�3 for proteinidentification; the lower the expectation value, the more significant the score.

Student’s t test significance testing was not performed on these protein spotsfor multiple reasons. First, our sample size was small; we had either three or fourreplicates for each protein spot, so the statistics of such a small sample size wasunderpowered for this study. Second, the outline shape of the same protein spotas defined by the Progenesis software varied from one 2D gel to the next, furthercomplicating statistical comparison.

Ingenuity pathway analysis. The Ingenuity pathway analysis software (IPA)tool has been described in detail previously (11). Briefly, IPA consists of a large,manually curated knowledge base of cellular interactions and regulatory eventsmined from the peer-reviewed literature. An experimental data set can be usedto query this knowledge base, and IPA will construct functional signaling net-works based on known interactions within the knowledge base. The software usesFisher’s exact test to assign a statistical score of the probability that these in siliconetworks could be generated by chance. For our studies, a score of 5 (P � 10�5)was used as the cutoff for significance. Networks were constructed using theIngenuity knowledge base as the reference set.

Electrophoretic mobility shift assay. The following single-stranded oligonu-cleotides were synthesized by BioSynthesis, Inc. (Lewisville, TX): DRAX, CCTAGCAACAGATGCGTCATCTCAAAA, and DPBX, CCTAGTGAGCAATGACTGATACAAAGC. Duplex oligonucleotides were annealed at 1.75 �M in 10mM Tris-HCl (pH 7.6), 2 mM MgCl2, 50 mM NaCl, 1 mM EDTA by heating to95°C and cooled slowly. Probes were labeled with -32P by using T4 polynucle-otide kinase (Promega, Madison, WI) under standard reaction conditions. A5-�g amount of nuclear extract was incubated with 0.1 pmol of labeled oligonu-cleotide probe in a 15-�l volume for 15 min under standard reaction conditions[20 mM HEPES (pH 7.5), 50 mM KCl, 2.5 mM MgCl2, 20 mM dithiothreitol,10% glycerol with 0.5 �g poly(dI-C) per ml]. Samples were then resolved byelectrophoresis on a standard 6% acrylamide gel in 0.25� Tris-borate-EDTA.The gels were then dried and imaged on a Packard Instant Imager and byexposure to Autorad film (ISC Bioexpress, Kaysville, UT).

Flow cytometry. P388D1 cells were cultured in six-well plates and mock in-fected or infected with P2 or P18 PICV for 24 h. Cells were then harvested andwashed in fluorescence-activated cell-sorting buffer (phosphate-buffered salineplus 0.05% sodium azide, 0.5% bovine serum albumin, and 2% fetal bovineserum). Cells were stained with anti-major histocompatibility complex II (MHC-II) conjugated to fluorescein isothiocyanate (eBioscience, San Diego, CA),washed three times in fluorescence-activated cell-sorting buffer, and analyzed byusing a BD Canto flow cytometer (BD Biosciences, San Jose, CA). Data wereanalyzed by using FCS Express (De Novo Software, Los Angeles, CA).

RESULTS

Analysis of 2D-gel electrophoresis. Cell extracts from mock-infected or PICV P2 or P18 variant-infected P388D1 cells fromtriplicate cultures were prepared at 2, 4, 8, 12, and 16 h postin-fection. While cell extracts from infected guinea pigs wouldhave been preferable, the large amount of protein required forthis study (milligram quantities) meant that in vitro infections

were required. Additionally, at the time of this study theguinea pig genome had not been sequenced and so proteinscould not be definitively identified by MS-MS peptide sequenc-ing. Although mice infected with PICV do not exhibit symp-toms, our previous studies have shown that murine cells in-fected in vitro exhibit similar responses in the signalingpathways that we have compared with those of cells fromprimary guinea pig macrophages, support viral replication, andshow significant differences in their responses to P2 and P18infections (8, 9, 24). Samples were resolved by 2D electro-phoresis; triplicate gels were run per sample. There was insuf-ficient protein in the 12-h samples to run triplicate gels, and sothis time point was excluded from further analyses. Spots wereconsidered to be up- or downregulated if the difference wasseen on duplicate gels and was greater than twofold. A sum-mary of the changes identified is shown in Fig. 1. As can beseen, infection with the P18 variant induced fewer total differ-ences from mock infection than infection with the attenuatedP2 variant at all time points, although P18 did induce moredownregulation at 4 and 8 h postinfection. This finding isconsistent with the results of our previous kinomics study,which showed significantly more-complex signaling networksinduced during attenuated P2 infection in vivo (9). Of partic-ular interest is the finding that the disparity between P2- andP18-induced changes is greatest at the earliest time point (2 h).This is consistent with our hypothesis that critical events earlyin infection are likely to be of key importance in determiningthe host’s fate. Figure 1 also shows that there is a greaternumber of differences between P2 and P18 infections thanbetween infection with either virus variant and mock infectionat 2, 4, and 8 h postinfection. This result shows that, despitehaving very few genetic differences (72), the P2 and P18 vari-ants of PICV produce strikingly different host responses.

Another point of interest is the difference in the number ofproteins which show expression or modification changes fol-lowing P2 or P18 infection. For example, at 2 h postinfection,the P2 variant induces an approximately equivalent number ofupregulated and downregulated proteins; in contrast, P18 in-fection induces mainly upregulation of proteins. At 4 h postin-fection, the cellular response to both P2 and P18 infectionappears to predominantly involve upregulation of host pro-teins. By 8 h postinfection, the pattern is very different, with P2infection resulting in a predominant upregulation of cellularproteins, similar to P18 at 2 h postinfection, and with P18exhibiting a majority of downregulated events. By 16 h postin-fection, both viruses produce a broadly similar response, withthe vast majority of protein level changes being upregulation;accordingly, at this time point there are few significant proteinlevel differences between P2 and P18 infections.

Spot identification by MS-MS. We next attempted to iden-tify the proteins which showed differential expression betweeninfections. We selected 190 spots for sequencing usingMALDI-TOF-TOF MS-MS. This number included all of thespots that showed differential expression in P2 and P18 infec-tions at all time points (118 spots) and the spots which showedthe greatest increases or were present/absent between mock,P2, and P18 infections. A summary of all significant spot iden-tifications (expectation value of 10�3 and/or protein score of�53) for all treatments and time points is shown in Table S1 inthe supplemental material. As can be seen there, the majority

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 689

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

of proteins identified with high confidence are members of thehnRNP family. Additionally, other key cellular proteins likelyto be important in the cellular response to infection, includingproteins involved in energy production and several heat shockproteins, were also identified. Figure 2 shows representativegels showing identified proteins from mock- and P2-infectedcells. Unfortunately, a significant number of proteins se-quenced were not identified with significant confidence scoresor expectation values. We hypothesize that this was in part dueto protein degradation due to the extensive time taken toperform the appropriate image warping and spot-matchinganalysis on the large number of gels used in this study.

Construction of functional signaling networks. Due to thesmall number of proteins identified with high confidence ineach comparison at each time point, the proteins identified foreach comparison (mock- versus P2-infected cells, mock- versusP18-infected cells, and P2- versus P18-infected cells) at all timepoints were combined into a single data set using theSwissPROT accession number (http://www.expasy.org/sprot/)and severalfold-change value. Protein pathways that met thesignificance threshold were merged to produce the networksshown in Fig. 3.

Analysis of the mock versus P2 data set produced one sig-nificant (score of 39) network with protein functions related tolipid metabolism, molecular transport, and small-molecule bio-chemistry (Fig. 3a). Interestingly, the in silico-created networkincorporated the cystic fibrosis transporter protein, which we

have previously shown by kinome analysis to be involved inPICV-induced networks (9). The network also included theFos proto-oncogene, included in our earlier networks con-structed by high-throughput immunoblotting (8), the heat-shock protein 70 complex, and the transcriptional regulatorCCAAT-enhancer binding protein alpha. The mock versus P18data set produced a significant network (score of 30), shown inFig. 3b, with protein roles in cellular assembly and organiza-tion, carbohydrate metabolism, cell signaling, and energy me-tabolism. As can be seen, there is a discrete, highly intercon-nected subnetwork involved in energy production and another,broader network, which shows a lower degree of interconnec-tivity, including the proto-oncogene c-Myc, previously identi-fied in our kinome assay, and an hnRNP family member whichcan function as a transcription factor, hnRNP K.

As characterizing the pathogenesis-associated differencesbetween P2 and P18 infections was the main aim of this study,all P2 versus P18 differences were sequenced. Thus, the dataset constructed from the P2 versus P18 differences was consid-erably larger than that produced from data from infection witheither virus compared to mock infection. Analysis of these dataproduced three significant networks (scores of 25, 25, and 13)which were merged to produce an integrated signaling network(Fig. 3c). As with the network produced for mock versus P18infection, discrete subnetworks were observed, with roles inenergy metabolism, carbohydrate metabolism, and moleculartransport. As with previous analyses, comparison of the P2-

FIG. 1. Summary of protein level changes over time following infection with P2 or P18 PICV. All up- and downregulated spots with a twofoldor greater difference which were identified in duplicate or triplicate gels were tallied for each time point. Spots which were present or absent inone gel were recorded as upregulated or downregulated, respectively. Comparisons refer to the observation for the virus-infected sample or, in thecase of P2 versus P18, for the P2-infected sample; M refers to mock infection. The y axis shows the number of �twofold differences. Individualprotein changes can be found in Table S1 in the supplemental material. v, versus; hpi, hours postinfection.

690 BOWICK ET AL. J. VIROL.

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

and P18-induced proteomes produced signaling networkswhich included central nodes, such as c-Myc and c-Fos. Thetranscription factor SP1, previously shown to be differentiallyactivated in P2 and P18 infections (9), is also a central, highlyinterconnected node in this analysis. The hnRNP K proteinshows a high level of interconnectivity in this network. Inter-estingly, the nucleolar phosphoprotein nucleophosmin is incor-porated into this network. Nucleophosmin has been shown tobe an NF-�B coactivator (21, 40), suggesting a further mech-anism for NF-�B regulation, consistent with the results of ourearlier studies in which we identified differential NF-�B activ-ity in P2 and P18 infections (24). Several other proteins iden-

tified in these networks, such as the insulin receptor (INSR)and annexin A2 (ANXA2), were found in our earlier networkanalyses.

We next looked at the functional roles of the differentiallyexpressed/modified proteins in order to better understandthe potential roles of these proteins in disease. Figure 4shows significance scores of how these proteins map toknown functional processes and diseases. The histogramrepresents a significance score, indicating the number ofproteins which correspond to the particular process ratherthan an indication of activity. Both P2 and P18 infection ledto significant changes in proteins involved in carbohydrate

FIG. 2. Representative gels showing proteins identified by MS-MS following 2D-PAGE. 2D electrophoresis was performed in triplicate onnuclear extracts from mock-, P2-, and P18-infected cells harvested at various times postinfection. Expression changes of proteins which showed�twofold differences between treatments in two or three of the gels were considered significant. One hundred ninety spots were selected forprotein identification by MS-MS. The figure shows representative gels from mock- and P2-infected samples. The spots which were identified ashaving an expectation threshold of 10�6 are annotated. The proteins shown here correspond to the first two sections in Table S1 in thesupplemental material. Boxed numbers are the spot identification numbers allocated by the software.

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 691

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

692

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

metabolism, energy production, cell signaling, and RNAtrafficking compared to the results for mock infection. Ofinterest is the increased number of proteins induced by P2that are involved in amino acid metabolism and proteindegradation, folding, and synthesis. Consistent with the dis-ease’s pathology, a significant number of proteins with rolesin hepatic-system disease, immune development, responseand disease, and inflammatory disease are also differentiallyexpressed in P2 and P18 infections. These functions cen-tered on HSPD1/Hsp60 (downregulated in P2), HSPA5/78-kDa glucose-regulated protein (upregulated in P2), andhnRNP A2/B1 (all spots downregulated in P2).

Cytoplasmic shuttling of hnRNP proteins. As the majorityof the spots we identified were hnRNP family members (rep-resentative gels are shown in Fig. 5) and these spots showeddifferential expression between infections, we further investi-gated the subcellular location of these proteins during timecourses of infections by nuclear/cytoplasmic fractionation ofinfected cells and detection of hnRNP A2/B1 by immunoblot-ting (Fig. 6). Of particular interest is the observation that at 2 hpostinfection, hnRNP A2/B1 is nuclear in mock- and P18-infected cells, whereas the protein localizes to the cytoplasmfollowing infection with the attenuated P2 variant. At laterstages of infection, P2 and P18 induce similar patterns ofhnRNP A2/B1 expression and localization. Similar nuclear lo-calization and expression was observed for hnRNP A1 (datanot shown). These results are consistent with many of ourprevious data showing that P18-infected cells resemble mock-infected cells at early times postinfection, suggesting a failureto activate and/or active suppression of host cell responses.

Differential activity of XBP-1. Network analysis of proteinswhich showed differential expression in P2 and P18 infections(Fig. 3c) implicated the transcription factor X-box bindingprotein 1 (XBP-1), a transcription factor involved in transac-tivating the MHC-II promoter. XBP-1 is a leucine zipper pro-tein and is structurally similar to the AP-1 members c-Fos andc-Jun (41). To further investigate the role of this protein inPICV infection, nuclear extracts were prepared from P2- andP18-infected cells at 4 and 16 h postinfection and used to assaydifferences in binding to two probes previously characterizedas XBP-1 binding sites (53). Differential binding was assayedby mobility shift assay (Fig. 7a). For both probes, P2 infectioninduced increased binding of the upper band (marked) at 4 hpostinfection compared to the levels of binding induced bymock and P18 infections. By 16 h postinfection, both P2 andP18 led to increased levels of binding of the upper band.

To determine whether these changes in MHC-II promoterbinding led to a change in the surface expression of MHC-II,cells were mock infected or infected with P2 or P18 PICV for12 or 48 h, and the levels of surface expression of MHC-II weredetermined by flow cytometry. Figure 7b shows an increase in

MHC-II type I-Ek induced by P2 infection by 12 h compared tothe levels induced by mock and P18 infections (median fluo-rescence intensity of 2,876, compared to 1,920 and 1,737 formock and P18 infections, respectively). By 48 h, infection withP18 induces a striking increase in the surface expression ofMHC-II, with P2 also inducing increased expression, with amore-heterogeneous population of MHC-II upregulation asshown by the wider distribution following staining with bothMHC-II antibodies. These results correlate with the earlychange in XBP-1 binding induced by P2 infection, consistentwith the early increase in MHC-II expression induced by P2infection.

DISCUSSION

In this report, we have investigated the host response toattenuated and virulent arenavirus infection using 2D electro-phoresis of the nuclear proteome and MS-MS. We have iden-tified with high confidence proteins which show differentialexpression or modification in three classes of pairwise compar-ison and over a time course of infection. By using pathwayanalysis, we have illustrated how these identified proteins maybe involved in functional signaling networks. While our proteinidentification revealed a number of proteins which are canon-ically cytoplasmic, many of the proteins, such as ATP synthase(ATP5A) or EIF5A, can also be found in the nucleus or itsmembrane. Additionally, we cannot rule out contamination ofthe nuclear fraction with mitochondrial proteins or newly syn-thesized proteins on the rough endoplasmic reticulum. How-ever, the comparative nature of this study and the fact that allsamples were treated identically may mean that any changes incontaminating proteins are indicative of the changes in theirlevels in infected cells. Pursuant to this is the large number ofproteins involved in energy metabolism which showed signifi-cant increases following infection; this finding is consistentwith cells increasing energy production in response to chal-lenge, a result also seen following inflammatory responses in-duced by lipopolysaccharide treatment (11).

A finding of particular interest and a result which shows anintrinsic advantage of nonbiased, global approaches in under-standing virus-host interactions is the identification of severalproteins, which are not often studied in this field, which mayprove to be of importance in furthering our understanding ofviral pathogenesis. In this study, we have identified severalproteins involved in regulating NF-�B activity and the inflam-matory response, a central component in hemorrhagic-feverpathogenesis.

One group of proteins which may play a central role in regu-lating the inflammatory response in arenavirus infections are the70-kDa heat shock proteins (HSP70). We have previously iden-tified the HSP70 HSPA5 protein as downregulated following in-

FIG. 3. Pathway analysis reveals protein networks and key “hubs” of interaction. Significant proteins identified at all time points for eachcomparison were uploaded to the Ingenuity pathway analysis software using SwissPROT identifiers. Networks which met the cutoff threshold (scoreof �5) were merged to form the interaction networks shown. Proteins shown backed by gray symbols are those which were present in the data set,and proteins backed by white symbols were included in the networks on the basis of known interactions. Shaded regions highlight the subnetworksof interaction within each global network. Proteins in shaded regions are those directly identified from differentially expressed spots, and proteinsin unshaded regions are those brought into the networks on the basis of known interactions mined from the literature. The networks are describedin Results. (a) Mock versus P2. (b) Mock versus P18. (c) P2 versus P18.

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 693

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

FIG. 4. Functional significance of identified proteins. The Ingenuity pathway analysis software was used to perform a comparison analysison the proteins that were differentially expressed/modified in P2- or P18-infected cells compared to their levels in mock-infected cells. Theseproteins are assigned roles in functional and disease processes on the basis of published reports. The bar represents the statisticalinvolvement of proteins in these processes rather than an increase or decrease in process activity. The dashed line indicates the thresholdof statistical significance.

694

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

fection with PICV P2 (8); our kinomics analysis showed that thepeptide corresponded to the phosphorylation sequence of theHSP70 homologue in Escherichia coli (9). This finding demon-strates that the kinase(s) upstream of HSP70 in guinea pig mac-rophages are active and capable of phosphorylating their targetsite. A recent study by Djavani et al. has shown by using microar-ray analysis that a number of HSP family mRNAs are differen-tially transcribed during LCMV infection (22). Interestingly, in-fection with both the virulent WE and attenuated ArmstrongLCMV strains led to 2- to 3.5-fold reductions in HSPA8 transcriptlevels. While this correlates with the decrease in protein levelsseen following P2 infection in our previous report, it does notcorrelate with the lack of HSP70 protein reduction following P18

FIG. 5. Example of differential hnRNP expression in P2- and mock-infected cells. Representative gels showing differences in hnRNP expres-sion. The spots found to be hnRNP family members in the 2-h-time-point gels were identified with the Progenesis software. The spots shown inthe figure correspond to the hnRNP proteins shown in the 2-h section of Table S1 in the supplemental material.

FIG. 6. hnRNP proteins show differential subcellular locations inP2- and P18-infected cells. P388D1 cells were mock (M), P2, or P18infected in triplicate, and nuclear and cytoplasmic extracts prepared atvarious times postinfection. Samples were denatured in SDS-contain-ing buffer and resolved by PAGE. Samples were immunoblotted withantibodies against hnRNP A1 and hnRNP A2/B1.

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 695

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

infection in this assay. There are a number of explanations for thisobservation. First, this could be due to the differences between acell culture system and an animal model or a difference betweenthe PICV and LCMV virus effects on the host cell. Anotherpossible reason could be differences between transcriptional andtranslational regulation or a change in protein half-life and turn-over.

The increased levels of HSPA8 following P2 infection pre-sented in this report may seem to contradict our earlier reportand that of Djavani et al. (22) which show decreases in bothtranscript and protein levels. However, as this study was per-formed on nuclear extracts, the increase in nuclear HSPA8 isindicative of activation (20, 36, 38), which is regulated by phos-phorylation, resulting in nuclear translocation of the protein(14). Nuclear translocation of HSP70 has also been shown tobe induced early following cytomegalovirus infection (50).HSP70 activation has been shown to have an anti-inflamma-tory effect. In cells in which HSP70 was activated prior totumor necrosis factor alpha (TNF-�) treatment, NF-�B nu-clear translocation and DNA binding were blocked, concomi-tant with a stabilization of I�B (71). The proteins describedabove are all involved in regulating NF-�B activation. As wehave previously shown, NF-�B is differentially active in P2 andP18 infections (24). This observation, coupled with the factthat NF-�B is a central regulator of the immune response,makes this pathway a key target for therapeutic modulation. Asthis pathway has been extensively studied due to its role in anumber of disease pathologies which are mediated by inflam-

mation, a number of pharmacological agents have already beenidentified and may prove to be important in developing immu-nomodulatory treatments for infectious diseases. Figure 8 sum-marizes the results discussed above and illustrates how theproteins described may act to regulate NF-�B activity.

Several other proteins identified may play additional roles inregulating inflammation. Valosin-containing protein (VCP)has been identified as a target of Akt (68), identified as a keysignaling node in our earlier global analyses. A small interfer-ing RNA knockdown of VCP was shown to inhibit NF-�Bactivation following growth factor stimulation (68); addition-ally, VCP has been shown to be a multiubiquitin chain-target-ing factor and targets the ubiquitinated form of I�B, the in-hibitor of NF-�B, to the proteasome for degradation (18, 19).VCP may also play a role in the apoptotic pathway induced byendoplasmic reticular stress (57). The transcriptional regulatorCREB-binding protein 3-like 1 (CREB3L1), identified in theP2 versus P18 network, may also be involved in NF-�B regu-lation via its regulation of HSPA5. HSPA5 can inhibit theformation of the HSP90/glucocorticoid receptor complex, re-quired for steroid binding (32) which leads to suppression ofthe inflammatory response via inhibition of NF-�B-mediatedtransactivation (10, 60). The glucocorticoid receptor (NR3C1)is also implicated in the mock infection versus P18 network,further suggesting a role for this protein in pathogenesis. OtherCREB family proteins have also been shown to play a role inNF-�B signaling and the inflammatory response. The pleiotro-pic cytokine interleukin-6 (IL-6), important in the production

FIG. 7. P2 and P18 infection induced differential XBP-1 binding to DNA and MHC-II surface expression. (a) Nuclear extracts from mock-, P2-,and P18-infected cells were harvested at 4 and 16 h postinfection and assayed by gel shift assay for their ability to bind two MHC-II promoterelements. Probes DRAX and DPBX are described in Materials and Methods. M, mock infection. (b) Surface expression of MHC-II on mock-, P2-,or P18-infected macrophages was assayed at 12 and 48 h postinfection by flow cytometry.

696 BOWICK ET AL. J. VIROL.

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

of acute-phase proteins, is transactivated by NF-�B, which issufficient for transactivation in response to TNF-� stimulation;however, maximal transactivation requires association with theCREB family protein CREBBP (CREBBP/CBP or CBP/p300)(67). Interestingly, CREBBP/p300 has been shown to play animportant role in modulating the glucocorticoid receptor andin the NF-�B antagonism (48, 49) described above. The per-oxisome proliferator-activated receptor (PPAR) family pro-teins are involved in regulating the NF-�B pathway. PPAR isshown in the P2 versus P18 network. Interestingly, our previousstudy identified a differential significance for PPAR signalingbetween P2 and P18 infections in vivo (9). PPAR has beenshown to be involved in the inhibition of NF-�B activity bybutyrate (61) and in reducing the nuclear translocation of p65in response to IL-1 and gamma interferon treatment by inhib-iting the degradation of I�B-� (35). The role of the PPARpathway in infection requires further investigation since a

more-complete understanding of the regulation of NF-�B ininfection and its role in pathogenesis may be of critical impor-tance in terms of developing therapeutics which act at the levelof host response modulation.

An interesting finding of this study was the inclusion of thetranscription factor XBP-1 in our signaling networks. Thistranscription factor is involved in the transactivation of theMHC-II promoter. Downregulation of surface MHC-II ondendritic cells has previously been reported, with a virulentvariant of LCMV leading to a significant reduction in MHC-IIexpression compared to the levels of expression of dendriticcells infected with an attenuated variant or mock infected (63,64). Our data show an increase in surface expression ofMHC-II following PICV infection of murine macrophages andalso show differential DNA-binding activity of a transcriptionfactor involved in MHC-II expression. The difference betweenthese findings may be due to differences between macrophageand dendritic-cell responses, the difference in cell type used forthe study, differential effects of PICV and LCMV infections onhost immune signaling, or differences due to high multiplicitiesof infection in in vitro infections and cells taken from infectedanimals in which only a proportion of cells are infected. Theupregulation of MHC-II late in infection may, at least in part,explain why infected mice do not exhibit disease.

Consistent with the hnRNP shuttling data presented here,the P2/P18 differences appear to be most striking early ininfection, suggesting that the initial effects of infection, such asbinding and entry, may be important in determining appropri-ate immune response development and disease outcome.These data serve to link the early molecular-signaling eventsfollowing infection with the known impairment in the adaptiveimmune response, such as is seen in LCMV infection and alsoat the level of antigen presentation (1). Now that the receptorsfor both Old World and New World hemorrhagic arenavirusesare known (12, 56), we can begin to investigate the downstreamsignaling pathways of these receptors for differential activationand which responses they induce following virus binding andduring entry.

This study identified a large number of differentially ex-pressed or modified hnRNP family members. While the factthat these proteins are abundant in the cell, particularly com-pared to proteins such as transcription factors, may mean thatwe are more likely to identify these proteins than others due tosampling effects, the fact that the differences between P2 andP18 infections are so striking means that these proteins mayhave a biologically significant role in determining pathogene-sis. This conclusion is reinforced by the discovery of hnRNPproteins in our previous assay and network analysis (8). Vali-dation of hnRNP expression by immunoblotting confirmedsignificant differences between P2 and P18 infections inhnRNP shuttling. However, the nuclear cytoplasmic shuttlingdata assayed by immunoblotting did not correlate with ourobservations from the 2D-PAGE analysis, in which we ob-served increased hnRNP A2/B1 in P2-infected cells at 2 hpostinfection; there could be a number of reasons for this, suchas the 2D results relating to highly specific posttranslationallymodified forms of the protein or different splice variants. How-ever, both assays show clear differences between the infectionsin hnRNP shuttling. Other viral systems have also been shownto induce relocalization of hnRNP proteins. Infection of cells

FIG. 8. A regulatory network for the inflammatory response. Sev-eral proteins identified in this study (described in Discussion) with aknown function in regulating the NF-�B response were used to con-struct a potential regulatory network for NF-�B. Grids next to theproteins indicate nuclear protein and transcriptome expression differ-ences characterized in this study and that of Djavani et al. (22). Theupper row of each box indicates changes in levels of nuclear proteinsin this study, and the lower row transcriptional expression changes inLCMV-infected macaques in the study of Djavani et al.; red indicatesupregulation, and green indicates downregulation. The columns rep-resent, from left to right, mock versus attenuated infection, mockversus severe infection, and attenuated versus severe infection withPICV P2 and P18 in our study and LCMV Armstrong and WE in thetranscriptome study. CREB3L1, cyclic-AMP-responsive element bind-ing protein 3-like 1; VCP, valosin-containing protein; HSPA5, 78-kDaglucose-regulated protein precursor (heat shock 70-kDa protein 5);PPARG, peroxisome proliferative activated receptor gamma; NR3C1,nuclear receptor subfamily 3 group C member 1; CREBBP, CREBbinding protein; Hsp70, heat shock protein 70 (group); NFKBIA,nuclear factor �B inhibitor � (I�B-�); RELA, NF-�B p65 subunit.Solid lines indicate direct interactions between proteins, broken linesindicate an indirect interaction, an ellipse represents a transcriptionalregulator, a rectangle represents a ligand-dependent nuclear receptor,a diamond represents an enzyme, concentric circles represent a groupor complex, and a single circle represents other functions.

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 697

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

with poliovirus has been shown to cause redistribution of thehnRNPs A1 and K from the nucleus to the cytoplasm (30).Additionally, this study showed that this relocalization was adirect effect of virus infection, rather than simply an indirecteffect of transcriptional-repression-induced hnRNP cytoplas-mic accumulation (55) mediated by poliovirus 3C proteasecleavage of the cellular TATA-binding protein (15). Herpessimplex virus infection has also been shown to induce changesin hnRNP distribution within the nucleus, with the hnRNPmoving from a diffuse nuclear distribution to a punctate stain-ing pattern following infection (44).

hnRNPs can also bind and/or directly regulate viral RNAs. Forexample, hnRNP A1 has been shown to bind to the transcription-regulatory region of mouse hepatitis virus RNA (39) and regulateRNA synthesis (65). Additionally, hnRNP A1 is able to binddirectly to the mouse hepatitis virus nucleocapsid protein (70).More recently, it was shown that multiple A/B hnRNPs can re-place hnRNP A1 in mouse hepatitis virus RNA synthesis (66).Human immunodeficiency virus type 1 RNA trafficking is medi-ated by hnRNP A2, and it has also been shown that the imme-diate early gene 2 protein of human cytomegalovirus interactswith hnRNP A1. These studies, in addition to the identified rolesfor hnRNPs as transcription factors, suggest a number of ways inwhich hnRNPs could be involved in arenavirus infection. Furtherexperiments will be required to define the role hnRNP proteinsare playing in arenavirus infection and whether the functionaleffects of hnRNPs may be implicated in the differential pathogen-esis of these viruses.

We have previously shown that the thioaptamer XBY-S2 isable to protect guinea pigs from lethal PICV infection (25).Interestingly, when XBY-S2 was used in a novel sandwichassay (69), it was also able to bind the hnRNP proteins A1,A2/B1, A3, A/B, and D0. The hnRNP A1 protein has beenshown to be involved in regulating the NF-�B pathway bybinding to I�B-� (31), suggesting a further mechanism bywhich hnRNPs may be important in mediating the host re-sponse to infection. While this may be an artifact due to therelative abundance of hnRNP proteins, we cannot exclude thepossibility that this thioaptamer may act, if only in part, bybinding to and modulating the function of hnRNP proteins.

This study suggests that hnRNPs are highly likely to be involvedin partially determining the pathogenesis of PICV infection. Dueto the involvement of hnRNPs in a number of viral infections,continued investigation of the role of hnRNPs in viral replicationand pathogenesis may prove to be of key importance in thedevelopment of novel therapeutic approaches, as well as furtherour understanding of the complex, multifunctional role these pro-teins play in the molecular biology of the cell. In addition, thisreport has identified a number of proteins, differentially ex-pressed in attenuated and virulent infections, which are associ-ated with the regulation of the inflammatory response. Theseproteins, and the pathways in which they act, require furtherinvestigation to clearly determine their role in infection and todefine targets for therapeutic modulation.

Lassa fever is often characterized by a delay in the produc-tion of antibody (34, 54), suggestive of an inhibition of the earlyinnate responses that are required to develop an effectiveadaptive response. Consistent with this is the observation thatthe infection of macrophages with Lassa virus does not induceTNF-� expression and inhibits TNF-� production following

lipopolysaccharide stimulation, whereas infection with the ap-athogenic Mopeia virus does not (43). This could be explainedby an inhibition of NF-�B activation by virulent arenaviruses,as we have previously shown for PICV (24). Inhibition ofIRF-3 has been reported for LCMV (45), providing anothermechanism for inhibition of an innate immune signaling path-way. In this study, we have identified differential expression ofnucleophosmin. This protein has been shown to inhibit PKRactivity (28), CXCR4-mediated chemotaxis (73), and DNAbinding of IRF-1 (37). IRF-1 is implicated in the control ofnumerous cellular genes with important roles in establishingearly immune responses and mediating apoptosis, such as typeI interferons, the TAP transporter, Fas ligand, caspases, IL-1,IL-8, IL-12, STAT 1 and 2, and 2�-5�-oligoadenylate syn-thetase. Modulation of the expression of these genes wouldhave a profound effect on the development of the immuneresponse and could, in combination with the other reportedinhibitory effects, be a critical mechanism for establishing apathogenic infection. Experiments are currently in progress tofurther characterize and define the role of nucleophosmin inarenavirus infection.

Interestingly, nucleophosmin, XBP-1, NF-�B p65 (previouslyshown to be perturbed by virulent arenavirus infection) (24), andIRF-1 have been implicated in a hormone response network (75).Transcriptional analysis of peripheral blood mononuclear cellsfrom macaques infected with LCMV also identified changes inhormone response genes (22). Dysregulation of endocrine func-tion has been reported for persistent LCMV infection followingviral infection of the pituitary and inhibition of growth hormone(GH) production (51, 52). GH and gamma-aminobutyric acidhave been shown to act in an autocrine fashion to regulate GHexpression (27, 46, 74). Modulation of the responses to thesehormones could be a mechanism for the reduction of GH seen inpersistent LCMV infection. Given that hormone response net-works have now been implicated at the genomic and proteomiclevel and nucleophosmin additionally identified at the kinomicslevel (9), further investigation of hormone response dysfunctionand of the role of nucleophosmin in acute arenavirus disease isrequired.

We are now beginning to define arenavirus interactions withthe host cell at a number of different levels, from the phos-phoproteomic to the genomic. Further analysis of these data-sets in combination will reveal how these pathways are regu-lated and how arenavirus infection modulates host responsesto infection. This will allow future experiments to clearly definenot only potential diagnostic and prognostic biomarker signa-tures but also key determinants of viral pathogenesis. As webegin to construct functional signaling networks and map vi-rus-induced perturbations, we can begin to link these molecu-lar changes to disease pathology at the tissue level and the levelof the whole organism. This may identify novel targets fortherapeutic intervention, particularly novel immunotherapieswhich aim to restore the functions inhibited by viral proteins.

ACKNOWLEDGMENTS

We acknowledge Barry Elsom for technical assistance and SusanStafford, Zheng Wu, and Robert English of the Biomolecular Re-source Facility at UTMB for assistance with the 2D gels and proteinidentification.

This work was supported by grants from the NIH (UO1 AI05487and R01 A127744) and by a grant to N.K.H. through the Western

698 BOWICK ET AL. J. VIROL.

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

Regional Center for Excellence for Biodefense and Emerging Infec-tious Disease Research (NIH grant number U54 AI057156).

D.G.G. and B.A.L. declare financial interests in AM Biotechnolo-gies and AptaMed, UTMB spin-off companies involved in thioaptamertechnologies, including those using thioaptamer XBY-S2.

REFERENCES

1. Althage, A., B. Odermatt, D. Moskophidis, T. Kundig, U. Hoffman-Rohrer,H. Hengartner, and R. M. Zinkernagel. 1992. Immunosuppression by lym-phocytic choriomeningitis virus infection: competent effector T and B cellsbut impaired antigen presentation. Eur. J. Immunol. 22:1803–1812.

2. Amlie-Lefond, C., D. A. Paz, M. P. Connelly, G. B. Huffnagle, K. S. Dunn,N. T. Whelan, and H. T. Whelan. 2005. Innate immunity for biodefense: astrategy whose time has come. J. Allergy Clin. Immunol. 116:1334–1342.

3. Amman, B. R. 2007. Pet rodents and fatal lymphocytic choriomeningitis intransplant patients. Emerg. Infect. Dis. 13:719–725.

4. Andrade, A. A., P. N. Silva, A. C. Pereira, L. P. De Sousa, P. C. Ferreira, R. T.Gazzinelli, E. G. Kroon, C. Ropert, and C. A. Bonjardim. 2004. The vacciniavirus-stimulated mitogen-activated protein kinase (MAPK) pathway is re-quired for virus multiplication. Biochem. J. 381:437–446.

5. Aronson, J. F., N. K. Herzog, and T. R. Jerrells. 1994. Pathological andvirological features of arenavirus disease in guinea-pigs: comparison of 2Pichinde virus-strains. Am. J. Pathol. 145:228–235.

6. Aronson, J. F., N. K. Herzog, and T. R. Jerrells. 1995. Tumor-necrosis-factorand the pathogenesis of Pichinde virus-infection in guinea-pigs. Am. J. Trop.Med. Hyg. 52:262–269.

7. Ben-Israel, H., and T. Kleinberger. 2002. Adenovirus and cell cycle control.Front. Biosci. 7:d1369–d1395.

8. Bowick, G. C., S. M. Fennewald, B. L. Elsom, J. F. Aronson, B. A. Luxon,D. G. Gorenstein, and N. K. Herzog. 2006. Differential signaling networksinduced by mild and lethal hemorrhagic fever virus infections. J. Virol.80:10248–10252.

9. Bowick, G. C., S. M. Fennewald, E. P. Scott, L. Zhang, B. L. Elsom, J. F.Aronson, H. M. Spratt, B. A. Luxon, D. G. Gorenstein, and N. K. Herzog.2007. Identification of differentially activated cell-signaling networks associ-ated with Pichinde virus pathogenesis by using systems kinomics. J. Virol.81:1923–1933.

10. Caldenhoven, E., J. Liden, S. Wissink, A. Van de Stolpe, J. Raaijmakers, L.Koenderman, S. Okret, J. A. Gustafsson, and P. T. Van der Saag. 1995.Negative cross-talk between RelA and the glucocorticoid receptor: a possiblemechanism for the antiinflammatory action of glucocorticoids. Mol. Endo-crinol. 9:401–412.

11. Calvano, S. E., W. Z. Xiao, D. R. Richards, R. M. Felciano, H. V. Baker, R. J.Cho, R. O. Chen, B. H. Brownstein, J. P. Cobb, S. K. Tschoeke, C. Miller-Graziano, L. L. Moldawer, M. N. Mindrinos, R. W. Davis, R. G. Tompkins,and S. F. Lowry. 2005. A network-based analysis of systemic inflammation inhumans. Nature 437:1032–1037.

12. Cao, W., M. D. Henry, P. Borrow, H. Yamada, J. H. Elder, E. V. Ravkov, S. T.Nichol, R. W. Compans, K. P. Campbell, and M. B. Oldstone. 1998. Iden-tification of alpha-dystroglycan as a receptor for lymphocytic choriomenin-gitis virus and Lassa fever virus. Science 282:2079–2081.

13. Centers for Disease Control and Prevention. 2005. Lymphocytic choriomen-ingitis virus infection in organ transplant recipients—Massachusetts, RhodeIsland, 2005. MMWR Morb. Mortal. Wkly. Rep. 54:537–539.

14. Chu, A., N. Matusiewicz, and U. Stochaj. 2001. Heat-induced nuclear accu-mulation of hsc70s is regulated by phosphorylation and inhibited in confluentcells. FASEB J. 15:1478–1480.

15. Clark, M. E., P. M. Lieberman, A. J. Berk, and A. Dasgupta. 1993. Directcleavage of human TATA-binding protein by poliovirus protease 3C in vivoand in vitro. Mol. Cell. Biol. 13:1232–1237.

16. Colle, J. H., M. F. Saron, B. Shidani, M. P. Lembezat, and P. Truffa-Bachi.1993. High frequency of T lymphocytes committed to interferon-gammatranscription upon polyclonal activation in spleen from lymphocytic chorio-meningitis virus-infected mice. Int. Immunol. 5:435–441.

17. Colle, J. H., M. F. Saron, and P. Truffa-Bachi. 1993. Altered cytokine genesexpression by conA-activated spleen cells from mice infected by lymphocyticchoriomeningitis virus. Immunol. Lett. 35:247–253.

18. Dai, R. M., E. Chen, D. L. Longo, C. M. Gorbea, and C. C. Li. 1998.Involvement of valosin-containing protein, an ATPase co-purified withIkappaBalpha and 26 S proteasome, in ubiquitin-proteasome-mediated deg-radation of IkappaBalpha. J. Biol. Chem. 273:3562–3573.

19. Dai, R. M., and C. C. Li. 2001. Valosin-containing protein is a multi-ubiq-uitin chain-targeting factor required in ubiquitin-proteasome degradation.Nat. Cell Biol. 3:740–744.

20. Dastoor, Z., and J. Dreyer. 2000. Nuclear translocation and aggregate for-mation of heat shock cognate protein 70 (Hsc70) in oxidative stress andapoptosis. J. Cell Sci. 113:2845–2854.

21. Dhar, S. K., B. C. Lynn, C. Daosukho, and D. K. St. Clair. 2004. Identifi-cation of nucleophosmin as an NF-kappaB co-activator for the induction ofthe human SOD2 gene. J. Biol. Chem. 279:28209–28219.

22. Djavani, M. M., O. R. Crasta, J. C. Zapata, Z. Fei, O. Folkerts, B. Sobral, M.

Swindells, J. Bryant, H. Davis, C. D. Pauza, I. S. Lukashevich, R. Ham-mamieh, M. Jett, and M. S. Salvato. 2007. Early blood profiles of virusinfection in a monkey model for Lassa fever. J. Virol. 81:7960–7973.

23. Dyer, R. B., and N. K. Herzog. 1995. Isolation of intact nuclei for nuclearextract preparation from a fragile B-lymphocyte cell-line. BioTechniques19:192.

24. Fennewald, S. M., J. F. Aronson, L. Zhang, and N. K. Herzog. 2002. Alter-ations in NF-�B and RBP-J� by arenavirus infection of macrophages in vitroand in vivo. J. Virol. 76:1154–1162.

25. Fennewald, S. M., E. P. Scott, L. H. Zhang, X. Yang, J. F. Aronson, D. G.Gorenstein, B. A. Luxon, R. E. Shope, D. W. C. Beasley, A. D. T. Barrett, andN. K. Herzog. 2007. Thioaptamer decoy targeting of AP-1 proteins influencescytokine gene expression and the outcome of arenavirus infections. J. Gen.Virol. 88:981–990.

26. Fischer, S. A., M. B. Graham, M. J. Kuehnert, C. N. Kotton, A. Srinivasan,F. M. Marty, J. A. Comer, J. Guarner, C. D. Paddock, D. L. DeMeo, W. J.Shieh, B. R. Erickson, U. Bandy, A. DeMaria, Jr., J. P. Davis, F. L. Del-monico, B. Pavlin, A. Likos, M. J. Vincent, T. K. Sealy, C. S. Goldsmith, D. B.Jernigan, P. E. Rollin, M. M. Packard, M. Patel, C. Rowland, R. F. Helfand,S. T. Nichol, J. A. Fishman, T. Ksiazek, and S. R. Zaki. 2006. Transmissionof lymphocytic choriomeningitis virus by organ transplantation. N. Engl.J. Med. 354:2235–2249.

27. Gamel-Didelon, K., C. Corsi, G. Pepeu, H. Jung, M. Gratzl, and A. Mayer-hofer. 2002. An autocrine role for pituitary GABA: activation of GABA-Breceptors and regulation of growth hormone levels. Neuroendocrinology76:170–177.

28. Garcia, M. A., E. F. Meurs, and M. Esteban. 2007. The dsRNA proteinkinase PKR: virus and cell control. Biochimie 89:799–811.

29. Goodbourn, S., L. Didcock, and R. E. Randall. 2000. Interferons: cell sig-nalling, immune modulation, antiviral response and virus countermeasures.J. Gen. Virol. 81:2341–2364.

30. Gustin, K. E., and P. Sarnow. 2001. Effects of poliovirus infection on nucleo-cytoplasmic trafficking and nuclear pore complex composition. EMBO J.20:240–249.

31. Hay, D. C., G. D. Kemp, C. Dargemont, and R. T. Hay. 2001. Interactionbetween hnRNPA1 and I�B� is required for maximal activation of NF-�B-dependent transcription. Mol. Cell. Biol. 21:3482–3490.

32. Hutchison, K. A., K. D. Dittmar, L. F. Stancato, and W. B. Pratt. 1996.Ability of various members of the hsp70 family of chaperones to promoteassembly of the glucocorticoid receptor into a functional heterocomplex withhsp90. J. Steroid Biochem. Mol. Biol. 58:251–258.

33. Jahrling, P. B., R. A. Hesse, J. B. Rhoderick, M. A. Elwell, and J. B. Moe.1981. Pathogenesis of a Pichinde virus strain adapted to produce lethalinfections in guinea pigs. Infect. Immun. 32:872–880.

34. Johnson, K. M., J. B. McCormick, P. A. Webb, E. S. Smith, L. H. Elliott, andI. J. King. 1987. Clinical virology of Lassa fever in hospitalized patients.J. Infect. Dis. 155:456–464.

35. Kim, E. K., K. B. Kwon, B. S. Koo, M. J. Han, M. Y. Song, E. K. Song, M. K.Han, J. W. Park, D. G. Ryu, and B. H. Park. 2007. Activation of peroxisomeproliferator-activated receptor-gamma protects pancreatic beta-cells fromcytokine-induced cytotoxicity via NF kappaB pathway. Int. J. Biochem. CellBiol. 39:1260–1275.

36. Kodiha, M., A. Chu, O. Lazrak, and U. Stochaj. 2005. Stress inhibits nucle-ocytoplasmic shuttling of heat shock protein hsc70. Am. J. Physiol. CellPhysiol. 289:C1034–C1041.

37. Kondo, T., N. Minamino, T. Nagamura-Inoue, M. Matsumoto, T. Taniguchi,and N. Tanaka. 1997. Identification and characterization of nucleophosmin/B23/numatrin which binds the anti-oncogenic transcription factor IRF-1 andmanifests oncogenic activity. Oncogene 15:1275–1281.

38. Lagunas, L., C. M. Bradbury, A. Laszlo, C. R. Hunt, and D. Gius. 2004.Indomethacin and ibuprofen induce Hsc70 nuclear localization and activa-tion of the heat shock response in HeLa cells. Biochem. Biophys. Res.Commun. 313:863–870.

39. Li, H. P., X. Zhang, R. Duncan, L. Comai, and M. M. Lai. 1997. Heteroge-neous nuclear ribonucleoprotein A1 binds to the transcription-regulatoryregion of mouse hepatitis virus RNA. Proc. Natl. Acad. Sci. USA 94:9544–9549.

40. Lin, C. Y., Y. C. Liang, and B. Y. Yung. 2006. Nucleophosmin/B23 regulatestranscriptional activation of E2F1 via modulating the promoter binding ofNF-kappaB, E2F1 and pRB. Cell. Signal. 18:2041–2048.

41. Liou, H. C., M. R. Boothby, P. W. Finn, R. Davidon, N. Nabavi, N. J.Zeleznik-Le, J. P. Ting, and L. H. Glimcher. 1990. A new member of theleucine zipper class of proteins that binds to the HLA DR alpha promoter.Science 247:1581–1584.

42. Lisowska, K., and J. M. Witkowski. 2003. Viral strategies in modulation ofNF-kappaB activity. Arch. Immunol. Ther. Exp. (Warsaw). 51:367–375.

43. Lukashevich, I. S., R. Maryankova, A. S. Vladyko, N. Nashkevich, S. Koleda,M. Djavani, D. Horejsh, N. N. Voitenok, and M. S. Salvato. 1999. Lassa andMopeia virus replication in human monocytes/macrophages and in endothe-lial cells: different effects on IL-8 and TNF-alpha gene expression. J. Med.Virol. 59:552–560.

44. Martin, T. E., S. C. Barghusen, G. P. Leser, and P. G. Spear. 1987. Redis-

VOL. 83, 2009 ARENAVIRUS-INDUCED DIFFERENTIAL PROTEOME EXPRESSION 699

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from

tribution of nuclear ribonucleoprotein antigens during herpes simplex virusinfection. J. Cell Biol. 105:2069–2082.

45. Martinez-Sobrido, L., E. I. Zuniga, D. Rosario, A. Garcia-Sastre, and J. C.de la Torre. 2006. Inhibition of the type I interferon response by the nucleo-protein of the prototypic arenavirus lymphocytic choriomeningitis virus.J. Virol. 80:9192–9199.

46. Mayerhofer, A., B. Hohne-Zell, K. Gamel-Didelon, H. Jung, P. Redecker, D.Grube, H. F. Urbanski, B. Gasnier, J. M. Fritschy, and M. Gratzl. 2001.Gamma-aminobutyric acid (GABA): a para- and/or autocrine hormone inthe pituitary. FASEB J. 15:1089–1091.

47. McCormick, J. B., I. J. King, P. A. Webb, C. L. Scribner, R. B. Craven, K. M.Johnson, L. H. Elliott, and R. Belmont-Williams. 1986. Lassa fever. Effectivetherapy with ribavirin. N. Engl. J. Med. 314:20–26.

48. McKay, L. I., and J. A. Cidlowski. 1998. Cross-talk between nuclear factor-kappa B and the steroid hormone receptors: mechanisms of mutual antag-onism. Mol. Endocrinol. 12:45–56.

49. McKay, L. I., and J. A. Cidlowski. 2000. CBP (CREB binding protein)integrates NF-kappaB (nuclear factor-kappaB) and glucocorticoid receptorphysical interactions and antagonism. Mol. Endocrinol. 14:1222–1234.

50. Ohgitani, E., K. Kobayashi, K. Takeshita, and J. Imanishi. 1999. Biphasictranslocation of a 70 kDa heat shock protein in human cytomegalovirus-infected cells. J. Gen. Virol. 80:63–68.

51. Oldstone, M. B., M. Rodriguez, W. H. Daughaday, and P. W. Lampert. 1984.Viral perturbation of endocrine function: disordered cell function leads todisturbed homeostasis and disease. Nature 307:278–281.

52. Oldstone, M. B., Y. N. Sinha, P. Blount, A. Tishon, M. Rodriguez, R. vonWedel, and P. W. Lampert. 1982. Virus-induced alterations in homeostasis:alteration in differentiated functions of infected cells in vivo. Science 218:1125–1127.

53. Ono, S. J., H. C. Liou, R. Davidon, J. L. Strominger, and L. H. Glimcher.1991. Human X-box-binding protein 1 is required for the transcription of asubset of human class II major histocompatibility genes and forms a het-erodimer with c-fos. Proc. Natl. Acad. Sci. USA 88:4309–4312.

54. Peters, C. J., C. T. Liu, G. W. Anderson, Jr., J. C. Morrill, and P. B. Jahrling.1989. Pathogenesis of viral hemorrhagic fevers: Rift Valley fever and Lassafever contrasted. Rev. Infect. Dis. 11(Suppl. 4):S743–S749.

55. Pinol-Roma, S., and G. Dreyfuss. 1991. Transcription-dependent and tran-scription-independent nuclear transport of hnRNP proteins. Science 253:312–314.

56. Radoshitzky, S. R., J. Abraham, C. F. Spiropoulou, J. H. Kuhn, D. Nguyen,W. Li, J. Nagel, P. J. Schmidt, J. H. Nunberg, N. C. Andrews, M. Farzan, andH. Choe. 2007. Transferrin receptor 1 is a cellular receptor for New Worldhaemorrhagic fever arenaviruses. Nature 446:92–96.

57. Rao, R. V., K. S. Poksay, S. Castro-Obregon, B. Schilling, R. H. Row, G. delRio, B. W. Gibson, H. M. Ellerby, and D. E. Bredesen. 2004. Molecularcomponents of a cell death pathway activated by endoplasmic reticulumstress. J. Biol. Chem. 279:177–187.

58. Richmond, J. K., and D. J. Baglole. 2003. Lassa fever: epidemiology, clinicalfeatures, and social consequences. Brit. Med. J. 327:1271–1275.

59. Saron, M. F., J. H. Colle, A. utry-Varsat, and P. Truffa-Bachi. 1991. Acti-vated T lymphocytes from mice infected by lymphocytic choriomeningitisvirus display high affinity IL-2 receptors but do not proliferate in response toIL-2. J. Immunol. 147:4333–4337.

60. Scheinman, R. I., A. Gualberto, C. M. Jewell, J. A. Cidlowski, and A. S.Baldwin, Jr. 1995. Characterization of mechanisms involved in transrepres-

sion of NF-kappa B by activated glucocorticoid receptors. Mol. Cell. Biol.15:943–953.

61. Schwab, M., V. Reynders, S. Loitsch, D. Steinhilber, J. Stein, and O. Schro-der. 2007. Involvement of different nuclear hormone receptors in butyrate-mediated inhibition of inducible NF kappa B signalling. Mol. Immunol.44:3625–3632.

62. Seow, H. F. 1998. Pathogen interactions with cytokines and host defense: anoverview. Vet. Immunol. Immunopathol. 63:139–148.

63. Sevilla, N., S. Kunz, D. McGavern, and M. B. Oldstone. 2003. Infection ofdendritic cells by lymphocytic choriomeningitis virus. Curr. Top. Microbiol.Immunol. 276:125–144.

64. Sevilla, N., D. B. McGavern, C. Teng, S. Kunz, and M. B. Oldstone. 2004.Viral targeting of hematopoietic progenitors and inhibition of DC matura-tion as a dual strategy for immune subversion. J. Clin. Investig. 113:737–745.

65. Shi, S. T., P. Huang, H. P. Li, and M. M. Lai. 2000. Heterogeneous nuclearribonucleoprotein A1 regulates RNA synthesis of a cytoplasmic virus.EMBO J. 19:4701–4711.

66. Shi, S. T., G. Y. Yu, and M. M. Lai. 2003. Multiple type A/B heterogeneousnuclear ribonucleoproteins (hnRNPs) can replace hnRNP A1 in mousehepatitis virus RNA synthesis. J. Virol. 77:10584–10593.

67. Vanden Berghe, W., K. De Bosscher, E. Boone, S. Plaisance, and G. Haegeman.1999. The nuclear factor-kappaB engages CBP/p300 and histone acetyltrans-ferase activity for transcriptional activation of the interleukin-6 gene promoter.J. Biol. Chem. 274:32091–32098.

68. Vandermoere, F., I. El Yazidi-Belkoura, C. Slomianny, Y. Demont, G.Bidaux, E. Adriaenssens, J. Lemoine, and H. Hondermarck. 2006. Thevalosin-containing protein (VCP) is a target of Akt signaling required for cellsurvival. J. Biol. Chem. 281:14307–14313.

69. Wang, H., X. Yang, G. C. Bowick, N. K. Herzog, B. A. Luxon, L. O. Lomas,and D. G. Gorenstein. 2006. Identification of proteins bound to a thio-aptamer probe on a proteomics array. Biochem. Biophys. Res. Commun.347:586–593.

70. Wang, Y., and X. Zhang. 1999. The nucleocapsid protein of coronavirusmouse hepatitis virus interacts with the cellular heterogeneous nuclear ribo-nucleoprotein A1 in vitro and in vivo. Virology 265:96–109.

71. Yoo, C. G., S. Lee, C. T. Lee, Y. W. Kim, S. K. Han, and Y. S. Shim. 2000.Anti-inflammatory effect of heat shock protein induction is related to stabi-lization of I kappa B alpha through preventing I kappa B kinase activation inrespiratory epithelial cells. J. Immunol. 164:5416–5423.

72. Zhang, L. H., K. Marriott, and J. F. Aronson. 1999. Sequence analysis of thesmall RNA segment of guinea pig-passaged Pichinde virus variants. Am. J.Trop. Med. Hyg. 61:220–225.

73. Zhang, W., J. M. Navenot, N. M. Frilot, N. Fujii, and S. C. Peiper. 2007.Association of nucleophosmin negatively regulates CXCR4-mediated G pro-tein activation and chemotaxis. Mol. Pharmacol. 72:1310–1321.

74. Zhou, H., X. Wang, W. K. Ko, and A. O. Wong. 2004. Evidence for a novelintrapituitary autocrine/paracrine feedback loop regulating growth hormonesynthesis and secretion in grass carp pituitary cells by functional interactionsbetween gonadotrophs and somatotrophs. Endocrinology 145:5548–5559.

75. Zhu, Y., B. Singh, S. Hewitt, A. Liu, B. Gomez, A. Wang, and R. Clarke. 2006.Expression patterns among interferon regulatory factor-1, human X-boxbinding protein-1, nuclear factor kappa B, nucleophosmin, estrogen recep-tor-alpha and progesterone receptor proteins in breast cancer tissue microar-rays. Int. J. Oncol. 28:67–76.

700 BOWICK ET AL. J. VIROL.

at MO

OD

Y M

ED

ICA

L LIBR

AR

Y on F

ebruary 25, 2009 jvi.asm

.orgD

ownloaded from