analysis of liver x receptor target gene expression across ...4198... · analysis of liver x...

Analysis of Liver X Receptor target gene expression across species

A Thesis

Submitted to the Faculty

of

Drexel University

by

Paul Bart Noto

in partial fulfillment of the

requirements for the degree

of

Doctor of Philosophy

May 2013

ii

DEDICATIONS

This thesis is dedicated with great affection to my family, loving parents and wife and, above all, my daughter Elena.

iii

ACKNOWLEDGMENTS

I’d like to acknowledge the many people who helped me in obtaining my degree.

I’m very grateful to Dr. Joe Bentz for giving me the opportunity to work on the

doctoral program at Drexel University. His support and mentorship were essential

to get through in this long process.

Enormous gratitude to Dr. Deepak Lala and Dr. Yuri Bukhtiyarov for their

constant effort in helping me throughout my research project. Their endless

mentorship not only allowed me to complete my studies but also greatly

contributed to my scientific growth and forma mentis.

I would also like to thank all my committee members, Dr. Brian McKeever, Dr.

Daniel Marenda, Dr. Felice Elephant and Dr. Nianli Sang for their generous

commitment to my research progress over the past few years.

I also want to thank Vitae Pharmaceuticals for allowing me to continue my

education by giving me the opportunity to work on my research project while

pursuing other discovery programs.

I’d like to thank Dr. Gerard McGeenan and Dr. Colin Tice for their valuable

scientific inputs, support and contributions to my research.

I also appreciate all the help provided by Susan Cole, by assisting and supporting

me through all the steps of the process.

Last, but not least, I’d like to acknowledge everyone in my family for their

endless support and understanding during difficult moments, alleviated by the

loving hugs of my little princess Elena.

Thank you all!

iv

TABLE OF CONTENTS LIST OF TABLES ...............................................................................................vii

LIST OF ILLUSTRATIONS ............................................................................ viii

ABSTRACT ............................................................................................................ x

1: INTRODUCTION .......................................................................................... 12

1.1 Liver X Receptors (LXRs) – Structure and general mechanism of action. . 12

1.2 LXR isoforms and their expression across tissues ....................................... 13

1.3 Physiological aspects of LXR target gene expression ................................. 14

1.3.1. Cholesterol and lipid metabolism ........................................................ 14

1.3.2. Inflammation ........................................................................................ 17

1.3.3. Alzheimer’s disease (AD) ..................................................................... 19

1.4 Pharmacological modulation of LXRs......................................................... 20

1.4.1. Therapeutic applications ..................................................................... 21

1.4.2. Drug Discovery: strategies, animal models and challenges ............... 22

1.5 Implications of differential LXR target gene expression across species ..... 26

2: REGULATION OF SPHINGOMYELIN PHOSPHODIESTERASE,

ACID-LIKE 3A GENE (SMPDL3A) BY LIVER X RECEPTORS ................ 28

Abstract .............................................................................................................. 29

2.1 Introduction .................................................................................................. 30

2.2 Material and Methods .................................................................................. 33

2.2.1. Cell Culture and Transfection ............................................................. 33

2.2.2. Gene expression microarray analysis. ................................................. 34

2.2.3. Analysis of the SMDPL3A expression in cells and tissues. ................. 35

2.2.4. Animal studies ...................................................................................... 36

2.2.5. SMPDL3A protein analysis.................................................................. 36

2.2.6. Gel Mobility Shift Assays. .................................................................... 37

2.2.7. Chromatin Immunoprecipitation Assays.............................................. 38

2.3 Results ......................................................................................................... 39

v

2.3.1 Genome Wide Gene Expression Analysis and validation by real time-

PCR (RT-PCR) ............................................................................................... 39

2.3.2 Expression of SMPDL3A is induced by LXR agonists. ......................... 40

2.3.3. Knockdown of LXRs in THP-1-derived macrophages reduces the

expression of the SMPDL3A gene.................................................................. 41

2.3.4. Both Retinoid X Receptor (RXR) and LXR ligands induce SMPDL3A

gene expression. ............................................................................................. 42

2.3.5 LXR directly interacts with LXR response element in SMPDL3A

promoter region. ............................................................................................ 43

2.3.6. LXRs regulate the SMPDL3A gene in a cell type-specific fashion in

human cells. ................................................................................................... 43

2.3.7. SMPDL3A is not induced by LXRs in mice. ......................................... 44

2.4 Discussion .................................................................................................... 45

2.5 References .................................................................................................... 48

2.6. Figure Legends............................................................................................ 51

3: LXR TRANSCRIPTOME IN CYNOMOLGUS MONKEY BRAIN ......... 70

Abstract .............................................................................................................. 71

3.1 Introduction .................................................................................................. 72

3.2 Material and Methods .................................................................................. 75

3.2.1. Cell Culture and treatment of CCF-STTG1 cells ................................ 75

3.2.2. ApoE protein analysis in human CCF-astrocytes. ............................... 75

3.2.3. Experimental protocol for monkey studies .......................................... 76

3.2.4. Gene expression analysis in cells and tissues. ..................................... 77

3.2.5. ABCA1, ApoE and Apo-AI protein analysis in monkey cerebrum. ...... 77

3.2.6. Analysis of Aβ peptides levels in monkey cerebra and hippocampi. ... 78

3.2.7. RNA-sequencing of monkey cerebra. ................................................... 79

3.3 Results .......................................................................................................... 81

3.3.1 VTP-5 is a potent, LXRβ selective modulator. ...................................... 81

3.3.2 VTP-5 increases expression of ABCA1 and ApoE in human astrocytes.

........................................................................................................................ 81

3.3.3. VTP-5 significantly increases expression of ABCA1 and ApoE in

cerebral cortex in primates. ........................................................................... 82

vi

3.3.4. VTP-5 lowers Aβ1-42 in primate hippocampus in a dose-dependent

manner. .......................................................................................................... 82

3.3.5 LXRα and LXRβ are expressed at different levels in Cynomolgus brain

and liver tissues.............................................................................................. 83

3.3.6. RNA-sequencing of monkey cerebrum confirms the induction of several

known LXR target genes by treatment with VTP-5. ....................................... 84

3.3.7. VTP-5 promotes Aβ clearance without affecting key genes involved in

Aβ synthesis/degradation ............................................................................... 85

3.3.8. VTP-5 induces mRNA expression of Apo-AI and PLAT genes. ........... 85

3.3.9. VTP-5 increases the Apo-AI protein levels in Cynomolgus cerebrums.

........................................................................................................................ 86

3.3.10.KEGG pathway analysis reveals a possible involvement of LXRs in

neurotransmission. ......................................................................................... 86

3.4 Discussion .................................................................................................... 87

3.5 References .................................................................................................... 91

3.6. Figure Legends............................................................................................ 95

3.7 Table Legends .............................................................................................. 97

CONCLUSIONS AND FUTURE DIRECTIONS ........................................... 111

LIST OF REFERENCES .................................................................................. 115

APPENDIX A ..................................................................................................... 124

VITA.................................................................................................................... 127

vii

LIST OF TABLES Chapter 3: Table 1 ………………………………………………………………………… 98 Table 2 ………………………………………………………………………… 99 Table 3 ……………………………………………………………………….. 100

viii

LIST OF ILLUSTRATIONS Chapter 2: Figure 1A .………………………………………………………………………. 55 Figure 1B .………………………………………………………………………. 56 Figure 1C ……………………………………………………………………….. 57 Figure 2A ……………………………………………………………………….. 58 Figure 2B .………………………………………………………………………. 59 Figure 2C ……………………………………………………………………...... 60 Figure 2D ……………………………………………………………………...... 61 Figure 3A ……………………………………………………………………...... 62 Figure 3B ……………………………………………………………………...... 63 Figure 4A ……………………………………………………………………...... 64 Figure 4B ……………………………………………………………………...... 65 Figure 5A ……………………………………………………………………...... 66 Figure 5C ……………………………………………………………………...... 67 Figure 6A ……………………………………………………………………...... 68 Figure 6B ……………………………………………………………………...... 69 Chapter 3: Figure 1A .……………………………………………………………………... 101 Figure 1B .……………………………………………………………………... 102 Figure 2A .……………………………………………………………………... 103 Figure 2B ……………………………………………………………………… 104 Figure 3 ....……………………………………………………………………... 105 Figure 4A ……………………………………………………………………… 106

ix

Figure 4B ……………………………………………………………………… 107 Figure 5A ……………………………………………………………………… 108 Figure 5B ……………………………………………………………………… 109 Figure 6 ...………………………………………………………………………..110

x

ABSTRACT Analysis of Liver X Receptor target gene expression across species

Paul Bart Noto

Deepak Lala, Supervisor, Ph.D.

Joe Bentz, Supervisor, Ph.D.

Liver X Receptors (LXRs) are nuclear hormone receptors that regulate key genes

involved in cholesterol and lipid metabolism. As transcription factors, LXRs turn

on the gene expression of ATP-binding cassette transporters (ABCs) which

mediate cholesterol efflux from cells, such as macrophage foam cells. In addition,

LXRs have the ability to down regulate pro-inflammatory genes. Therefore, LXRs

have been extensively investigated as potential therapeutic targets for the

treatment of conditions that result from altered cholesterol and lipid homeostasis

as well as increased inflammation, such as atherosclerosis and Alzheimer’s

disease (AD). This latter is a neurodegenerative disorder that is associated with

the deposition of brain amyloid plaques, constituted by insoluble Aβ peptides.

LXR activation has been shown to promote Aβ clearance from the brain via the

ABCA1-apolipoprotein E pathway and improve cognitive functions in rodent

models of AD. The ability of LXRs to promote reverse cholesterol transport

(RCT) and suppress inflammation has been characterized in both human and

murine in vitro systems, but mostly in rodent in vivo systems. Although the LXR

signaling pathway is mostly conserved across species, LXRs can also regulate

their target genes in a species-, tissue- and isoform-specific fashion. Therefore the

purpose of this work is to investigate the regulation of target genes by LXRs

across species and identify, if any, differences that could aid us in understanding

xi

the role of LXR modulation in higher species, such as non-human primates. In the

context of inflammation, the LXR genome landscape had only been investigated

in murine macrophages. Therefore, we performed a genome-wide screen in human

THP-1 macrophages. This led us to the identification of a novel LXR target gene,

Sphingomyelin Phosphodiesterase Acid-Like 3A Gene (SMPDL3A), which is

regulated in a species- and tissue-specific fashion, being restricted to human blood

cells, with no induction by LXRs in mouse cellular systems. Next, we confirmed

the LXR-mediated upregulation of ABCA1 and ApoE genes in Cynomolgus

monkey brains, as this had never been investigated in higher species. In addition,

we also characterized the LXR transcriptome in Cynomolgus brain by RNA-

sequencing in order to identify potential novel LXR target genes.

For the first time in higher species, we show Apolipoprotein AI upregulation in

the brain of Cynomolgus monkey upon treatment with a synthetic LXR

modulator.

12

CHAPTER 1: INTRODUCTION

1.1 Liver X Receptors (LXRs) – Structure and general mechanism of action.

LXRs are members of the superfamily of nuclear hormone receptors. These share

one common scaffold, comprising two major structural elements: a DNA binding

domain (DBD), which is generally highly conserved and that contains two zinc

fingers which bind to specific hormone response elements (HREs) within target

genes; and a ligand binding domain (LBD), which is moderately conserved in

sequence and highly conserved in structure between the different nuclear

receptors. Along with the DBD, the LBD contributes to the dimerization interface

of the receptor and in addition, binds co-activator and co-repressor proteins

(Mangelsdorf et al., 1995; Kumar and Thompson, 1999).

Although all nuclear receptors have the same structural features, they have been

classified in several different ways according to their mode of action, functioning

either as monomers or homo-/hetero dimers (Novac and Heinzel, 2004).

LXRs regulate the expression of their target genes as heterodimers and require

retinoid X receptors (RXRs) as obligate heterodimer partners to bind to their

cognate response elements, which can be activated by both RXR and LXR ligands

(Willy et al., 1995). Indeed, the RXR/LXR heterodimer is characterized by dual

ligand permissivity since it can be activated by a rexinoid (RXR agonist), an LXR

agonist, or both agonists in a synergistic fashion (Shulman et al., 2004). The

mechanism by which LXRs activate gene transcription is known as

transactivation. This consists in the direct binding of the receptors to LXR

13

response elements (LXREs) present within the promoters of the target genes. In

particular, LXREs typically consist of an (A/G)GGTCA direct repeat motif spaced

by 4 nucleotides (DR4). In the absence of LXR ligands, the LXR/RXR

heterodimer is associated with co-repressors, such as nuclear co-repressor 1

(NCoR1) or silent mediator of retinoic acid receptor and thyroid receptor

(SMRT), and constitutively bound to the promoter of LXR target genes (Chen and

Evans, 1995; Horlein et al., 1995; Hu et al., 2003). This is known as basal gene

repression. The presence of ligands causes dissociation of NCoR1 from the

promoters of LXR target genes and induces recruitment of co-activators by LXRs

(Hu et al., 2003; Wagner et al., 2003) and the subsequent initiation of gene

transcription.

An alternative mechanism of gene regulation by LXRs, which is not LXRE-

dependent, is transrepression. This relies upon the ligand-dependent, ubiquitin-

like modifications of the lysine residues in the LBDs of LXRs with small

ubiquitin related modifier (SUMO) proteins (Ghisletti et al., 2007). The

SUMOylated LXRs are recruited to the promoter regions of certain constitutively

repressed genes preventing the clearance of the co-repressor (NCoR1) complex in

response to transcriptional stimuli.

1.2 LXR isoforms and their expression across tissues

Two isoforms are known, LXRα (NR1H3) and LXRβ (NR1H2). LXRα is

primarily expressed in liver, macrophages, intestine and adrenals while LXRβ is

ubiquitously expressed across all tissues (Song et al., 1994; Whitney et al., 2002)

with particularly high levels in the developing brain (Fan et al., 2008). The

homology between human LXRα and LXRβ is significant, with approximately 76

14

and 78 % amino acid identity in their DBD and LBD, respectively. LXRs are also

highly conserved between rodents and humans. Human and murine LXRα/LXRβ

paralogs are almost identical, given the 99% homology in amino acid sequence in

both their DBD and LBD (Lee et al. 2008).

1.3 Physiological aspects of LXR target gene expression

LXRs act as sensors of oxysterols (OHCs), which are metabolites of cholesterol,

across several metabolically active tissues, such as liver, kidney and brain. Known

natural ligands for LXRs are 22(R)-hydroxycholesterol, 24(S)-

hydroxycholesterol, 27-hydroxycholesterol and 24(S),25-epoxycholesterol, with

this latter being the most potent agonist (Janowski et al., 1999). Therefore,

whenever intracellular cholesterol reaches high levels, oxysterol-activated LXRs

turn on the expression of key genes involved in cholesterol metabolism. In

addition, LXRs activate the transcription of several genes that lead to fatty acid

synthesis and lipogenesis, leading to hypertriglyceridemia and hepatosteatosis.

1.3.1. Cholesterol and lipid metabolism

Elevated concentrations of intracellular cholesterol and OHCs lead to activation of

LXRs, which turn on the expression of ABC transporters in multiple tissues, such

as ABCA1/G1 in macrophages (Venkateswaran et al., 2000; Kennedy et al., 2001)

and ABCG5/G8 in liver and intestine (Repa et al., 2002). ABCA1 mediates the

transport of phospholipids and cholesterol to poorly-lipidated apolipoproteins,

such as Apo-AI (Chambenoit et al., 2001), contributing to stabilization of high-

density lipoproteins (HDL) and therefore setting the first step of RCT. On the

contrary, ABCG1 promotes cholesterol efflux to phospholipid-containing

15

acceptors, such as HDL particles previously lipidated by ABCA1 (Gelissen et al.,

2006). ABCG5/G8 transporters play a crucial role in the secretion of hepatic

cholesterol into bile, as mice lacking either transporter show increased and

reduced levels of cholesterol in the liver and bile acids, respectively (Yu et al.,

2002). Also, mutations in either ABCG5 or ABCG8 human genes result into

sitosterolemia, an autosomal recessive disorder associated with elevated levels of

phytosterols in plasma and an increased risk of developing atherosclerosis (Lee et

al., 2001). An additional LXR target gene is the phospholipid transfer protein

(PLTP) (Lafitte et al., 2003). This mediates the transfer of phospholipids and

cholesterol from triglyceride (TG)-rich lipoproteins (TRL) into HDL, contributing

to the formation of β-HDL particles, which are very efficient acceptors of

cholesterol from peripheral cells (Lee at al., 2003). Indeed, as PLTP knockout

mice manifest the lack of phospholipid transfer from TRL to HDL (Jiang et al.,

1999), transgenic mice over-expressing human PLTP show increased plasma β-

HDL plasma levels along with reduced accumulation of cholesterol in

macrophages, when compared to wild-type mice (van Haperen et al., 2000). In

liver, LXRs have been also shown to upregulate CYP7Α1, a rate-limiting enzyme

involved into the synthesis of bile acids from cholesterol, in rodents but not in

humans (Menke et al., 2002).

The role of LXRs in cholesterol uptake is less clear. A 2006 study showed the

presence of an LXRE within the promoter of the low-density lipoprotein receptor

(LDLR) gene, as activation of LXRs with an agonist led to the induction of the

gene in human hepatoblastoma cells (Ishimoto et al., 2006). On the contrary, in

mice, others have shown the LXR-mediated upregulation of the inducible

degrader of the LDLR (IDOL), an E3 ubiquitin ligase that mediates the

16

ubiquitination of LDLR, thus targeting it for degradation (Zelcher et al., 2009).

An additional role of LXRs in cholesterol homeostasis is at the intestinal level.

LXR activation has been shown to reduce the expression levels of the Niemann–

Pick C1 like 1 (NPC1L1) gene in both human colon carcinoma cells (CaCo-2) and

mouse intestine (Duval et al., 2006). NPC1L1 is required for intestinal cholesterol

absorption and it is primarily expressed in the brush border membrane of

enterocytes in the small intestine (Altmann et al. 2004).

Additionally, LXRs positively regulate the expression of cholesterylester transfer

protein (CETP), which mediates a bidirectional exchange of cholesteryl esters and

triglycerides between lipoproteins, such as HDL and LDL (Luo and Tall, 2000;

Barter et al., 2003). Importantly, plasma CETP activity is restricted to higher

species, as rodents do not express the CETP gene. The implications of this

species-specific difference will be discussed in the context of pharmacological

LXR modulation.

In liver, upon ligand binding, LXRs are also responsible for the upregulation of

the sterol regulatory element-binding protein-1c (SREBP1c) gene (Repa et al.,

2000) and several other genes involved in lipogenesis, such as fatty acid synthase

(FAS) (Joseph et al., 2002) and stearoyl-CoA desaturase (SCD) (Sun et al., 2003).

Oral administration of a synthetic LXR agonist, T0901317, to mice and hamsters

leads to increased plasma and hepatic triglyceride levels (Schultz et al., 2000).

Control of lipogenesis in not restricted to plasma and liver only, as LXR

activation has also been shown to promote lipid accumulation in human mature

adipocytes as well (Juvet et al., 2003).

17

1.3.2. Inflammation

Treatment of macrophages with lipopolysaccharide (LPS) leads to activation of

the Toll-like receptor-4 (TLR-4) (Takeuchi et al., 1999) and subsequent induction

of cytokines involved in innate immunity and inflammatory response (Akira et al.,

2001). LXRs have been shown to act as negative regulators of key inflammatory

genes, such as tumor-necrosis factor alpha (TNFα), interleukins (IL-1β, IL-6),

cyclooxigenase 2 (COX-2), inducible nitric oxide synthase (iNOS) and necrosis

factor kB (NFkB) in murine macrophages simulated with LPS (Joseph et al.,

2003). Additionally, in murine peritoneal macrophages, ligand-activated LXRs

can counteract the LPS-induced effects on the expression of matrix

metalloproteinase 9 (MMP-9), which is involved in degradation of extracellular

matrix (ECM) components during normal and pathogenic tissue remodeling

(Castrillo et al., 2003).

The mechanism by which LXRs exert anti-inflammatory properties relies on the

association with co-repressor complexes that prevent the recruitment of the

transcription machinery onto the promoters of several pro-inflammatory genes,

such as iNOS, IL-1β and TNFα, in mouse primary macrophages (Ghisletti et al.,

2007). As mentioned earlier, this is known as transrepression.

LXRs may also play a significant role in innate immunity. In response to

intracellular bacteria, induction of LXRα expression in murine macrophages leads

to increased survival, as well as decreased apoptosis, and LXR-mediated gene

upregulation of the Scavenger Receptor Cystine-Rich Repeat Protein (Spα)

(Joseph et al., 2004), which appears to have a critical role in the clearance of

bacterial pathogens (Terpstra et al., 2000; Glass and Witztum, 2001).

18

Consistent with this, LXR activation has been shown to potentiate the LPS

response in human macrophages, by inducing the expression of the TLR-4 gene

(Fontaine et al., 2007). This might suggest a biphasic role for LXRs, as they

initially prepare macrophages to elicit an antibacterial response, and then, once the

inflammatory stimulus is present, exert anti-inflammatory actions to restore

normal cell conditions. Nonetheless, regulation of TLR-4 is known to be species-

specific, since LXRs do not induce this gene in mice. Although the mouse and

human TRL-4 genes are highly conserved (Roger et al., 2005), differences in the

LXREs within the TRL-4 promoters may account for the differential gene

regulation by LXRs across human and mouse species.

The anti-inflammatory effects of LXRs are not just limited to macrophages.

For instance, LXRs can also suppress the hepatic expression of the C-reactive

protein (CRP), a typical human acute phase protein. This has been demonstrated

in human hepatocytes, showing that LXRs can maintain the CRP gene in a

repressed state by preventing the cytokine-induced clearance of nuclear

receptor/co-repressor complexes (Blaschke et al., 2006).

Furthermore, LXR activation with both natural and synthetic ligands, such as

oxysterols and GW3965, has led to the reduction of inflammation in mouse

models of irritant and allergic contact dermatitis. As topical application of 12-

myristate-13-acetate (PMA) to the ear surface of CD1 mice led to dermatitis and

increased ear thickness, treatment with the LXR agonists was shown to reduce the

levels of PMA-induced pro-inflammatory cytokines, such as IL-1α and TNFα, as

well as a reduction in ear weight and thickness (Fowler et al., 2003).

Nonetheless, controversial results have been also reported. For instance, while

some authors demonstrated that LXR activation exacerbates inflammation in a

19

murine model of collagen-induced arthritis (CIA) (Asquith et al, 2009), others

have shown that LXRs can suppress inflammation and joint destruction in CIA

mice (Park et al., 2010).

1.3.3. Alzheimer’s disease (AD)

AD is a neurodegenerative disorder resulting from the deposition of β-amyloid

(Aβ) peptides in the extracellular space of the brain parenchyma (Selkoe, 1993).

The Aβ peptides are generated by proteolytic degradation of a larger molecule, the

Aβ precursor protein (APP) (Masters et al., 1985), and aggregate into insoluble

fibrillar plaques (Shoji et al., 1992), which cause toxicity and ultimately lead to

neuronal death (Hardy and Allsop, 1991).

This process results into loss of cognitive functions and memory, well-known

hallmarks of dementia that characterize AD.

ApoE is a plasma lipoprotein primarily synthesized in liver and brain

(Elshourbagy et al., 1985). In particular, ApoE is produced and secreted by

astrocytes in the central nervous system (CNS) and has been shown to be involved

in both cholesterol transport and neuronal regeneration (Ignatius et al., 1986;

Boyles et al., 1989). ApoE is known to have high affinity for Aβ peptides and has

been found associated to amyloid plaques in brains of AD patients (Strittmatter et

al., 1993b). Three isoforms of ApoE are known: ε2, ε3 and ε4. The higher

frequency of the ε4 allele has been widely associated with late-onset and familial

AD (Strittmatter et al., 1993), as this isoform has been shown to be less effective

than the ε2, ε3 isoforms in mediating the removal of Aβ peptides from the brain

(DeMattos et al., 2004).

20

Several studies have demonstrated that activation of LXRs results in increased

ApoE levels in murine and human macrophages (Mak et al., 2002; Jiang et al.,

2003) and in rat brain, in which higher levels of lipidated ApoE positively

correlate with amyloid Aβ clearance (Suon et al., 2010). The clearance process

requires the transfer of intracellular cholesterol via ABCA1 onto interstitial ApoE

(Wharle et al., 2004; Hirsch-Reinshagen et al., 2005) to form HDL-like particles

(Fagan et al., 1999). Importantly, lipidation of ApoE appears to be required in

order to enhance both degradation and efflux of the neurotoxic amyloid peptides,

Aβ40 and Aβ42 (Tokuda et al., 2000; Morikawa et al., 2005; Bell et al., 2007). In

particular, Aβ42 is believed to be the major component of cerebrovascular

amyloid deposits, with respect to the more soluble Aβ40 peptide (Roher et al.,

1993). Treatment with LXR modulators has been proven beneficial in several

rodent models of AD, by improving cognitive functions and reducing the amyloid

load in brain (Jiang et al., 2008; Fitz et al., 2010). This latter has also been proven

to result from the uptake of Aβ-bound lipidated-ApoE particles by murine

microglial cells, where the soluble Aβ peptides are processed and degraded by

proteolytic enzymes, such as neprilysin (NEP), in the lysosomal compartment

(Jiang et al., 2008).

1.4 Pharmacological modulation of LXRs.

The ability of LXRs to regulate cholesterol and lipid homeostasis while reducing

inflammation has generated a large interest in targeting these receptors for the

treatment of disorders such as atherosclerosis, atopic dermatitis, asthma and AD.

21

1.4.1. Therapeutic applications

The primary pharmacological intervention for atherosclerosis relies on statins

(Endo, 1992), which inhibit HMG-CoA-reductase, the rate-limiting enzyme in

cholesterol synthesis. Although statins effectively lower blood-circulating

cholesterol and therefore ameliorate the conditions of people with cardiovascular

disorders, new drugs that actually promote cholesterol efflux from overloaded

macrophages are needed in order to reduce existing atherosclerotic plaques and

therefore lower chances of thrombotic events.

As discussed so far, the ability of LXRs to promote RCT via direct gene

upregulation of several ABC transporters in macrophages and intestine, while

limiting absorption of cholesterol in the small intestine, makes them an attractive

therapeutic target for the treatment of atherosclerosis. Pharmacological

modulation of LXRs has also been proposed for the treatment of skin disorders,

such as atopic dermatitis. In mouse skin, not only LXR activation results in

reduced expression of pro-inflammatory cytokines but also prevents keratinocyte

differentiation while promoting epidermal development, by increasing lipid

production and thereby improving barrier function (Fowler et al., 2003; Hatano

et al., 2010). Treatment of human airway smooth muscle cells (hASM) with the

synthetic agonist T0901317 was shown to reduce a series of cytokines and pro-

inflammatory factors that would suggest an additional application for LXR

modulation in the context of airway inflammatory diseases, such as asthma and

chronic obstructive pulmonary disease (COPD) (Delvecchio et al., 2007).

LXRs may also play a potential therapeutic role in stroke. In rodent models of

experimental stroke, treatment with two synthetic agonists, T090 and GW3965,

diminished the levels of several ischemia-related inflammatory markers, such as

22

iNOS, MMP-9, COX-2 and TNFα (Morales et al., 2008). Therefore, in cases of

cerebral ischemia LXR modulators may indeed offer neuroprotection by

reducing brain inflammation and neurological deficits (Sironi et al., 2008).

Finally, the ability of LXRs to drive the ABCA1-ApoE mediated clearance of β-

amyloid plaques from the brain in rodents has generated quite some interest in

the context of AD. Currently, no therapy exists to block and reverse the

progression of such debilitating neurological disease. Several small molecule

drugs that specifically inhibit the activity of the beta-site APP cleaving enzyme 1

(BACE1), which leads to the generation of amyloid peptides, are currently being

investigated in clinical trials. Nonetheless, taken together with the anti-

inflammatory properties of LXRs in brain, development of CNS-penetrant LXR

modulators would prove beneficial in the setting of neurological disorders, such

as AD and Parkinson’s disease (PD) either alone or in combination with other

agents. In facts, LXRβ has been shown to protect dopaminergic neurons in a

mouse model of PD by modulating the microglia-mediated neuronal toxicity

(Dai et al., 2012).

1.4.2. Drug Discovery: strategies, animal models and challenges

Despite LXRs’ ability to promote cholesterol efflux upon activation via ligand

binding of both natural and synthetic agonists, a compelling undesired side effect

is the parallel activation of SREBP1c and other genes involved in fatty acid

synthesis, such as FAS, SCD and acetyl-CoA carboxylase (ACC), leading to

lipogenesis (Liang et al., 2002). Elevation of plasma and liver triglycerides in

mice has been observed upon treatment with the LXR full agonist, T0901317

(Schultz et al., 2000). Since the early characterization of these ligands, great

23

efforts have been dedicated to identifying a ligand capable of modulating LXRs

in turning on ABC transporter genes as well as reducing inflammation, without

affecting SREBP1c gene levels. Given the higher expression of LXRα in liver,

with respect to LXRβ (Su et al., 2004), several pharmaceutical companies have

opted for the development of LXRβ-selective modulators, avoiding, where

possible, activation of LXRα, which seems to play a more significant role in

liver in terms of SREBP1c gene regulation. This rationale is supported by the

evidence that despite the more severe atherosclerotic profile of a double

knockout mice for LXRα and apoE (Lxrα–/–apoE–/–), with respect to the apoE–/–

phenotype, treatment with a potent synthetic LXR agonist leads to anti-

atherogenic effects, as the result of reduced aortic lesion areas and improved

cholesterol and lipid profiles (Bradley et al., 2007).

Although synthetic steroidal LXR modulators have the potential to achieve such

goal with low impact on hepatic lipogenesis, their pharmacokinetic properties,

such as poor bioavailability, makes them less attractive. For instance, DMHCA

(N,N-dimethyl-3β-hydroxy-cholenamide) is an oxysterol derivative that has been

shown to be effective in both human cells and C57BL/6 mice. Treatment with the

steroid led to activation of ABCA1 gene expression in both human THP-1

derived-macrophages and murine peritoneal macrophages without induction of

SREBP1c in either human HepG2 hepatocytes or mouse liver, where no lipid

accumulation could be observed (Quinet et al., 2004).

Additionally, long-term administration of DMHCA in apoE-deficient (apoE-/-)

mice was shown to reduce the formation of atherosclerotic lesions without causing

hepatosteatosis and elevation of triglycerides in plasma (Kratzer et al., 2009).

24

Similarly, a recent synthetic steroidal LXRα-selective agonist, ATI-829,

marginally induced SREBP1c expression in HepG2 cells, while robustly inducing

ABCA1 expression in THP1 cells. The efficacy of the compound was also

assessed in a different model of atherosclerosis, LDLR-deficient mice (Ldlr-/-),

showing reduction in the size of aortic lesions without affecting either cholesterol

or triglycerides levels in plasma and liver (Peng et al., 2008), contrary to the

results that may have been expected for an LXRα-selective ligand. Indeed, LXR

knockout experiments in atherosclerosis murine models (Ldlr-/-) show the

requirement of LXRα in macrophages in order to achieve robust reduction of

atherosclerotic plaques (Bischoff et al., 2010). Consistent with this, increased

expression of LXRα in the intestine of Ldlr-/- mice, obtained via knock in of a

VP16-LXRα construct, led to improved RCT and decreased severity of aortic

lesions (Lo Sasso et al., 2010).

As anticipated earlier, CETP is an LXR target gene (Luo and Tall, 2000).

Induction of CETP in higher species represents a major liability in the

pharmacological activation of LXRs, as increased CETP activity is associated

with an enhanced atherogenic lipoprotein profile (Zhong et al., 1996).

Indeed, two synthetic non-steroidal LXR agonists were administered to CETP-

containing species, such as hamsters and Cynomolgus monkeys, causing a

significant increase of both VLDL and LDL cholesterol levels in plasma (Groot et

al., 2005), therefore questioning the overall therapeutic value of LXR modulation

by isoform non-selective agonists. Nonetheless, another synthetic non-steroidal

compound with higher affinity for the LXRβ isoform, WAY-252623, was later

shown to reduce plasma LDL cholesterol in non-human primates without

affecting the lipoprotein profile in hamsters (Quinet et al., 2009). Treatment with

25

WAY-623 also caused accumulation of lipids in liver, where triglyceride levels

were reported to be five times higher with respect to the control animals.

Nonetheless, in 2006 Wyeth initiated a phase I clinical trial for WAY-252623.

Activation of the LXR target genes (ABCA1 and ABCG1) was observed upon

treatment with the compound in ex vivo whole blood analyses during the single

ascending-dose phase of the trial. However, the occurrence of CNS-related side

effects was also observed. While it was not clear whether these effects were

compound or target related, the trial was terminated along with no further

development of the drug (Ratni and Wright, 2010).

Nonetheless, LXR modulation has been shown to ameliorate the neurological

conditions of animal models of AD. The role of LXRs in the reduction of the

amyloid burden brain has been characterized by generating triple transgenic mice

lacking either LXRα or LXRβ with a knock in of APP and presenilin 1 (PS1)

genes, that carry mutations which cause increased formation of amyloid plaques

(Zelcher et al., 2007). In this study it was shown that both Lxrα–/– Lxrβ–/– mice

exhibit increased levels of Aβ40 and Aβ42 peptides, suggesting the beneficial role

of LXRs in the APP/S1 transgenic animals. Additionally, the authors also

demonstrated the anti-inflammatory effects of LXR activation in LPS-treated

primary astrocytic and microglial cells isolated from mouse brains.

Similar immuno-modulatory effects have also been observed in a different mouse

model of AD, APP23 transgenic mice (Fitz et al., 2010). In this model, LXR

activation with T090 also reversed the negative effects of high fat (HF) diet by

improving spatial learning and memory retention, with a concomitant

upregulation of both abca1 and apoE genes and reduction of Aβ peptides.

26

A common animal model of AD used to study the effects of small molecule

inhibitors of secretase enzymes, such as BACE1, is the transgenic mouse Tg2576.

These express the human APP gene carrying the Swedish mutation, which confers

a large extent of amyloid deposition in brain. In this model, T090 was able to

reduce the levels of Aβ42, but not Aβ40, in hippocampi only along with the

reversal of contextual memory deficits associated with these animals (Riddell et

al., 2007). Finally, the effects of LXR ligands on amyloid reduction have also

been assessed in rats, with the specific purpose of analyzing Aβ composition in

cerebro-spinal fluid (CSF), which is easier to obtain with respect to mice.

Not only the LXR compound upregulated both abca1 and apoE in rat brain, but

also led to increased levels of Aβ peptides in the CSF, suggesting a clearance

mechanism at the basis of apoE-mediated Aβ reduction (Suon et al., 2010).

Although an experimental approach was attempted in 2010 (Li et al.), currently,

there is no availability of non-human primate models of AD that would allow

assessing the effects of LXR modulators on disease progression and cognitive

functions.

1.5 Implications of differential LXR target gene expression across species

Although the LXR signaling pathway is mostly conserved across species, LXRs

can also regulate their target genes in a species- and isoform-specific fashion.

Examples of genes differentially regulated across species include CYP7A1, the

rate-limiting enzyme in bile acid synthesis, which is activated by LXRs in mouse

but not in human (Goodwin et al., 2003). This represents a crucial difference in

the control of cholesterol homeostasis by LXRs, suggesting distinct species-

specific mechanisms for the elimination of excessive cholesterol. In addition, as

27

CETP is a known LXR target gene, one must also consider assessing the efficacy

of experimental LXR modulators in CETP-containing species, such as non-human

primates, that are more predictive of the response to LXR activation in humans.

When addressing the role of LXR modulation in immune cells, it is critical to

consider the species-specific regulation of TLR-4, which mediates the response to

LPS and is up-regulated by LXR agonists in human but not mouse macrophages

(Fontaine et al., 2007). Another example is the SMPDL3A (Sphingomyelin

Phosphodiesterase Acid-Like 3A) gene, which is regulated by LXRs in humans,

but not rodents, in a tissue-specific fashion (Noto et al., 2012). Although the exact

function of SMDPL3A is not yet known, it is intriguing to see that its regulation

by LXRs appears to be restricted to blood cells only.

Similarly, in human macrophages LXRα, but not LXRβ positively controls its

own expression upon activation with known LXR ligands and this effect has not

been observed in murine macrophages (Li et al., 2002). An additional example of

isoform-specific regulation is the AIM gene (also known as Spα), which is

induced by LXRα, but not LXRβ, in murine macrophages (Joseph et al., 2004).

28

CHAPTER 2: REGULATION OF SPHINGOMYELIN PHOSPHODIESTERASE, ACID-LIKE 3A GENE (SMPDL3A) BY LIVER X RECEPTORS Paul B. Noto, Yuri Bukhtiyarov, Meng Shi, Brian M. McKeever, Gerard M.

McGeehan and Deepak S. Lala.

Discovery Biology, Vitae Pharmaceuticals, Inc, Fort Washington, Pennsylvania

(PBN, YB, MS, BMM, GMM, DSL)

Department of Biology, Drexel University, Philadelphia, Pennsylvania (PBN)

29

Abstract Liver X receptors alpha (LXRα) and beta (LXRβ) function as physiological

sensors of cholesterol metabolites (oxysterols), regulating key genes involved in

cholesterol and lipid metabolism. LXRs have been extensively studied in both

human and rodent cell systems, revealing their potential therapeutic value in the

contexts of atherosclerosis and inflammatory diseases. The LXR genome

landscape has been investigated in murine macrophages but not in human THP-1

cells, which represent one of the frequently employed monocyte/macrophage cell

systems to study immune responses. We used a whole genome screen to detect

direct LXR target genes in THP-1 cells treated with two widely used LXR ligands

(T0901317 and GW3965). This screen identified the sphingomyelin

phosphodiesterase acid-like 3A (SMPDL3A) gene as a novel LXR regulated gene,

with an LXR response element (LXRE) within its promoter. We investigated the

regulation of SMPDL3A gene expression by LXRs across several human and

mouse cell types. These studies indicate that the induction of SMDPL3A is LXR-

dependent and is restricted to human blood cells with no induction observed in

mouse cellular systems.

30

2.1 Introduction Liver X receptors (LXRs) are nuclear hormone receptors that act as oxysterol

sensors, regulating genes involved in cholesterol and lipid metabolism (Janowski

et al., 1999). Elevated cholesterol levels can lead to enhanced oxysterol

production and the activation of LXRs, which increase the gene expression

(transactivation) of a number of target genes. The capacity of LXRs to promote

reverse cholesterol transport (RCT) via direct gene upregulation of several ATP-

binding cassette (ABC) transporters in macrophages and intestine (e.g.,

ABCA1/G1/G5/G8) makes them an attractive therapeutic target for the treatment

of atherosclerosis (Calkin and Tontonoz, 2010). Activation of LXRs in liver also

leads to induction of genes directly involved in lipid synthesis, such as sterol

regulatory element-binding protein-1c (SREBP1c), fatty acid synthase (FAS) and

stearoyl CoA desaturase (SCD) (Repa et al., 2000). Chronic LXR activation in

liver can cause hypertriglyceridemia and hepatosteatosis. LXRs have also been

shown to exert anti-inflammatory properties by suppressing genes involved in

inflammation, such as tumor necrosis factor alpha (TNFα), interleukins (IL-1β,

IL-6), cyclooxygenase 2 (COX-2), inducible nitric oxide synthase (iNOS) and

nuclear factor kappa B (NFκB) in murine macrophages (Joseph et al., 2003). The

immunomodulatory effects of LXRs rely on the association of LXRs with

corepressor complexes bound to transcription factors, such as NFκB, that

modulate the expression of inflammatory genes (transrepression) (Ghisletti et al.,

2007). An additional therapeutic indication for LXRs is in Alzheimer’s disease

(AD). LXR activation has been shown to increase the levels of the Apolipoprotein

E (ApoE) in murine and human macrophages (Mak et al., 2002) and in rat brain,

31

where increased ApoE has been positively associated with amyloid Aβ clearance

in AD models (Suon et al., 2010).

Although many metabolic pathways are conserved across species, LXRs can

regulate their target genes in a species-specific fashion. For instance, the CYP7A1

gene, the rate-limiting enzyme in bile acid synthesis, is activated by LXRs in

mouse, but not in human (Goodwin et al., 2003). Additionally, in human

macrophages, LXRα, but not LXRβ, has been shown to be involved in an

autoregulatory loop upon activation with known LXR ligands. Such an effect has

not been observed in murine macrophages (Li et al., 2002). Additionally, the Toll-

like Receptor 4 (TLR4), which is upregulated by LXR agonists in human but not

mouse macrophages (Fontaine et al., 2007).

The LXR genome landscape has been extensively studied in murine systems, but

has not been fully investigated in human THP-1 macrophages. THP-1 cells

represent one of the most frequently employed cell systems for studying the role

of LXRs in human macrophage biology. In this study we investigated LXR gene

regulation at the genome wide level in THP-1-derived macrophages in the

presence or absence of lipopolysaccharide (LPS). This survey led to the

identification of a novel LXR-regulated gene and an LXRE within its promoter.

LXRs activate the expression of the SMDPL3A gene, either in the presence or the

absence of LPS. This study focuses on the regulation of SMPDL3A by LXRs

across various cell types and tissues in human and rodent species. The SMPDL3A

gene was originally identified based on its sequence similarities with acid

Sphingomyelinase and its function has not been characterized so far other than its

increased expression and association with DBCCR1 (deleted in bladder cancer

chromosome region 1) in bladder cancer (Wright et al., 2002). Given the

32

biological importance of acid sphingomyelinases in activated macrophages

(Truman et al., 2011), we decided to further investigate the SMPDL3A gene

regulation by LXRs.

33

2.2 Material and Methods

The LXR ligands GW3965 and TO901317 were purchased from Tocris (catalog #

2474 and 2373). The RXR ligand LG100268 was purchased from Toronto

Research Chemicals, Inc. catalog # L397650.

2.2.1. Cell Culture and Transfection

THP-1 cells were maintained in RPMI 1640 medium with Glutamax (Invitrogen,

catalog # 61870127) supplemented with 10% fetal bovine serum (Hyclone,

catalog # SH30531), 50 μM β-Mercaptoethanol and antibiotics [penicillin (50

U/ml)-streptomycin (50 μg/ml), Invitrogen, catalog # 15070063] at 37°C under

5% CO2. Twenty-four hours before treatment, THP-1 cells were plated in 96-well

plates at a density of 5 x 104 cells/well in presence of 200 nM phorbol 12-

myristate 13-acetate (PMA, Sigma catalog # 79346). Cell were then incubated

with LXR ligands in RPMI 1640 medium with Glutamax supplemented with 10%

delipidated-fetal bovine serum (Hyclone, catalog # SH3085502HI) and

antibiotics.

HepG2 cells were maintained and routinely propagated in minimal essential

medium (Invitrogen, catalog # 0820234DJ) supplemented with 10% fetal bovine

serum and antibiotics at 37°C under 5% CO2.

CCD 1112 foreskin fibroblasts were maintained and routinely propagated in

Iscove's Modified Dulbecco's Medium (Invitrogen, catalog # 12440046)

supplemented with 10% fetal bovine serum and antibiotics at 37°C under 5%

CO2.

H4, HEK293 and RAW264.7 cells were maintained and routinely propagated in

Dulbecco’s modified Eagle’s medium (Invitrogen, catalog # 10566032)

34

supplemented with 10% fetal bovine serum and antibiotics at 37°C under 5%

CO2. H4, HEK293, RAW264, CCD 1112 and HepG2 were plated in 96-well

plates at a density of 4 x 104 cells/well and incubated for 24 hours with LXR

ligands in their respective medium supplemented with 10% delipidated-fetal

bovine serum and antibiotics.

For siRNA studies, 24 hours before transfection, THP-1 cells were plated in 96-

well plates at a density of 5 x 104 cells/well and differentiated with PMA, as

described above. Each transfection was carried out with either 30 nM of

scrambled siRNA (Invitrogen, catalog # AM4635,) or 30 nM LXR-specific

siRNA (LXRα, catalog # 4390824-s19568; LXRβ, catalog # 4390824-s14685,

Invitrogen) using 0.4 μl Lipofectamine RNAiMAX (Invitrogen, catalog #

13778075) in Opti-MEM Reduced Serum Medium (Invitrogen, catalog #

31985062).

Twenty-four hours after transfection, cells were washed once with DPBS and

treated with the LXR agonist in RPMI 1640 medium with Glutamax

supplemented with 10% delipidated-fetal bovine serum and antibiotics.

2.2.2. Gene expression microarray analysis. THP-1 cells were differentiated as described above and plated in 35 mm-dishes at

5 x 106 cells/dish. Twenty-four hours later, cells were pre-treated for 1 hour with

either DMSO or 1 μM T090 in delipidated FBS-containing media and then

incubated with either plain media or LPS-containing media (100 ng/ml) for an

additional 8 hours (LPS purchased from Sigma catalog# L2654).

35

Total RNA was isolated and purified using RNeasy columns (Qiagen). Reverse

transcription and hybridization on two Agilent Human GE 4 X 44K v2

Microarrays were carried out by MOgene LC (St. Louis, Missouri).

2.2.3. Analysis of the SMDPL3A expression in cells and tissues. For all cells treated in 96-well format, RNA was isolated and purified using ABI

Prism 6100 Nucleic Acid PrepStation (Applied Biosystems). cDNA was

synthesized and subjected to real-time PCR using One-Step RT-PCR reagents

(Applied Biosystems). Gene expression analysis was carried out according to the

method described by Bookout and Mangelsdorf (Bookout AL and Mangelsdorf

DJ, 2003).

cDNA from Human MTC™ Panels I and II were purchased from Clontech

(catalog# 636742 and 636743) and subjected to real-time PCR.

Whole blood from human donors was purchased from AllCells (catalog#

WB001).

Human PBMCs from the whole blood were collected in EDTA-containing tubes

and purified using standard Ficoll-Paque gradient centrifugation. Briefly, 15 ml of

blood was transferred to 50ml-tubes, diluted with 15mL of DPBS and underlayed

with 10 ml of Lymphocyte Separation Medium (9.4% Sodium Diatrizoate, 6.2%

Ficoll, MP Biomedicals, LLC, catalog # 50494X). The tubes were centrifuged for

60 min at 800 × g, with no brake. The cell interface layer was harvested carefully,

and the cells were washed three times in PBS (sedimented for 10 min at 800 × g)

and resuspended in RPMI 1640 medium with Glutamax supplemented with 10%

fetal bovine serum and antibiotics before counting. Cells were plated on 6-well

plates at a density of 3 x 106 cells/well and treated with the LXR ligand for 24

36

hours. The relative gene expression level was determined using ΔΔCt method. All

primer probe sets for the human genes were purchased from Applied Biosystems.

2.2.4. Animal studies

Male C57BL/6 mice (Charles River Laboratories) of approximately 11-13 weeks

of age were given a single daily dose, administered by oral gavage, of either

vehicle (1% Polysorbate-80 and 0.5% natrosol) or T090 at 30 mg/kg for four

consecutive days. Four animals per group were used. Four hours after the last

treatment (day four), blood was collected and preserved in RNAlater (Qiagen,

catalog # 76104) and animals were sacrificed by cervical dislocation; liver and

intestine tissues were collected and frozen in liquid nitrogen. RNA was isolated

from whole blood using Ribo Pure™-Blood kit (Invitrogen, catalog # AM1928);

RNA from the other tissues was isolated by lysis with QIAzol reagent and RNeasy

Columns (Qiagen). Total RNA was subjected to real-time PCR as described

above. Primer probe sets for the rodent genes were purchased from Applied

Biosystems.

2.2.5. SMPDL3A protein analysis. HEK293 cells were plated in 35mm-dishes at 5 x 106 cells/dish the day before

transfection. Each transfection mix contained either 5 μg of an empty control-

vector (OriGene, catalog # PCMV6XL4) or 5 μg of a Myc-DDK-tagged

SMDPL3A plasmid (OriGene, catalog # RC204332) with 30 μl of Lipofectamine

2000 (Invitrogen, catalog # 11668019) in Opti-MEM Reduced Serum Medium.

Twenty-four hours after transfection, both HEK293 cells and THP-1-macrophages

(treated with the LXR ligand, Fig. 2C) were lysed in cold RIPA buffer,

supplemented with protease inhibitors cocktail, and sonicated on a cup horn

37

(Fisher Scientific) for 2 minutes with 30 second-bursts. Cell lysates were cleared

by centrifugation for 10 minutes at 14,000 rpm at 4°C.

Lysates were subjected to Bradford assay for assessing protein concentration.

Western Blots were carried out by resolving 100 μg of protein from the total cell

lysates by SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4°C

with 1.7 μg/ml polyclonal anti-SMPDL3A antibody produced in mouse (Sigma,

catalog # SAB1400412) followed by the incubation with 1:2,000 diluted donkey

anti-mouse-HRP conjugate (Jackson ImmunoResearch Laboratories, catalog #

715-035-151). As a loading control, the blot was cut and stained with 1:5,000

diluted, HRP-conjugated, anti-β-actin antibody (GenScript, catalog # A00730).

2.2.6. Gel Mobility Shift Assays.

Purified human full-length LXRα, LXRβ, and RXRα were purchased from Protein

One (catalog# P1045, P1046 and P1022). Single strands containing the LXRE

response element in human SMDPL3A

(5’-GAAGGAAGAGGGGTTACTGGAGTTCAGTGGTCTGAA-3’) were

biotinylated using the Biotin 3’ End DNA Labeling Kit (Thermo Scientific,

catalog# 89818). Double-stranded oligonucleotides were annealed via

denaturation at 95°C for 1 minute followed by incubation at 70°C for 30 minutes.

Labeled probes were incubated with 20 ng of purified receptors in 10 mM Tris

(pH 7.5), 60 mM KCl, 0.02 mM EDTA, 2% glycerol and 1 mM DTT for 30 min

at room temperature. DNA-protein complexes were resolved on a 6%

polyacrylamide gel, electro blotted to nylon membrane, UV-crosslinked for 10

minutes and incubated with Streptavidin-HRP in blocking buffer for 15 minutes

(LightShift Chemoluminiscent EMSA Kit, Thermo Scientific, catalog# 20148).

38

2.2.7. Chromatin Immunoprecipitation Assays.

THP-1 cells were differentiated as described above in 150-mm dishes for 24

hours. T090 was added in delipidated-FBS containing media overnight for 16 h.

Cells were incubated with 1% formaldehyde for 10 minutes at room temperature.

Unreacted formaldehyde was neutralized with 0.125 M glycine. Cells were

washed twice with ice-cold PBS and scraped in cold PBS containing protease

inhibitors. Cells were collected and washed twice by centrifugation at 700 × g for

5 minutes at 4°C. Cell pellets were lysed in cold RIPA buffer with protease

inhibitors and chromatin was sheared via sonication on a cup horn for 6 minutes

with 30 second-bursts to yield an average DNA fragment length of approximately

500 bp. Lysates were clarified by centrifugation at 12, 500 × g for 5 min at 4°C.

Lysates were diluted 1:5 with ChIP dilution buffer and incubated overnight at 4°C

with the following antibodies: anti-LXRα (Abcam, catalog# ab41902) or mouse

IgG as a control (Invitrogen, catalog# 100005292). Immunoprecipitations and

DNA purifications were carried out as described by Novus Biologicals

(ChromataChIP Kit, NBP1-71709). DNA was used for quantitative PCR with

POWER SYBR mix (Applied Biosystems, catalog# 4367659) and the following

primers: hSMPDL3A-F-ACTCTGTGAGTCTTCACACCT, hSMPDL3A-R-

CTGAGAGGAGGCAGGAGAGTT. For the control genes, the following primers

were used: hABCA1-F-ACGTGCTTTCTGCTGAGTGA, hABCA1-R-

ACCGAGCGCAGAGGTTACTA, h36B4-F-ACGCTGCTGAACATGCTCAA,

h36B4-R-GATGCTGCCATTGTCGAACA (as described by Phelan et al., 2008).

39

2.3 Results

2.3.1 Genome Wide Gene Expression Analysis and validation by real time-PCR (RT-PCR) We used genome-wide microarray gene expression technology to identify novel

LXR regulated genes in THP-1 derived macrophages. Cells were treated with two

LXR synthetic agonists, T0901317 (T090) (Schultz et al., 2000) and GW3965

(Collins JL et al., 2002) in either the presence or the absence of LPS. Treatment

with LPS induced more than 400 genes, many of which are known to be regulated

by LXRs. Almost all of these genes to some degree were downregulated upon co-

treatment with the LXR ligands. Specifically, pro-inflammatory genes that were

induced by LPS, TNFα and IL-6, were mildly reduced (30%-40%) by both T090

and GW3965 (Fig. 1A). Additionally, the expression of chemokine (C-C motif)

ligand 4 (CCL4), also known as macrophage inflammatory protein 1β (MIP-1β),

was modestly reduced by both LXR ligands as had been previously observed in

murine macrophages (Joseph et al., 2003). The LXR agonists upregulated a

common set of 18 genes. This set includes most of all known LXR target genes

including, ABCA1, APOE and NR1H3 (LXRα) (Venkateswaran et al., 2000;

Laffitte et al., 2001; Li et al., 2002). In addition, one novel gene was identified in

this fashion, SMPDL3A. In the absence of LPS, both T090 and GW3965 induced

~4-5-fold increase in expression of the SMPDL3A gene. Treatment with LPS

lowered SMPDL3A expression by half. Both T090 and GW3965 were able to

increase gene expression even in presence of LPS. The negative effect of LPS on

gene expression was also observed for other genes, such as the ABC transporters,

apolipoproteins and the genes involved in lipid synthesis, but not for the LXR

genes.

40

We validated the microarray results for the CCL4 and SMPDL3A genes by

quantitative RT-PCR. The downregulation of the CCL4 gene by both T090 and

GW3965 in the presence of LPS was confirmed by RT-PCR. As shown in figure

1B, both compounds significantly reduce mRNA levels of CCL4. In addition,

treatment of macrophages with either T090 or GW3965 induced the gene

expression of SMDPL3A by several folds (Fig. 1C), confirming the findings from

the microarray chip.

2.3.2 Expression of SMPDL3A is induced by LXR agonists.

SMPDL3A may be functionally related to other sphingomyelinases. Several of

these, e.g., SMPD1 and SMPD2 and SMPDL3B, were shown to be upregulated by

LXR activation in mouse skin keratinocytes (Chang et al., 2008). We measured

the effect of T090 treatment on the expression of the sphingomyelin

phosphodiesterase family in THP-1 macrophages. Since none of these were

differentially regulated by the LXR agonists in the genome-wide gene expression

analysis (data not shown), we analyzed the mRNA levels of four

sphingomyelinases and the analog of SMPDL3A, SMPDL3B, by RT-PCR in

THP-1 cells. Interestingly, SMPDL3A appears to be the only gene related to the

sphingomyelinase phosphodiesterase family that is induced by the LXR agonists

in both THP-1 monocytes and the PMA-differentiated macrophages (Fig. 2A).

The activation of the SMPDL3A gene expression was also confirmed to be

concentration-dependent for T090, with a calculated EC50 value of ~80 nM (Fig.

2B), which corresponds to the cellular potency of T090 typically observed in

Gal4-LXR reporter assays (data not shown). Additionally, the levels of

SMDPL3A protein increased in a concentration-proportional manner upon T090

41

treatment of THP-1 macrophages (Fig. 2C). Specificity of the antibody used for

analysis of SMPDL3A protein expression was demonstrated by immunostaining

of cell lysate from HEK293 cells transiently transfected with a vector encoding

the full-length human SMPDL3A fused to Myc-DDDDK tag at the C-terminus

(Supplemental Figure 1).

In order to discern the dynamics of the SMPDL3A gene induction by LXR

agonists, SMPDL3A mRNA levels were measured 4, 8 and 24 hours after

addition of T090 to THP-1 macrophages with and without stimulation with LPS

(Fig.2D). LPS suppressed basal expression of SMPDL3A by 78% and 72% at 4

and 8 hours, respectively, similar to the effect observed in the genome-wide gene

expression analysis. The suppressive effect of LPS on the base-line SMPDL3A

expression was significantly reduced at 24 hours, with only 25% decrease in

expression levels versus controls. T090 was able to increase gene expression at all

time points in a time-dependent manner, regardless of whether THP-1

macrophages were stimulated with LPS. Significant induction is seen within 4

hours reaching near maximal effect at 8 hours.

2.3.3. Knockdown of LXRs in THP-1-derived macrophages reduces the

expression of the SMPDL3A gene.

To examine whether the transcriptional regulation of the SMDPL3A gene is

indeed mediated by LXRs, we monitored the gene expression of SMDPL3A over

time in THP-1 macrophages incubated with an LXR ligand (T090) and transfected

with siRNA for LXRα, LXRβ or both (Fig. 3A). The absolute mRNA levels of

SMPDL3A (normalized to the scrambled siRNA-controls) were reduced after

silencing the LXR isoforms individually or together, implying possible

42

involvement of both LXR isoforms in the regulation of SMDPL3A. Treatment

with T090 led to significant upregulation of SMPDL3A over time when individual

LXR isoforms were knocked down, reflecting overlap in function of LXRα and

LXRβ for induction of the SMPDL3A gene expression. Less pronounced but still

significant stimulation of SMPDL3A expression by T090 was observed in the

double-knockdown experiment. This residual activation is most likely due to

incomplete silencing of both LXR isoforms - approximately ~75% and 85% for

LXRα and LXRβ, respectively, assessed by RT-PCR analysis (Supplemental

Figure 2).

2.3.4. Both Retinoid X Receptor (RXR) and LXR ligands induce SMPDL3A

gene expression.

LXRs require RXRs as obligate heterodimer partners to bind to their cognate

response elements, which can be activated by both RXR and LXR ligands (Willy

et al., 1995). To test whether the SMDPL3A gene can be induced by an RXR

ligand, we treated THP-1 macrophages with a known RXR agonist, LG100268

(Boehm et al., 1995). T090 and LG100268 were applied to THP-1 macrophages at

sub-optimal concentrations (Fig.2B; Li et al., 2002). Each compound significantly

induced SMPDL3A gene expression (Fig. 3B). When compounds were applied

together, the extent of the SMPDL3A induction appeared to be the sum of the

effects seen with either RXR or LXR agonist alone. Like LXRs, the peroxisome

proliferator-activated receptor gamma (PPARγ) functions as a heterodimer with

RXRs (Bardot et al., 1993; Gearing et al., 1993). We treated THP-1 macrophages

with Rosiglitazone, a known PPARγ agonist (Lehmann et al., 1995), and failed to

observe induction of the SMPDL3A gene expression (Supplemental Figure 3).

43

2.3.5 LXR directly interacts with LXR response element in SMPDL3A

promoter region.

We identified a putative LXR response element (LXRE) in the promoter region of

the SMPDL3A gene (Pehkonen et al., 2012) based on sequence homology to a

consensus LXRE motif (Sandelin and Wasserman, 2005). Duplex

oligonucleotides containing the base pairs 2105-2120 of the SMPDL3A gene

(NC_000006.11, bp 123109971…123130865 of Chromosome 6) exhibited

specific binding to a heterodimer of the full-length LXRα/β and RXRα proteins.

The DNA duplex recruited none of the proteins as either monomers or

homodimers (Fig. 4A). The labeled DNA can be displaced from the protein-DNA

complex with the unlabeled duplex DNA having the same sequence.

In order to demonstrate direct interaction of LXR with the promoter region of

SMPDL3A within a cell we conducted Chromatin Immunoprecipitation (ChIP) in

THP-1 macrophages with LXRα-specific antibodies and analyzed the abundance

of the LXRE DNA by real-time PCR (Fig. 4B). Treatment of the cells with LXR

agonist T0901317 led to a significant increase in the amount of the SMPDL3A

LXRE DNA in the immunoprecipitated material, similar to the DNA of a known

LXR target, ATP binding cassette (ABC) transporter A1.

2.3.6. LXRs regulate the SMPDL3A gene in a cell type-specific fashion in

human cells.

Next, we investigated the expression levels of the SMDPL3A gene in multiple

human tissues. The expression levels of the SMPDL3A gene across all human

tissues were normalized to spleen tissue, which showed the lowest level of

expression. Kidney, colon with mucosa lining, placenta, lung and liver showed the

44

highest relative expression of the gene (Fig. 5A). We then analyzed various

immortalized cell lines derived from the tissues expressing low and high levels of

SMPDL3A. As shown in Figure 5B, no SMPDL3A gene induction by T090 was

observed in human H4 neuroglioma cells, CCD-1112 skin fibroblasts, HepG2

hepatocytes and HEK293 kidney cells. Control studies showed that known LXR

target genes were robustly induced in these cell lines by T090: ABCA1 in

neuronal cells, HEK293 and skin fibroblasts and SREBP1c in HepG2 cells (see

supplemental data). In order to rule out the possibility that regulation of

SMDPL3A by LXRs is restricted to an immortalized cell line, such as THP-1

from acute monocytic leukemia, we measured the effects of T090 on human

peripheral blood mononuclear cells (PBMCs) isolated from two healthy donors.

As shown in Figure 5C, treatment with T090 led to robust SMPDL3A and

ABCA1 gene induction in the PBMCs from both donors.

2.3.7. SMPDL3A is not induced by LXRs in mice.

In contrast to human monocytes, the Smpdl3a gene induction was not observed in

RAW264.7 mouse macrophages treated with T090 (Fig. 6A). We also analyzed

expression levels of Smpdl3a in blood, liver and intestine in mice treated with

either vehicle or 30 mg/kg of T090 for four days. While T090 treatment strongly

induced known target genes, Abca1 and Srebp1c, the expression levels of

Smpdl3a remained unaffected by the LXR ligand in blood, intestine or liver (Fig.

6B). These data imply that regulation of SMPDL3A gene by LXR occurs in

human monocytes and macrophages but does not occur in murine tissues.

45

2.4 Discussion

In order to identify novel LXR target genes in THP-1 macrophages, we analyzed

genome-wide expression profiles of forty-four thousand genes using microarray

gene expression analysis in THP-1 macrophages with and without stimulation of

inflammatory response with LPS. The validity of the gene expression results was

supported by robust induction of the genes that had been previously ascribed to

regulation by LXRs. Anti-inflammatory properties of LXRs in THP-1

macrophages appear to be not as strong as those observed with steroidal

glucocorticoid receptor (GR) agonists (Auphan et al., 1995). However, the overall

down-regulation of the expression of several cytokines, including chemokines

such as CCL1, CCL4 and chemokine (C-X-C motif) ligand 3 (CXCL3) reflects an

LXR-mediated transrepression of proinflammatory genes tuning down the

attraction of additional monocytes to atherosclerotic foam macrophages.

The novel LXR target gene, SMPDL3A, was originally identified based on its

sequence similarity with acid sphingomyelinases-phosphodiesterases. The

function of the protein has not been characterized so far, other than its increased

expression and association with DBCCR1 protein in bladder cancer. Given the

biological importance of acid sphingomyelinases in activated macrophages

(Truman et al., 2011), we decided to further investigate the SMPDL3A gene

regulation by LXRs.

We confirmed the microarray findings by real-time PCR quantitation of the

SMPDL3A mRNA in THP-1 macrophages treated with two known LXR ligands,

T090 and GW3965. We saw strong induction of the gene expression by both LXR

agonists demonstrating that the SMPDL3A gene is indeed the target of LXR

transcriptional activity in THP-1 cells. The induction of the SMPDL3A gene by

46

the RXR agonist LG100268 alone and its additive effect with the LXR-mediated

transcription of the gene further supports direct regulation of the SMDPL3A gene

by LXR/RXR heterodimers. While working on the manuscript we became aware

of the recent study (Pehkonen et al., 2012) where two LXR peaks within the

transcription start site of the SMDPL3A gene were detected in THP-1

macrophages by ChIP-Seq analysis. We used this information for identifying an

LXRE sequence within the region pinpointed by the ChIP-Seq study and

demonstrated direct interaction of LXR with this region by EMSA and ChIP

analyses. To investigate the cell specific activity we also carried out ChIP analysis

in HepG2 cells and observed that LXR is recruited to the SMPDL3A promoter in

response to ligand (data not shown) indicating that the cell-specific activation by

LXRs must lie in the differential recruitment of cofactors to LXR, similar to what

has been described for the Estrogen Receptors (Shang and Brown, 2002). Taken

together, these results unequivocally prove that LXR has an active role in

transcriptional control of SMPDL3A gene expression.

LPS appears to suppress the expression of SMPDL3A at least by two-fold, and

this effect wanes over time. We have also observed a similar effect in RAW264

murine macrophages upon treatment with LPS (data not shown). Similar down-

regulation of sphingomyelinase activity by pertussis toxin (PTX), also a TLR-4

ligand, had been described by Wang et al. (2007), who showed that the PTX

treatment prolongs macrophage survival by inhibiting acid sphingomyelinase

activity. The effect of the LXR agonists does not depend on the stimulation of

THP-1 macrophages with LPS. T090 induced the SMPDL3A gene expression

with and without LPS. Knockdown of both LXR isoforms followed by the

treatment with T090 showed significant reduction in the expression levels of

47

SMPDL3A demonstrating that the gene is under direct control of LXR, and both

LXR isoforms contribute to the stimulation of the SMPDL3A gene expression.

Collectively, the data indicate SMPDL3A is a direct LXR target gene.

We were intrigued by the observation that SDMPL3A was the only gene

belonging to the sphingomyelinase family to be regulated by LXRs. This may

suggest that SMPDL3A has functions other than sphingomyelinase and

phospodiesterase activities. The fact that the protein levels of SMPDL3A increase

in a concentration-dependent fashion in the T090-treated THP-1 macrophages

implies a functional role of SMPDL3A in leukocytes.

The cell-type specificity of the SMDPL3A regulation by LXRs is also very

interesting phenomenon. The expression of the SMPDL3A gene appears to be

controlled by LXRs in monocytes and macrophages, immortalized cells derived

from monocytic leukemia, and primary cell cultures from healthy donors.

However, no LXR-mediated induction of the SMPDL3A gene was observed in

kidney, liver, skin fibroblasts and neuroglioma immortalized cell lines. Expression

of SMPDL3A is not restricted only to leukocytes. The gene is widely expressed

among human tissues. The significantly higher gene expression levels of

SMDPL3A in kidneys and colon may suggest a particular functional role of this

gene in epithelial cells. Further analysis of SMPDL3A expression in primary cell

cultures will be helpful in assessing the significance of the tissue-specific

regulation of this gene by LXRs. The induction of the SMPDL3A gene by LXRs

may be species-specific, since no increase in gene expression could be observed in

murine macrophage-like cells (RAW264.7) nor any changes had been detected in

three different tissues, including blood, collected from the mice treated with T090.

48

Further work is in progress on elucidation of the functions of SMPDL3A and the

role of LXR-mediated induction of this gene in human monocytes and

macrophages.

2.5 References Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 270 (5234): 286-90.

Bardot O, Aldridge TC, Latruffe N, and Green S (1993). PPAR-RXR heterodimer activates a peroxisome proliferator response element upstream of the bifunctional enzyme gene. Biochem. Biophys. Res. Commun. 192: 37-45. Boehm MF, Zhang L, Zhi L, et al. (1995) Design and synthesis of potent retinoid X receptor selective ligands that induce apoptosis in leukemia cells. J Med Chem; 38: 3146-55. Bookout AL and Mangelsdorf DJ (2003) Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways Nuclear Receptor Signaling 1:e012 Calkin AC, Tontonoz P, Liver X Receptor Signaling Pathways and Atherosclerosis (2010) Arterioscler Thromb Vasc Biol. 30 (8): 1513-8

Chang KC, Shen Q, Oh IG, Jelinsky SA, Jenkins SF, Wang W, Wang Y, LaCava M, Yudt MR, Thompson CC, Freedman LP, Chung JH, Nagpal S (2008) Liver X receptor is a therapeutic target for photoaging and chronological skin aging. Mol Endocrinol. 22 (11): 2407-19

Collins JL, Fivush AM, Watson MA, Galardi CM, Lewis MC, et al. (2002) Identification of a nonsteroidal liver X receptor agonist through parallel array synthesis of tertiary amines. J Med Chem. 45 (10): 1963-6.

Fontaine C, Rigamonti E, Nohara A, Gervois P, Teissier E, Fruchart JC, Staels B, Chinetti-Gbaguidi G (2007) Liver X receptor activation potentiates the lipopolysaccharide response in human macrophages. Circ Res.101 (1): 40-9.

Gearing KL, Göttlicher M, Teboul M, Widmark E, Gustafsson JA (1993) Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci USA 90 (4): 1440-4.

Ghisletti S, W Huang, Ogawa S, Pascual G, Lin ME , Willson TM, Rosenfeld MG, Glass CK (2007) Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARγ. Mol. Cell. 25: 57-70.

49

Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA (2003) Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha Mol Endocrinol. 17 (3): 386-94.

Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, Mangelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRa and LXRb Proc Natl Acad Sci 96 (1): 266-71

Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P (2003) Reciprocal regulation of inflammation and lipid metabolism by liver X receptors Nat. Med. 9 (2): 213-9. Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ, Tontonoz P (2001) LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes Proc Natl Acad Sci USA. 98 (2): 507-12.

Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA (1995) An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem. 270 (22): 12953-6.

Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, Lala DS (2002) Induction of human liver X receptor α gene expression via an autoregulatory loop mechanism Mol. Endocrinol. 16 (3): 506-14. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors alpha and beta J Biol Chem. 277: 31900–31908.

Pehkonen P, Welter-Stahl L, Diwo J, Ryynanen J, Wienecke-Baldacchino A, Heikkinen S, Treuter E, Steffensen KR, Carlberg C (2012) Genome-wide landscape of liver X receptor chromatin binding and gene regulation in human macrophages BMC Genomics 13 (1): 50.

Phelan CA, Weaver JM, Steger DJ, Joshi S, Maslany JT, Collins JL, Zuercher WJ, Willson TM, Walker M, Jaye M, Lazar MA (2008) Selective partial agonism of liver X receptor alpha is related to differential corepressor recruitment Mol Endocrinol. 22 (10): 2241-9

Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000) Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta Genes Dev. 14 (22): 2819-30. Sandelin A and Wasserman WW (2005) Prediction of nuclear hormone receptor response elements Mol Endocrinol. 19 (3): 595-606

50

Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B (2000) Role of LXRs in control of lipogenesis Genes Dev.14 (22): 2831-8. Shang Y and Brown M (2002) Molecular determinants for the tissue specificity of SERMs Science 295 (5564): 2465-8. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats Mol Neurodegener. 29: 5:44. Truman JP, Al Gadban MM, Smith KJ, Hammad SM (2011) Acid sphingomyelinase in macrophage biology Cell Mol Life Sci. 68 (20): 3293-305. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha Proc Natl Acad Sci USA. 97 (22):1 2097-102. Wang SW, Parhar K, Chiu KJ, Tran A, Gangoiti P, Kong J et al (2007) Pertussis toxin promotes macrophage survival through inhibition of acid sphingomyelinase and activation of the phosphoinositide 3-kinase/protein kinase B pathway Cell Signal 19 (8): 1772-1783. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ (1995) LXR, a nuclear receptor that defines a distinct retinoid response pathway Genes Dev. 9 (9): 1033-45. Wright KO, Messing EM, Reeder JE (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors J Urol. 168 (6): 2645-9.

51

2.6. Figure Legends Figure 1. A, Results of the genome-wide analysis of human genes in THP-1

macrophages. Transactivation of known LXR target genes by T090 (T) and

GW3965 (G) and LXR-mediated transrepression of LPS-induced genes. Cells

were pre-treated with either 1 μM T090 or GW3965 for 1 hour and then incubated

for 8 hours with either LPS-containing- or plain media. SMPDL3A is identified as

a novel LXR target gene. B, Regulation of CCL4 by LXRs confirmed via RT-

PCR (THP-1 macrophages treated the same way as for the genome-wide

analysis). C, Relative expression of the SMDPL3A gene in THP-1-macrophages

treated with 1 μM of either LXR ligand for 8 hours. Data represent mean ± SD

(n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.

Figure 2. Regulation of the SMPDL3A gene by LXRs in THP-1 cells.

The relative expression of all genes analyzed was measured by real-time PCR.

A, Relative expression of human sphingomyelinases in THP-1 cells (monocytes

versus derived-macrophages) treated with 1μM T090 for 24 hours.

B, Concentration-dependent SMDPL3A gene induction by T090 in THP-1

macrophages. The extrapolated EC50 is ~ 80 nM. C, Western Blot analysis of

SMPDL3A expression in THP-1-derived macrophages treated with either DMSO

(lane 1) or T090 at 50, 500 and 5,000 nM for 24 hours (lanes 2-4). 100 μg of total

cell lysates were resolved by SDS-PAGE, blotted to nitrocellulose, and stained

with 1.7 μg/ml anti-SMPDL3A followed by DAM-HRP (1:2,000). D, Time-

dependent SMPDL3A gene up regulation by 1 μM T090 with and without 100

ng/ml LPS. For each time point, the “DMSO+LPS” data (ΔΔCt) was normalized

52

to “DMSO” data (ΔCt) and the “T090+LPS” data was in turn normalized to the

“DMSO+LPS” data. Data represent mean ± SD (n=4). *p < 0.05, **p<0.01,

***p<0.001 as determined by Student’s t-test.

Figure 3. A, LXR-mediated induction of the SMPDL3A gene. THP-1

macrophages were treated with either scrambled siRNA or LXRα/β siRNA for 24

hours and incubated with the LXR ligand for 4, 8 and 24 hours. B, Treatment with

either 30 nM of either T090 or LG100268 for 18 hours leads to SMDPL3A gene

induction. Data represent mean ± SD (n=4). *p < 0.05, **p<0.01, ***p<0.001 as

determined by Student’s t-test.

Figure 4. Cell type-specific induction of the SMDPL3A gene by LXRs.

A, Relative expression of the SMPDL3A gene across a panel of human tissues

(Clontech Human MTC™ Panels I and II). Data normalized to spleen tissue

(lowest expression) B, SMPDL3A mRNA levels in several cell-lines treated with

three different concentrations of T090 for 24 hours. C, Significant induction of the

SMPDL3A and ABCA1 (control) genes by T090 in human peripheral blood

mononuclear cells isolated from two healthy donors. Data represent mean ± SD

(n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.

Figure 5. Identification of a DR-4 type LXRE within the human SMPDL3A gene.

A, Electromobility Shift Assays (EMSAs) using purified full-length LXRs and

RXRα with the DR4-LXRE sequence identified within the SMPDL3A gene

(2095-2130). Both LXRα:RXRα and LXRβ:RXRα bind to the LXRE (lanes 4 and

7, respectively). Excess of non-biotinylated probe (200X) abolishes the interaction

53

of the LXR:RXR heterodimers with the Biotin-LXRE (lanes 5 and 8). B,

Chromatin Immunoprecipitation Assays (ChIP) for THP-1 macrophages.

Treatment with 5μM T090 for 24hr increases the occupancy of LXRα within the

SMDPL3A gene. The known LXR target gene, ABCA1, was included in the

analysis as a positive control. ChIP signal was normalized to nonspecific DNA

region spanning the 36B4 gene, and data represent mean ± SD (n=4). Data are

from a representative experiment repeated three times with similar results.

*p<0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.

Figure 6. Analysis of gene expression for Smpdl3a in mouse tissues. A,

Treatment with T090 at various concentrations for 24 hours does not induce the

gene expression of Smpdl3a in RAW264.7 macrophages as opposed to the control

LXR target-gene, Abca1. B, Gene expression analysis of Smpdl3a in tissues

collected from mice treated with either vehicle or 30 mpk T090 for four days.

Data represent mean ± SD (n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined

by Student’s t-test.

54

Fig. 1A

55

Fig. 1B

56

Fig. 1C

57

Fig. 2A

58

Fig. 2B

59

Fig. 2C

β-Actin

SMPDL3A

60

Fig. 2D

61

Fig. 3A

62

Fig. 3B

63

Fig. 4A

64

Fig. 4B

65

Fig. 5A

66

Fig. 5B

67

Fig. 5C

68

Fig. 6A

69

Fig. 6B

70

CHAPTER 3: LXR TRANSCRIPTOME IN CYNOMOLGUS MONKEY BRAIN

Paul B. Noto1,2, Yuri Bukhtiyarov1, Gerard M. McGeehan1 and Deepak S. Lala1.

1Discovery Biology, Vitae Pharmaceuticals, Inc, Fort Washington, Pennsylvania

2Department of Biology, Drexel University, Philadelphia, Pennsylvania (PBN)

71

Abstract Recent evidence has established a critical role for LXRs in lipid metabolism in the

central nervous system (CNS), and these receptors have emerged as attractive

targets for the treatment of Alzheimer’s disease (AD). In mouse brain, activation

of LXRs induces both abca1 and apoE levels, leading to increased Aβ clearance.

Benefits of LXR modulators on cognition and amyloid load in the brain have been

demonstrated in several rodent models of AD. Nonetheless, the ABCA1-ApoE-

dependent Aβ clearance has not yet been investigated in higher species, such as

non-human primates. Therefore, we treated Cynomolgus monkeys with a potent,

CNS-penetrant, LXRβ-selective agonist (VTP-5) for 14 days and examined the

effect on ABCA1 and ApoE gene expression as well as Aβ levels in cerebral

cortex and hippocampus.

The LXR modulator significantly increased the expression of ABCA1 and ApoE

in the brain with a concomitant decrease in hippocampal Aβ42 levels. Here, we

also show auto-induction of LXRα in monkey brain, but not liver. This has only

been shown in human cells but not rodents. Additionally, we investigated

modulation of the LXR transcriptome by VTP-5 in Cynomolgus brain via RNA-

sequencing. Our findings revealed the upregulation of apolipoprotein AI (Apo-AI)

by VTP-5, strengthening the role of LXRs at the cerebrovascular level. Taken

together with the key aspects of LXR-mediated effects on AD markers in non-

human primates, our data further validate LXRs as attractive targets for the

treatment of AD in humans.

72

3.1 Introduction Liver X receptors (LXRs) are nuclear hormone receptors that act as oxysterol

sensors, regulating genes involved in cholesterol and lipid metabolism (Janowski

et al., 1999). Whenever the intracellular levels oxysterols rise, as the result of

excessive cholesterol, LXRs activate ATP-binding cassette (ABC) transporters,

such as ABCA1/G1/G5/G8, to promote cholesterol efflux to high-density

lipoproteins (HDL) particles, via specific interaction with Apo-AI (Chambenoit et

al., 2001). Although LXRs represent attractive therapeutic targets for the

treatment of atherosclerosis, due to their ability to promote reverse cholesterol

transport (RCT) upon activation by both natural and synthetic agonists (Joseph et

al., 2002), a compelling undesired effect is the parallel activation of sterol

regulatory element-binding protein-1c (SREBP1c) (Repa et al., 2000) and

upregulation of several other genes involved in fatty acid synthesis such as Fatty

Acid Snythase (FAS) and Acetyl-CoA Carboxylase (ACC) leading to lipogenesis

(Calkin and Tontonoz, 2010).

LXRα and LXRβ are diversely expressed in tissues. While LXRα is primarily

expressed in liver, intestine, adipose tissue and macrophages, LXRβ is present in

all tissues and organs (Annicotte et al., 2004; Su et al, 2004). Given the higher

levels of expression of LXRα in liver, with respect to LXRβ, LXRα has been

suggested to be major driver for the upregulation of lipogenic genes upon

activation with ligands. Therefore, development of LXRβ-selective synthetic

ligands may represent a therapeutic advantage by limiting activation of LXRα in

liver (Bradley et al., 2007).

Although the LXR signaling pathway is mostly conserved across species, LXRs

can also regulate their target genes in a species- and isoform-specific fashion.

73

Examples of genes differentially regulated across species include CYP7A1, the

rate-limiting enzyme in bile acid synthesis, which is activated by LXRs in mouse

but not in human (Goodwin et al., 2003) and the Toll-like receptor 4 (TLR4),

which is up-regulated by LXR agonists in human but not mouse macrophages

(Fontaine et al., 2007). Another example is the SMPDL3A (Sphingomyelin

Phosphodiesterase Acid-Like 3A) gene, which is regulated by LXRs in humans,

but not rodents, in a tissue-specific fashion (Noto et al., 2012). Similarly, in

human macrophages LXRα, but not LXRβ, positively controls its own expression

upon activation with known LXR ligands and this effect has not been observed in

murine macrophages (Li et al., 2002). An additional example of isoform-specific

regulation is the AIM gene (also known as Spα), which is induced by LXRα, but

not LXRβ, in murine macrophages (Joseph et al., 2004)

Recently, modulation of LXRs has been proposed for the treatment of

Alzheimer’s disease. Several studies have demonstrated that activation of LXRs

results in increased apolipoprotein E (ApoE) levels in murine and human

macrophages (Mak et al., 2002; Jiang et al., 2003) and in rat brain, in which

higher levels of lipidated apolipoprotein E positively correlate with amyloid Aβ

clearance (Suon et al., 2010). The clearance process requires the transfer of

intracellular cholesterol via ABCA1 onto interstitial ApoE (Wharle et al., 2004;

Hirsch-Reinshagen et al., 2005) to form HDL-like particles (Fagan et al., 1999).

Importantly, lipidation of ApoE appears to be required in order to enhance both

degradation and efflux of the neurotoxic amyloid peptides, Aβ40 and Aβ42

(Tokuda et al., 2000; Morikawa et al., 2005; Bell et al., 2007). Treatment with

LXR modulators has been proven beneficial in several rodent models of AD, by

74

improving cognitive functions and reducing amyloid load in brain (Jiang et al.,

2008; Fitz et al., 2010).

Here we demonstrate that treatment of Cynomolgus monkeys for 14 days with a

potent, bioavailable and brain-penetrant LXR modulator (VTP-5) leads to

increased levels of ABCA1 and ApoE in the brain, with a concomitant decrease in

Aβ42 levels in hippocampus. For the first time in non-human primates, we also

show auto-induction of LXRα in the brain, but not in the liver. Most

importantly, RNA-sequencing of Cynomolgus brain tissue revealed new insights

on modulation of gene expression by LXRs.

75

3.2 Material and Methods

VTP-5 was synthesized at Vitae Pharmaceuticals, Inc. The LXR ligands GW3965

and TO901317 were purchased from Tocris (catalog # 2474 and 2373).

3.2.1. Cell Culture and treatment of CCF-STTG1 cells

Cells were purchased from ATCC (catalog # CRL-1718) and maintained in

RPMI 1640 medium with Glutamax (Invitrogen, catalog # 61870127)

supplemented with 10% fetal bovine serum (Hyclone, catalog # SH30531) and

antibiotics [penicillin (50 U/ml)-streptomycin (50 μg/ml), Invitrogen, catalog #

15070063] at 37°C under 5% CO2. Twenty-four hours before treatment, CCF-

STTG1 cells were harvested and plated in 6-well plates at a density of 2.5 x 105

cells/well and incubated overnight with complete growth medium for attachment.

Medium was replaced with RPMI 1640 medium with Glutamax supplemented

with 0.2% fatty acid-free bovine serum albumin (Sigma, catalog # A6003) and

incubated for an additional 24 hours. Cells were treated for 48 hours with DMSO

or LXR ligands as described in figure legends.

3.2.2. ApoE protein analysis in human CCF-astrocytes.

Cell supernatants were collected prior to lysing cells. Briefly, cells were lysed in

cold RIPA buffer, supplemented with protease inhibitors cocktail, and sonicated

on a cup horn (Fisher Scientific) for 2 minutes with 30 second-bursts. Cell lysates

were cleared by centrifugation for 10 minutes at 14,000 rpm at 4oC.

Lysates were subjected to Bradford assay for assessing protein concentration.

Western Blots were carried out by resolving 100 μg of protein from the total cell

lysates by SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4oC

76

with 1:1,000 diluted polyclonal anti-ApoE antibody produced in goat (EMD,

catalog # 178479) followed by the incubation with 1:30,000 diluted rabbit anti-

goat-HRP conjugate (EMD, catalog # 401515). As a loading control, the blot was

cut and stained with 1:20,000 diluted, HRP-conjugated, anti-β-actin antibody

(GenScript, catalog # A00730).

3.2.3. Experimental protocol for monkey studies

Cynomolgus monkeys (Macaca fascicularis) (non-naïve) were used for this study.

The monkeys were housed and treated at the testing facility of SNBL USA, Ltd.

(Everett, WA 98203). A total of 16 monkeys were randomized into four groups

(four per treatment group; all males, 3.4–6.3 kg, 4–8 years of age) and treated via

nasogastric (NG) intubation with vehicle or VTP-5 at doses of 0.1, 0.3 and 1

mg/kg/day once daily for 14 days, within 2 hours of lights on. The diet was

routinely analyzed for contaminants and found to be within the manufacturer’s

specifications. Food analysis records were maintained at the testing facility.

Animals were fed twice a day and food was withheld for at least 4 hours post-

dose. The vehicle used for the study contained 0.5% Natrosol and 1% Polysorbate

80 in water. VTP5 was prepared in this vehicle. Body weights were assessed twice

during acclimation, including the day prior to the first dosing (day 1), and then

weekly throughout the dosing phase. A blood sample was obtained from all

animals two days prior to initiation of dosing (pre-dose baseline), between 4 and 6

hours after lights on. Blood was collected at 4 hours (prior to feeding) and 8

hours post dose on days 1, 3, 5, 7, 11 and 14. On day 14, animals were sedated

with an IM injection of ketamine and anesthetized with an intravenous injection of

Euthasol® followed by exsanguination. Tissue samples from the left cerebrum,

77

left lobe of the liver and duodenum were collected and snap frozen in liquid

nitrogen. Additionally, the right hippocampus was split into 5 sections (~0.1 cm3)

and transferred to a cassette, snap frozen and stored at -60ºC. Animals were

treated in accordance with standard procedures for veterinary care and in

compliance with USDA and animal welfare guidelines.

3.2.4. Gene expression analysis in cells and tissues.

Total RNA from CCF-astrocytes was isolated using RNeasy columns (Qiagen),

following the manufacturer’s instructions.

Approximately 50 mg of frozen cerebrum and liver tissue was homogenized in 1

mL of QIAzol reagent followed by addition of 0.5 mL chloroform. Samples were

vortexed and centrifuged at 14,000 rpm for 15 minutes at 4ºC. The aqueous phase

was recovered and isolation of total RNA was performed using RNeasy columns

(Qiagen), following the manufacturer’s instructions.

cDNA was synthesized and subjected to real-time PCR using One-Step RT-PCR

reagents (Applied Biosystems). Primer probe sets for all genes analyzed were

purchased from Applied Biosystems. Gene expression analysis was carried out

according to the method described by Bookout and Mangelsdorf (Bookout AL and

Mangelsdorf DJ, 2003).

3.2.5. ABCA1, ApoE and Apo-AI protein analysis in monkey cerebrum.

Approximately 50 mg of frozen cerebrum tissue was homogenized in 10 volumes

of cold RIPA buffer, supplemented with protease inhibitors cocktail. Lysates were

incubated on ice for 30 minutes and cleared by centrifugation for 30 minutes at

14,000 rpm at 4ºC. Lysates were subjected to Bradford assay for assessing protein

concentration. Lysates from the animals of each group were pooled and Western

78

Blots were carried out by resolving 60 μg of protein from the total cell lysates by

SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4ºC with the

following primary antibodies diluted 1:1,000: monoclonal anti-ABCA1 antibody

produced in mouse (Abcam, catalog # ab18180), monoclonal anti-Apo-AI

antibody produced in mouse (Cell Signaling, catalog # 3350), 1:1,000 diluted

polyclonal anti-ApoE antibody produced in goat (EMD, catalog # 178479).

ABCA1 and Apo-AI blots were then incubated with 1:5,000 diluted donkey anti-

mouse-HRP conjugate (Jackson ImmunoResearch Laboratories, catalog # 715-

035-151).

The ApoE blot incubation with 1:30,000 diluted rabbit anti-goat-HRP conjugate

(EMD, catalog # 401515). As a loading control, an additional blot was stained

with 1:20,000 diluted, HRP-conjugated, anti-β-actin antibody (GenScript, catalog

# A00730).

3.2.6. Analysis of Aβ peptides levels in monkey cerebra and hippocampi. 30-70 mg of either cerebra or hippocampi samples were homogenized in 3

volumes of lysis buffer (20 mM TRIS-HCl, pH 8; 0.2% Triton X-100

supplemented with protease inhibitors cocktail) and cleared by centrifugation for

60 minutes at 21,000 x g at 4ºC. Supernatants were subjected to immunodetection

of Aβ peptides using the MSD 96-well MULTI-SPOT Human/rodent Abeta

Triplex Ultra-Sensitive Assay (Mesoscale Discovery, catalog # K15141E-2).

79

3.2.7. RNA-sequencing of monkey cerebra. Total RNA from the four animals of both vehicle and VTP-5 (0.3 mpk) groups

was pooled and sent to Ambry Genetics (Aliso Viejo, CA) for RNA sequencing.

At the facility, samples were prepared using the Illumina protocol outlined in

“TruSeq RNA Sample Preparation Guide” (Part# 15008136 Rev. A November

2010). First, mRNA was purified from total RNA using magnetic oligo (dT)

beads, and then fragmented using divalent cations under elevated temperature.

cDNA was synthesized from the fragmented mRNA using Superscript II

(Invitrogen), followed by 2nd strand synthesis. cDNA fragment ends were

repaired and phosphorylated using Klenow, T4 DNA Polymerase and T4

Polynucleotide Kinase. Next, an ‘A’ base was added to the 3’ end of the blunted

fragments, followed by ligation of Illumina adapters via T-A mediated ligation.

The ligated products were size selected by AMPure XP Beads and then PCR

amplified using Illumina primers. The library size and concentration were

determined using an Agilent Bioanalyzer. The libraries were seeded onto the

flowcell at 6pM per lane (HiSeq2500) yielding approximately 600K pass-filter

clusters per mm2 tile area. The libraries were sequenced using 101+7+101 cycles

of chemistry and imaging.

Initial data processing and base calling, including extraction of cluster intensities,

was done using RTA 1.17.20 (HiSeq Control Software 2.0.5). Sequence quality

filtering script was executed in the Illumina CASAVA software (ver 1.8.2,

Illumina, Hayward, CA).

Mapping, read quantification, differential expression and KEGG pathway

enrichment analysis were performed at ContigExpress (New York, NY). Briefly,

the Illumina paired-end 2x100bp reads for each RNA sample were mapped to the

80

Cynomolgus macaque genome (Beijing Genome Institute, BGI) using the

splicing-aware mapper, TopHat. The resulting BAM files were processed for gene

quantification in FPKM and differential expression analysis using Cufflinks. For

identified differentially expressed (DE) genes (FDR ≤ 0.05), KEGG pathway

enrichment analysis was performed. Cynomolgus macaque genomic sequence,

gene predication, and functional annotation were downloaded from

http://macaque.genomics.org.cn/page/species/index.jsp (Yan et al., 2006). The

references sequences were indexed using Bowtie2 (Langmead et al., 2012) and the

raw reads were mapped with standard paired-end parameters using TopHat

(Trapnell et al., 2009). Mapped statistics were calculated using Picard (weblink).

Overall mapping rates ranged from 52% to 84%. The recent version of the

Cufflinks software (Roberts et al., 2011) was utilized for read quantification and

differential expression analysis, according to the predicted gene structures due to

the limited annotations available for the reference genome. The identified DE

genes in each pair-wise comparison were subjected to KEGG pathway enrichment

analysis using KOBAS (Xie et al., 2011).

81

3.3 Results

3.3.1 VTP-5 is a potent, LXRβ selective modulator.

VTP-5 is a small synthetic molecule developed at Vitae Pharmaceuticals that

shows significant affinity for the ligand-binding domains (LBD) of LXRα and

LXRβ. VTP-5 possesses higher affinity for the LXRβ-LBD. The binding

constants (Ki), obtained by displacement of radiolabeled T0901317, are 295 and

17 nM for LXRα and LXRβ, respectively. Consistent with the Ki’s, VTP-5 shows

the ability to activate both receptors in Gal4 transactivation cell-based assays,

with EC50s equal to 282 nM and 12 nM for LXRα and LXRβ, respectively. We

have also assessed the selectivity of VTP-5 for LXRs over other hormone nuclear

receptors. The compound did not show affinity towards any of the tested receptors

and most importantly did not activate the retinoid X receptors (RXRs), LXRs’

obligate heterodimer partners (Willy et al., 1995). In-depth characterization of

VTP-5 will be published elsewhere.

3.3.2 VTP-5 increases expression of ABCA1 and ApoE in human astrocytes.

We employed cultured human CCF-STTG1 astrocytes to show the LXR-mediated

increased expression of ABCA1 and ApoE. As shown in Figure 1A, treatment of

astrocytes with known LXR modulators, such as T0901317 and GW3965, and

VTP-5 for 48 hours led to a concentration-dependent increase in the transcription

levels of ABCA1 and, here shown for the first time in human cells, ApoE.

Consistent with the increased levels of ApoE transcript, we observed a

concentration-dependent increase in the protein levels of apoE in both cell lysate

and supernatants by Western Blot analysis (Fig. 1B).

82

3.3.3. VTP-5 significantly increases expression of ABCA1 and ApoE in

cerebral cortex in primates.

In order to assess the efficacy and bioavailability of VTP-5 in non-human

primates, Cynomolgus macaques (Macaca fascicularis) were treated with doses of

0.1-0.3 and 1 mg/kg via oral administration once a day for 14 days. Four hours

after the last dosing on day 14, animals were sacrificed and several relevant

organs were collected for gene expression analysis and drug exposure. VTP-5 was

found in high concentration in plasma and brain tissues at all doses (personal

communication).

Treatment with VTP-5 led to a significant dose-dependent up-regulation of

ABCA1 gene levels in brain cortical tissues. As demonstrated by RT-PCR

(Fig.2A), VTP-5 induced ABCA1 mRNA levels 2 to 4 fold over the vehicle

control.

We also measured the protein levels of both ABCA1 and ApoE in the same

tissues by Western Blot analysis (Fig. 2B). When compared to vehicle-treated

animals, VTP-5 was able to yield a substantial dose-dependent increase in

ABCA1 and ApoE levels after 14 days of treatment.

3.3.4. VTP-5 lowers Aβ1-42 in primate hippocampus in a dose-dependent

manner.

In order to address the potential beneficial role of LXR modulators in the context

of amyloid pathogenesis and Alzheimer’s’ disease, we measured the levels of

Aβ1-42 peptide in both brain cortical and hippocampal tissues after treatment with

VTP-5 for 14 days.

83

As shown in figure 3, at the highest dose the compound was able to yield

approximately 37% decrease in the levels of Aβ1-42 in hippocampus, but not

cerebral cortex (data not shown).

Although the effects observed at all doses did not reach statistical significance, the

reduction of Aβ1-42 levels appeared to follow a dose-dependent trend without any

significant accumulation of triglycerides in either plasma or liver tissues at 0.1 and

0.3 mpk (this data will be presented elsewhere).

3.3.5 LXRα and LXRβ are expressed at different levels in Cynomolgus brain

and liver tissues.

In order to address the biological implications of LXRβ selective-activation by

VTP-5 across tissues, we measured the levels of expression of both LXR isoforms

in both brain and liver samples from animals treated with either vehicle or VTP-5

at 0.3 mg/kg for 14 days. First, we verified that the binding efficiency of the RT-

PCR primer probe sets for both LXRs was comparable. This was assessed by

employing DNA constructs that encode for both full-length human LXRα and

LXRβ (data not shown). As shown in figure 4A, the expression levels of LXRβ

are significantly higher than LXRα in brain, as opposed to liver where LXRα

appears to be expressed at higher levels with respect to LXRβ. While LXRβ

transcript levels do not seem to vary significantly across brain and liver tissues,

the expression levels of LXRα are abundantly higher in liver with respect to brain.

Also, treatment with VTP-5 led to increased LXRα expression in brain at all doses

(Fig. 4B). The auto-regulatory loop mechanism has been previously shown for

LXRα, but not LXRβ, in human macrophages (Li et al., 2002) and, through the

present study, appears to be limited to brain only, as no significant induction of

84

LXRα was observed in liver upon treatment with VTP-5. Consistently, no

induction of LXRβ by the LXR agonist was observed in either brain or liver

tissues.

3.3.6. RNA-sequencing of monkey cerebrum confirms the induction of

several known LXR target genes by treatment with VTP-5.

In order to profile the LXR transcriptome in brain after treatment with VTP-5 at

0.3 mpk for 14 days, we subjected RNA from cerebral cortex to sequencing

(performed by Ambry Genetics). In table 1, we show several known LXR target

genes involved in both cholesterol and lipid metabolism that were upregulated in a

statistically significant fashion (in-depth analysis performed by ContigExpress).

Importantly, these include both ABC transporters (A1/G1) and, although to a

lower extent, ApoE. Interestingly, for the first time in monkey brain, LXR

activation led to induction of both lipoprotein lipase (LPL) and phospholipid

transfer protein (PLTP), previously shown to be regulated by LXRs in

macrophages and liver only (Zhang et al., 2001; Laffitte et al., 2003).

Additionally, treatment with the LXR modulator resulted in the induction of the

lipogenic genes SREBF and SCD. Preliminary sequencing results had revealed a

substantial induction of Apo-AI, which was later confirmed by RT-PCR (figure

5A) and western blotting (Figure 6). Also, RNA-sequencing revealed a mild

increase in the levels of Tissue Plasminogen Activator (PLAT) levels. This was an

intriguing finding, given the potential benefit in the context of cerebrovascular

ischemia (Papadopoulus et al., 1987).

85

3.3.7. VTP-5 promotes Aβ clearance without affecting key genes involved in

Aβ synthesis/degradation

Next, we wanted to understand whether the effect on Aβ42 lowering observed in

hippocampi is entirely dependent on increased levels of both ABCA1 and ApoE

or resulting from changes in the expression of key genes involved in the

generation and/or degradation of amyloid peptides. As shown in table 2, treatment

with VTP-5 did not affect either the transcription levels of the amyloid precursor

protein (APP), nor the expression of key enzymes involved into the processing of

APP, such as α−β- and γ secretases, which have an impact on generation of

amyloidogenic peptides (Lammich et al., 1999; Vassar et al., 1999; Hansson et al.,

2004).

3.3.8. VTP-5 induces mRNA expression of Apo-AI and PLAT genes.

In order to verify the induction of Apo-AI and PLAT by VTP-5, we performed

RT-PCR on RNA from all animals treated with VTP-5 at all doses. As shown in

Figure 5 (A-B), the compound led to a substantial upregulation of the Apo-AI

gene, in particular at 1 mpk, and a mild induction of PLAT transcription levels at

all doses.

Additionally, we investigated the effects of VTP-5 on the gene expression of both

apo-a1 and plat in cerebrums from mice treated with the compound at 30 mpk for

4 days. While the transcription levels of murine plat were modest, apo-a1 mRNA

was nearly undetectable. Despite the gene induction of abca1 by VTP-5, no effect

by the drug was seen on either apo-a1 or plat genes (data not shown). This might

suggest species-specific differences for the LXR mediated regulation of both Apo-

AI and PLAT.

86

3.3.9. VTP-5 increases the Apo-AI protein levels in Cynomolgus cerebrums.

Next, we wanted to assess whether the induction of Apo-AI gene expression

observed via both RNA sequencing and RT-PCR translated in increased protein

levels. As shown in figure 6, the LXR modulator led to a dose-dependent increase

of Apo-AI protein.

3.3.10. KEGG pathway analysis reveals a possible involvement of LXRs in

neurotransmission.

As shown in table 3, we summarized pathways affected by treatment with VTP-5

at 0.3 mpk based on their statistically significance (p<0.05). Although we’re

currently in the process of following up with several of the listed genes, LXR

activation appears to yield changes on pathways that regulate neurotransmission

and, possibly cognitive function.

For instance, both dopamine receptors D1 and D2 (DRD1/2) were upregulated.

VTP-5 also led to increased levels of several other key enzymes downstream of

the dopaminergic signaling cascade, such as adenylate cyclase type 5 (ADCY5)

and regulator of g-protein signalling 9 (RGS9), which lead to an overall increase

of intracellular cyclic adenosine monophosphate (cAMP). Interestingly, it has

been shown that RGS9 KO mice exhibit a lack of motor coordination and

impaired working memory (Blundell et al, 2008). Furthermore, the LXR

modulator led to downregulation of the metabotropic glutamate receptor 2/3

(GRM2/3), which exerts inhibitory effects on the cAMP cascade (Flor et al.,

1995).

The analysis also revealed upregulation of the serotonin receptor 2A (HTR2),

which has been extensively studied and shown to be involved in several distinct

processes, such as learning (Wood et al., 2011) and inflammation, by inhibiting

87

the pro-inflammatory effects mediated by tumor necrosis factor α (TNFα) (Yu et

al., 2008). Several genes involved in synaptic vesicular transport were

differentially regulated by treatment with VTP-5. These include members of the

Synaptotagmin family, which act as calcium sensors and are involved in both

synaptic vesicle docking and fusion with presynaptic membranes (Fukuda et al.,

2000; Pang et al., 2006) for neurotransmitter release.

Despite the bidirectional modulation of several members of the carbonic

anhydrase family, the physiological relevance of these genes in neurobiology

requires further elucidation and will be addressed elsewhere.

Finally, several genes involved in lipid metabolism, and which are involved in

PPAR signaling, were positively regulated. Among these, and as previously

discussed, known LXR target genes were induced, such as SCD, PLTP and LPL.

Interestingly, RXRγ was significantly upregulated. The relevance of SORBS1 and

FABP3 gene expression in brain will require further investigation.

3.4 Discussion

We wanted to assess whether the mechanism of ABCA1/ApoE-mediated brain Aβ

clearance shown in rodent models is conserved in higher species, such as non-

human primates. First, we investigated and confirmed the ability of human

astrocytic cells to upregulate both ABCA1 and ApoE genes upon LXR activation.

Also, our results show induction of ApoE at both the mRNA and protein level.

Induction of ApoE at the transcription level has been somewhat controversial, as

some authors have demonstrated that LXRs do not up-regulate apoE mRNA levels

in either neurons or glial cells in mice (Whitney et al., 2002) while others have

88

clearly showed the increase of apoE mRNA in murine astrocytes and glial cells

(Lefterov et al., 2007).

Treatment of Cynomolgus monkeys with a potent, CNS penetrant LXRβ-selective

modulator for 14 days clearly led to upregulation of LXR target genes, ABCA1

and ApoE. VTP-5 was able to yield a substantial dose-dependent increase in

ABCA1 and ApoE protein levels. Next, we looked at the levels of Aβ42 in both

hippocampus and cerebral cortex. Upon treatment with VTP-5 we were able to

observe a mild, but dose-dependent reduction of the amyloid peptide in

hippocampi only. No effect on either Aβ40 or Aβ42 was observed in cerebral

cortex. This is indeed consistent with observations made in Tg2576 mice, an

established model of AD, highlighting that the T090-mediated reduction of Aβ42,

but not Aβ40, is restricted to hippocampi only (Riddell et al., 2007). The effect on

hippocampal Aβ42 was achieved at doses that did not cause accumulation of

either plasma or liver triglycerides. In order to assess whether selective LXRβ

activation confers tissue-specific modulation of LXR target genes, we measured

the expression of both LXR isoforms in brain and liver tissues.

Consistent with previous reports (Whitney et al., 2002), we show that LXRβ is

more abundant than LXRα in monkey brain. Despite the comparable levels of

LXRβ in both brain and liver tissues, LXRα is expressed at much higher levels in

liver. Interestingly, treatment with VTP-5 leads to increased LXRα expression in

brain, but not liver. This represents a biological advantage for the development of

LXRβ selective modulators, which would allow better separation of beneficial

effects, such as enhanced RCT and reduction of Aβ burden in brain, from

undesired triglyceride elevation in liver (Calkin and Tontonoz, 2010).

89

RNA-sequencing of brain total RNA from VTP-5-treated monkeys allowed us to

confirm the induction of several LXR target genes, including the ABC

transporters, factors involved in lipid metabolism and PLTP. Although regulation

of PLTP by LXRs has been shown to be restricted to liver and lipid-loaded

macrophages (Laffitte et al., 2003), it is quite interesting to observe this in brain

tissue as well as it may prove beneficial in supporting cholesterol efflux from

atherosclerotic lesions. Importantly, the reduction of hippocampal Aβ42 appears

to be ABCA1/ApoE-dependent, as VTP-5 had no effect on the expression of any

of the genes involved in either Aβ synthesis or degradation.

Our results also revealed both mRNA and protein induction of Apo-AI, a critical

component of the RCT machinery (Chambenoit et al., 2001). Upregulation of

Apo-AI has also been observed in mouse brain and hippocampus, upon treatment

with the LXR full agonist, T090 (Lefterov et al., 2007; Fitz et al., 2010). This

supports the LXR-mediated induction of Apo-AI we observed in non-human

primates.

Despite the primary role of ApoE in brain cholesterol homeostasis (Elliott et al.,

2010) and amyloid metabolism (Jiang et al., 2008) with respect to other

apolipoproteins, increased Apo-AI levels may enhance the reduction of

cholesterol overload at the cerebrovascular level and possibly contribute to Aβ

clearance. In facts, the ability of Apo-AI to bind Aβ peptides has already been

shown in murine cells (Burns et al., 2006) and postmortem cerebrospinal fluid

(CSF) samples from AD patients (Paula-Lima et al., 2009).

Additionally, our RNA-sequencing results showed a mild induction of PLAT,

which was verified by RT-PCR. Upregulation of PLAT not only might improve

cerebrovascular conditions by promoting fibrinolysis and breakdown of clots, but

90

also contribute to Aβ clearance and inhibit amyloid-induced neurotoxicity, as

shown in mouse models of AD (Melchor et al., 2003).

KEGG pathway analysis revealed a very intriguing modulation of neurochemical

processes by LXR activation, suggesting a potential beneficial role of LXRs on

cognitive functions. Indeed, the LXR modulator affected the expression of key

genes involved in dopaminergic signaling cascades, such as DRD1/2 and ADCY5,

and synaptic plasticity, which ultimately leads to enhanced release of

neurotransmitters. To a certain extent, these findings are in line with the

observations reported by Dai et al (2012), showing the protective role of LXRβ on

dopaminergic neurons in a mouse model of Parkinson’s disease (PD).

Additionally, our findings showed induction of HTR2, which has been shown to

be involved in learning processes (Wood et al., 2011). Several of the findings just

discussed will require in-depth validation to assess whether such effects are

directly mediated by LXRs or result from secondary mechanisms that originate

from sub-chronic treatment of animals with LXR modulators. Overall, our

observations support the line of evidence established by other groups on the

critical role of LXR activation in rodent models of AD, showing improvement in

contextual memory (Jiang et al., 2008; Fitz et al., 2010).

In conclusion, we show that the treatment of non-human primates with a potent,

CNS-penetrant LXRβ selective modulator leads to induction of ABCA1, ApoE

and Apo-AI in brain with a concomitant decrease of Aβ42 in hippocampus and

modulation of several signaling pathways involved in neurotransmission and

synaptic plasticity, without a significant accumulation of either plasma or liver

triglycerides.

91

3.5 References Annicotte JS, Schoonjans K, and Auwerx J (2004). Expression of the liver X receptor alpha and beta in embryonic and adult mice. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 277: 312–316. Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV (2007). Transport pathways for clearance of human Alzheimer's amyloid beta-peptide and apolipoproteins E and J in the mouse central nervous system. J Cereb Blood Flow Metab;27:909–918. Blundell J, Hoang CV, Potts B, Gold SJ, Powell CM (2008). Motor coordination deficits in mice lacking RGS9. Brain Research 1190: 78–85. Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, Hseuh WA, Collins JL, Tangirala RK, Tontonoz P (2007). Ligand activation of LXR beta reverses atherosclerosis and cellular cholesterol overload in mice lacking LXR alpha and apoE. J Clin Invest. 117(8):2337-46. Burns MP, Vardanian L, Pajoohesh-Ganji A, Wang L, Cooper M, Harris DC, Duff K, Rebeck GW (2006) The effects of ABCA1 on cholesterol efflux and Abeta levels in vitro and in vivo. J Neurochem. 98(3):792-800. Calkin AC, Tontonoz P (2010). Liver x receptor signaling pathways and atherosclerosis. Arterioscler Thromb Vasc Biol. 30(8):1513-8. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G (2001). Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. J Biol Chem. 276: 9955–60. Dai YB, Tan XJ, Wu WF, Warner M, Gustafsson JA (2012). Liver X receptor beta protects dopaminergic neurons in a mouse model of Parkinson disease. Proc. Natl. Acad. Sci. U.S.A. 109:13112-13117 Elliott DA, Weickert CS, Garner B (2010) Apolipoproteins in the brain: implications for neurological and psychiatric disorders Clin Lipidol.1;51(4): 555-573. Fagan AM, Holtzman DM, Munson G, Mathur T, Schneider D, Chang LK, Getz GS, Reardon CA, Lukens J, Shah JA, LaDu MJ (1999) Unique lipoproteins secreted by primary astrocytes from wild type, apoE (−/−), and human apoE transgenic mice. J Biol Chem 274:30001–30007. Fitz NF, Cronican A, Pham T, Fogg A, Fauq AH, Chapman R, Lefterov I, Koldamova R (2010) Liver X receptor agonist treatment ameliorates amyloid pathology and memory deficits caused by high-fat diet in APP23 mice. J Neurosci 30:6862-6872.

92

Flor PJ, Lindauer K, Puttner I, Ruegg D, Lukic S, Knopfel T, Kuhn R (1995). Molecular cloning, functional expression and pharmacological characterization of the human metabotropic glutamate receptor type 2. Eur J Neurosci 7 (4): 622–9. Fukuda M, Moreira JE, Liu V, Sugimori M, Mikoshiba K, Llinas RR (2000). Role of the conserved WHXL motif in the C terminus of synaptotagmin in synaptic vesicle docking. Proc Natl Acad Sci USA 97 (26): 14715–14719 Hansson CA, Frykman S, Farmery MR, Tjernberg LO, Nilsberth C, Pursglove SE, Ito A, Winblad B, Cowburn RF, Thyberg J, Ankarcrona M (2004). Nicastrin, presenilin, APH-1, and PEN-2 form active gamma-secretase complexes in mitochondria. J. Biol. Chem. 279 (49): 51654–60. Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, et al. (2005). The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease. J Biol Chem 280:43243–43256. Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, and Man- gelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRa and LXRb. Proc Natl Acad Sci USA 96:266–271. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman DM, Tontonoz P, Landreth GE (2008) ApoE promotes the proteolytic degradation of Abeta. Neuron 58:681-693. Jiang XC, Beyer TP, Li Z, Liu J, Quan W, Schmidt RJ, Zhang Y, Bensch WR, Eacho PI, Cao G (2003). Enlargement of high density lipoprotein in mice via liver X receptor activation requires apolipoprotein E and is abolished by cholesteryl ester transfer protein expression. J Biol Chem 278:49072–49078. Joseph SB, Bradley MN, Castrillo A, Bruhn KW, Mak PA, Pei L, Hogenesch J, O'connell RM, Cheng G, Saez E, Miller JF, Tontonoz P (2004). LXR-dependent gene expression is important for macrophage survival and the innate immune response. Cell 119(2):299-309. Joseph SB, McKilligin E, Pei L, Watson MA, Collins AR, Laffitte BA, Chen M, Noh G, Goodman J, Hagger GN, Tran J, Tippin TK, Wang X, Lusis AJ, Hsueh WA, Law RE, Collins JL, Willson TM, Tontonoz P (2002). Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. U.S.A. 99 (11): 7604–9. Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, Tontonoz P (2003) The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol. 23(6):2182-91.

93

Lammich S, Kojro E, Postina R, Gilbert S, Pfeiffer R, Jasionowski M, Haass C, Fahrenholz F (1999). Constitutive and regulated alpha-secretase cleavage of Alzheimer's amyloid precursor protein by a disintegrin metalloprotease. Proc Natl Acad Sci USA 96(7):3922-7. Langmead B, Salzberg SL. (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods. 9(4):357-9. Lefterov I, Bookout A, Wang Z, Staufenbiel M, Mangelsdorf D, Koldamova R. (2007) Expression profiling in APP23 mouse brain: inhibition of Abeta amyloidosis and inflammation in response to LXR agonist treatment. Mol Neurodegener. 22;2:20. Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, and Lala DS (2002) Induction of human liver X receptor α gene expression via an autoregulatory loop mechanism. Mol Endocrinol 16:506–514. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, and Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors a and b. J Biol Chem 277:31900–31908. Melchor JP, Pawlak R, Strickland S. (2003) The tissue plasminogen activator-plasminogen proteolytic cascade accelerates amyloid-beta (Abeta) degradation and inhibits Abeta-induced neurodegeneration. J Neurosci. 23(26):8867-71. Morikawa M, Fryer JD, Sullivan PM, Christopher EA, Wahrle SE, DeMattos RB, O'Dell MA, Fagan AM, Lashuel HA, Walz T, et al. (2005) Production and characterization of astrocyte-derived human apolipoprotein E isoforms from immortalized astrocytes and their interactions with amyloid-beta. Neurobiol Dis 2005;19:66–76 Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Mol Pharmacol. 82(4):719-27. Pang ZP, Melicoff E, Padgett D, Liu Y, Teich AF, Dickey BF, et al. (2006). Synaptotagmin-2 is essential for survival and contributes to Ca2+ triggering of neurotransmitter release in central and neuromuscular synapses. The Journal of Neuroscience 26 (52): 13493–13504. Papadopoulos SM, Chandler WF, Salamat MS, Topol EJ, Sackellares JC (1987). Recombinant human tissue-type plasminogen activator therapy in acute thromboembolic stroke. J Neurosurg. 67(3):394-8. Paula-Lima AC, Tricerri MA, Brito-Moreira J, Bomfim TR, Oliveira FF, Magdesian MH, Grinberg LT, Panizzutti R, Ferreira ST (2009) Human apolipoprotein A-I binds amyloid-beta and prevents Abeta-induced neurotoxicity. Int J Biochem Cell Biol. 41(6):1361-70

94

Pussinen, P J; Jauhiainen M, Metso J, Pyle L E, Marcel Y L, Fidge N H, Ehnholm C (Jan. 1998). Binding of phospholipid transfer protein (PLTP) to apolipoproteins A-I and A-II: location of a PLTP binding domain in the amino terminal region of apoA-I. J. Lipid Res. 39 (1): 152–61. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000). "Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta". Genes Dev. 14 (22): 2819–30. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K et al. (2007) The LXR agonist TO901317 selectively lowers hippocampal Abeta42 and improves memory in the Tg2576 mouse model of Alzheimer's disease. Mol Cell Neurosci. 34(4):621-8. Roberts A. et al. (2011) Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. 27(17):2325-9. Su AI, Wiltshire T, Batalov S, et al (2004). A gene atlas of the mouse and human protein-encoding transcriptomes. Proc. Natl. Acad. Sci. U.S.A. 101 (16): 6062–7. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, and Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats. Mol Neurodegener 5:44. Tokuda T, Calero M, Matsubara E, Vidal R, Kumar A, Permanne B, Zlokovic B, Smith JD, Ladu MJ, Rostagno A, et al. (2000) Lipidation of apolipoprotein E influences its isoform-specific interaction with Alzheimer's amyloid beta peptides. Biochem J 348(Pt 2):359–365. Trapnell C. et al. (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 25(9):1105-11. Vassar R, Bennett BD, Babu-Khan S, Kahn S, Mendiaz EA, Denis P, Teplow DB, Ross S, Amarante P, et al. (1999). Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286 (5440): 735–41. Wahrle SE, Jiang H, Parsadanian M, Legleiter J, Han X, Fryer JD, Kowalewski T, Holtzman DM. (2004) ABCA1 is required for normal central nervous system ApoE levels and for lipidation of astrocyte-secreted apoE. J Biol Chem 279:40987–40993. Xie C. et al. (2011) KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 39 (Web Server issue):W316-22.

95

Yan G. et al., (2006) Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques. Nat Biotechnol. 29(11):1019-23. Yu B, Becnel J, Zerfaoui M, Rohatgi R, Boulares AH, Nichols CD (2008). Serotonin 5-hydroxytryptamine(2A) receptor activation suppresses tumor necrosis factor α -induced inflammation with extraordinary potency. J. Pharmacol. Exp. Ther. 327 (2): 316–323 Zhang Y, Repa JJ, Gauthier K, Mangelsdorf DJ (2001) Regulation of Lipoprotein Lipase by the Oxysterol Receptors, LXRα and LXRβ. J Biol Chem. 16;276(46):43018-24.

3.6. Figure Legends Figure 1. Regulation of the ABCA1 and ApoE genes by LXRs in CCF-STTG1

astrocytoma cells. The relative expression of both genes analyzed was measured

by real-time PCR. A, Relative expression of human ABCA1 and ApoE in human

astrocytes treated with 1 µM of LXR full agonists (T090 and GW3965) or VTP-5

at 5, 50 and 500 nM for 48 hours. B, Western Blot analysis of ApoE protein

expression in supernatants and lysates from human astrocytes treated with either

DMSO (lane 1) or 1 µM T090 and GW3965 (lanes 2-3) and VTP-5 at 5, 50 and

500 nM (lanes 4-6). 100 μg of total cell lysates or 20 µl were resolved by SDS-

PAGE on a 4-12% Bis-Tris gel, transferred to nitrocellulose and stained as

described in methods. Data represent mean ± SD (n=4). *p < 0.05 and ***p<0.001

as determined by Student’s t-test. Results are representative of two separate

experiments.

Figure 2. Upregulation of LXR target genes in Cynomolgus monkey brain.

Relative mRNA expression of ABCA1 (A) and Western Blot analysis (B) of

ABCA1 and ApoE protein expression in cortical cerebra of monkeys treated with

96

either Vehicle (Veh.) or VTP-5 at doses of 0.1, 0.3 and 1 mpk once daily for 14

days. 60 μg of cleared brain tissue lysates were resolved by SDS-PAGE on 10%

and 4-12% Bis-Tris gels for ABCA1 and ApoE protein analysis, respectively.

After transfer to nitrocellulose, blots were stained as described in methods. Data

represent mean ± SE (n=4). **p<0.01 as determined by Student’s t-test.

Figure 3. Detection of soluble Aβ1-42 in Primate Hippocampus.

Immuno-detection of soluble Aβ1-42 in hippocampi tissue lysates from monkeys

treated either Vehicle or VTP-5 at doses of 0.1, 0.3 and 1 mpk once daily for 14

days.

Figure 4. Relative mRNA expression of LXRs in Cynomolgus monkey brain and

liver. A, Comparison of LXR isoforms in cerebral cortex and liver tissues from

vehicle-treated animals. Data was normalized to the relative levels of brain LXRα.

B, Relative levels of LXRs in brain and liver tissues upon treatment with VTP-5.

Data normalized to the relative levels of each LXR isoform in brain and liver

tissues from vehicle-treated animals. Data represent mean ± SE (n=4). **p<0.01,

***p<0.001 as determined by Student’s t-test.

Figure 5. Relative mRNA expression of Apo-AI (A) and PLAT (B) genes in

Cynomolgus monkey brain upon treatment with treated either Vehicle or VTP-5 at

doses of 0.1, 0.3 and 1 mpk once daily for 14 days. Data represent mean ± SE

(n=4).

97

Figure 6. Western blot analysis of Apo-AI protein expression in in cortical

cerebra of monkeys treated with either Vehicle (Veh.) or VTP-5 at doses of 0.1,

0.3 and 1 mpk once daily for 14 days. 60 μg of cleared brain tissue lysates were

resolved by SDS-PAGE on a 4-12% Bis-Tris gel, blotted to nitrocellulose and

stained as described in methods.

3.7 Table Legends

Table 1. Differential gene expression analysis of LXR target genes by RNA-

sequencing of Cynomolgus monkey brain. RNA from all 4 animals of both

vehicle- and VTP-5 (0.3 mpk)-treated groups was pooled and subjected to RNA

sequencing as described in methods.

Table 2. Differential gene expression analysis of genes involved in Aβ

metabolism by RNA-sequencing of Cynomolgus monkey brain. RNA from all 4

animals of both vehicle- and VTP-5 (0.3 mpk)-treated groups was pooled and

subjected to RNA sequencing as described in methods.

Table 3. KEGG pathway enrichment analysis from RNA sequencing results.

Fold change indicates the differential gene expression ratio between vehicle and

VTP-5-treated animals. Only statistically significant gene pathways are shown

(corrected p value<0.05).

3.8 Acknowledgements

Linghang Zhuang* is kindly acknowledged for the synthesis of VTP-5.

We also thank Joan* and Rong Guo* for the bioanalytical measurement of VTP-5

in animal tissues. Andy Hardy* and Shi Meng* are also acknowledged for

performing gene expression analysis and measurement of triglyceride levels in

blood and liver tissues. *Vitae Pharmaceuticals, Inc. Fort Washington, PA.

98

Table 1: VTP-5 treatment leads to up-regulation of several known LXR-target genes and potential new ones

99

Table 2: VTP-5 promotes Aβ clearance without affecting key genes involved in Aβ synthesis/degradation

100

Table 3: KEGG pathway analysis reveals new insight in LXR-mediated differential gene expression

101

Fig. 1A

102

Fig. 1B

103

Fig. 2A

104

Fig. 2B

105

Fig. 3

106

Fig. 4A

107

Fig. 4B

108

Fig. 5A

109

Fig. 5B

110

Fig. 6

111

CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS Since the discovery of LXRs and their involvement in cholesterol and lipid

homeostasis, the mechanism of gene regulation has been extensively characterized

in rodent systems. Although the LXR signaling pathway is mostly conserved

across species, LXRs can also regulate their target genes in a species-, tissue- and

isoform-specific fashion. In the context of host defense and innate immunity, the

LXR genome landscape had only been investigated in murine macrophages.

Therefore, we analyzed genome-wide expression profiles of forty-four thousand

genes using microarray gene expression analysis in human THP-1 macrophages

with and without stimulation of inflammatory response with LPS. First, we

showed that although the anti-inflammatory properties of LXRs in THP-1

macrophages appear to be not as strong as those observed with steroidal GR

agonists (Auphan et al., 1995), the overall down-regulation of the expression of

several cytokines and chemokines reflects an LXR-mediated transrepression of

pro-inflammatory genes, thus tuning down the attraction of additional monocytes

to atherosclerotic foam macrophages. These findings are in general agreement

with the effects observed in murine macrophages (Joseph et al., 2003). In the

same study, we also identified the SMPDL3A as a novel human LXR target gene.

Through EMSA and ChIP analysis experiments, we demonstrated the presence of

an LXRE within the promoter of the human SMDPL3A gene. Additionally, we

characterized the regulation of SMDPL3A by LXRs across several primary and

immortalized human cell lines. We showed that the SMPDL3A gene appears to be

controlled by LXRs in monocytes, THP-1 derived macrophages and primary cell

cultures from healthy donors but not in kidney, liver, skin fibroblasts and

neuroglioma cell lines. In addition, our data indicates that the induction of the

112

SMPDL3A gene by LXRs may be species-specific, since no increase in gene

expression could be observed in murine macrophage-like cells (RAW264.7) nor

any changes had been detected in three different tissues, including blood,

collected from the mice treated with T090.

Hence, we show that SMPDL3A might represent an additional example of

species- and tissue-specific LXR target gene (Noto et al., 2012). Although the

functions of SMPDL3A remain to be elucidated, further analysis of SMPDL3A

expression in primary cell cultures will be helpful in assessing the significance of

the tissue-specific regulation of this gene by LXRs. Characterization of

SMPDL3A enzymatic activity in both biochemical and cell based assays might be

very helpful, given the biological importance of acid sphingomyelinases in

activated macrophages (Truman et al., 2011).

As the role of LXRs in neurodegenerative disorders has never been investigated in

higher species, such as non-human primates, we wanted to confirm the LXR-

mediated upregulation of ABCA1 and ApoE genes in Cynomolgus monkey brains

upon treatment with an LXRβ-selective modulator. First, we showed that LXR

activation leads to induction of ABCA1 and ApoE genes in monkey cerebra.

Additionally, we were able to observe a mild reduction of Aβ42 levels in monkey

hippocampi, but not cerebra. This is indeed consistent with observations made in

lower species, such as a mouse model of AD (Riddell et al., 2007). Since the

effect on hippocampal Aβ42 was achieved at doses that did not cause

accumulation of either plasma or liver triglycerides, we measured the expression

of both LXR isoforms in brain and liver tissues in order to help understand

whether selective LXRβ activation indeed confers tissue-specific modulation of

LXR target genes.

113

Consistent with previous reports (Whitney et al., 2002), we showed that LXRβ is

more abundant than LXRα in monkey brain. Despite the comparable levels of

LXRβ in both brain and liver tissues, LXRα was found to be expressed at much

higher levels in liver. Interestingly, treatment with VTP-5 led to increased LXRα

expression in brain, but not liver. This may represent a biological advantage for

the development of LXRβ selective modulators, which would allow better

separation of beneficial effects, such as enhanced RCT and reduction of Aβ

burden in brain, from the undesired triglyceride elevation in liver. In addition, we

also characterized the LXR transcriptome in Cynomolgus brain by RNA-

sequencing in order to identify potential novel LXR target genes. We were able to

confirm the induction of several known LXR target genes in brain, including

PLTP, which, interestingly, was previously shown to be upregulated by LXRs

exclusively in macrophages and liver (Zhang et al., 2001; Laffitte et al., 2003).

For the first time in higher species, we also showed upregulation of Apo-AI in the

brain of Cynomolgus monkey upon treatment with a synthetic LXR modulator.

Despite the primary role of ApoE in brain cholesterol homeostasis (Elliott et al.,

2010) and amyloid metabolism (Jiang et al., 2008), with respect to other

apolipoproteins, increased Apo-AI levels may enhance the reduction of

cholesterol overload at the cerebrovascular level and possibly contribute to Aβ

clearance (Burns et al., 2006; Paula-Lima et al., 2009). Additionally, we identified

PLAT as a possible novel LXR target gene in monkey cerebra, as shown by the

mild induction upon treatment with the LXR ligand. Upregulation of PLAT not

only might improve cerebrovascular conditions by promoting fibrinolysis and

breakdown of clots, but also contribute to Aβ clearance and inhibit amyloid-

induced neurotoxicity, as shown in mouse models of AD (Melchor et al., 2003).

114

Although upregulation of PLAT gene expression was verified only by RT-PCR,

we currently have not identified antibodies suitable for the detection of PLAT

protein in primates.

Finally, KEGG pathway analysis revealed a very intriguing modulation of

neurochemical processes by LXR activation. Our LXR modulator positively

affected the expression of several genes that belong to signaling pathways

involved in neurotransmission and synaptic plasticity. Although we are currently

following up with several of these genes, our findings seem to support the general

notion that LXRs may hold a potential beneficial role in cognitive functions.

Eventually, the therapeutic value of LXR modulation in neurological disorders

will require conducting behavioral studies in aged non-human primates, which

would be more predictive of the human neuropathophysiology.

115

LIST OF REFERENCES A.I. Shulman, C. Larson, D.J. Mangelsdorf, and R. Ranganathan (2004) Structural Determinants of Allosteric Ligand Activation in RXR Heterodimers. Cell, Vol. 116, 417–429 Akira S, Takeda K, Kaisho T (2001) Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. 2:675–680. Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M et al. (2004) Niemann-Pick C1-like 1 protein is critical for intestinal cholesterol absorption. Science 303 1201–1204. Apfel R, Benbrook D, Lernhardt E, Ortiz MA, Salbert G, Pfahl M (1994). A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormone receptor subfamily. Mol. Cell. Biol. 14 (10): 7025–35. Asquith DL, Miller AM, Hueber AJ, McKinnon HJ, Sattar N, Graham GJ, McInnes IB (2009) Liver X receptor agonism promotes articular inflammation in murine collagen-induced arthritis. Arthritis Rheum. 60(9):2655-65. Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 270 (5234): 286-90. Barter PJ, Brewer HB Jr, Chapman MJ, Hennekens CH, Rader DJ, Tall AR (2003). Cholesteryl ester transfer protein: a novel target for raising HDL and inhibiting atherosclerosis. Arterioscler Thromb Vasc Biol 23 (2): 160–7 Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV (2007). Transport pathwaysfor clearance of human Alzheimer's amyloid beta-peptide and apolipoproteins E and J in the mouse central nervous system. J Cereb Blood Flow Metab 27:909–918. Bischoff ED, Daige CL, Petrowski M, Dedman H, Pattison J, Juliano J, Li AC, Schulman IG (2010) Non-redundant roles for LXRalpha and LXRbeta in atherosclerosis susceptibility in low density lipoprotein receptor knockout mice. J Lipid Res. 51(5):900-6 Blaschke F, Takata Y, Caglayan E, Collins A, Tontonoz P, Hsueh WA, Tangirala RK (2006) A nuclear receptor corepressor-dependent pathway mediates suppression of cytokine-induced C-reactive protein gene expression by liver X receptor. Circ Res. 99(12):e88-99.

116

Boyles JK, Zoellner CD, Anderson LJ, Kosik LM, Pitas RE, Weisgraber KH, Hui DY, Mahley RW, Gebicke-Haerter PJ, Ignatius MJ, et al. (1989) A role for apolipoprotein E, apolipoprotein A-I, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve. J Clin Invest. 83(3):1015-31. Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, et al. (2007) Ligand activation of LXR beta reverses atherosclerosis and cellular cholesterol overload in mice lacking LXR alpha and apoE. J Clin Invest. 117(8):2337-46. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G (2001). Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. J Biol Chem. 276: 9955–60. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457 Dai YB, Tan XJ, Wu WF, Warner M, Gustafsson JA (2012). Liver X receptor beta protects dopaminergic neurons in a mouse model of Parkinson disease. Proc. Natl. Acad. Sci. U.S.A. 109:13112-13117 Delvecchio CJ, Bilan P, Radford K, Stephen J, Trigatti BL, Cox G, Parameswaran K, Capone JP (2007) Liver X receptor stimulates cholesterol efflux and inhibits expression of proinflammatory mediators in human airway smooth muscle cells. Mol Endocrinol. 21(6):1324-34. DeMattos RB, Cirrito JR, Parsadanian M, May PC, O'Dell MA, Taylor JW, Harmony JA, Aronow BJ, Bales KR, Paul SM, Holtzman DM (2004) ApoE and clusterin cooperatively suppress Abeta levels and deposition: evidence that ApoE regulates extracellular Abeta metabolism in vivo. Neuron 41:193–202. Duval C, Touche V, Tailleux A, Fruchart JC, Fievet C, Clavey V, Staels B & Lestavel S (2006) Niemann-Pick C1 like 1 gene expression is down-regulated by LXR activators in the intestine. Biochemical and Biophysical Research Communications 340 1259–1263. Elshourbagy NA, Liao WS, Mahley RW, Taylor JM (1985) Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets. Proc Natl Acad Sci USA. 82(1):203-7. Endo A (1992) The discovery and development of HMG-CoA reductase inhibitors. J Lipid Res. (11):1569-82. Fan X, Kim HJ, Bouton D, Warner M & Gustafsson JA (2008) Expression of liver X receptor beta is essential for formation of superficial cortical layers and migration of later-born neurons. PNAS 105 13445–13450.

117

Fontaine C, Rigamonti E, Nohara A, Gervois P, Teissier E, Fruchart JC, Staels B, and Chinetti-Gbaguidi G (2007) Liver X receptor activation potentiates the lipopolysaccharide response in human macrophages. Circ Res 101:40–49. Fowler AJ, Sheu MY, Schmuth M, Kao J, Fluhr JW, Rhein L, Collins JL, Willson TM, Mangelsdorf DJ, Elias PM, Feingold KR (2003). Liver X receptor activators display anti-inflammatory activity in irritant and allergic contact dermatitis models: liver-X-receptor-specific inhibition of inflammation and primary cytokine production. J Invest Dermatol. 120(2):246-55. Gelissen IC, Harris M, Rye KA, Quinn C, Brown AJ, Kockx M, Cartland S, Packianathan M, Kritharides L & Jessup W (2006) ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arteriosclerosis, Thrombosis, and Vascular Biology 26 534–540. Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Wilsson TM, Rosenfeld MG and Glass CK (2007) Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARγ. Mol. Cell 25, 57–70. Glass CK, and Witztum JL (2001) Atherosclerosis: the road ahead. Cell 104, 503–516. Groot, P. H., N. J. Pearce, J. W. Yates, C. Stocker, C. Sauermelch, C. P. Doe, R. N. Willette, A. Olzinski, et al. (2005). Synthetic LXR agonists increase LDL in CETP species. J Lipid Res 46: 2182-2191. Hardy J, Allsop D (1991) Amyloid Deposition as the Central Event in the Aetiology of Alzheimer's Disease. Trends Pharmacol. Sci.12(10):383–88 Hassen Ratni & Matthew B Wright (2010) Recent progress in liver X receptor-selective modulators. Current Opinion in Drug Discovery & Development 13(4):403-413 Hatano Y, Man MQ, Uchida Y, Crumrine D, Mauro TM, Feingold KR, Elias PM, Holleran WM (2010). Murine atopic dermatitis responds to peroxisome proliferator-activated receptors alpha and beta/delta (but not gamma) and liver X receptor activators. J Allergy Clin Immunol. 125(1):160-9.e1-5 Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, et al. (2005). The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease. J Biol Chem 280:43243–43256. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404 Hu X, Li S, Wu J, Xia C, Lala DS (2003) Liver X Receptors Interact with Corepressors to Regulate Gene Expression. Mol Endocrinol, 17(6):1019–1026

118

Ignatius MJ, Gebicke-Härter PJ, Skene JH, Schilling JW, Weisgraber KH, Mahley RW, Shooter EM (1986) Expression of apolipoprotein E during nerve degeneration and regeneration. Proc Natl Acad Sci USA. 83(4):1125-9. Ishimoto K, Tachibana K, Sumitomo M, Omote S, Hanano I, Yamasaki D, Watanabe Y, Tanaka T, Hamakubo T, Sakai J, Kodama T, Doi T (2006) Identification of human low-density lipoprotein receptor as a novel target gene regulated by liver X receptor alpha. FEBS Letters 580 4929–4933. Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ & Mangelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRalpha and LXRbeta. PNAS 96 266–271. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman DM, Tontonoz P, Landreth GE (2008) ApoE promotes the proteolytic degradation of Abeta. Neuron 58:681-693. Jiang XC, Beyer TP, Li Z, Liu J, Quan W, Schmidt RJ, Zhang Y, Bensch WR, Eacho PI, Cao G (2003). Enlargement of high density lipoprotein in mice via liver X receptor activation requires apolipoprotein E and is abolished by cholesteryl ester transfer protein expression. J Biol Chem 278:49072–49078. Jiang XC, Bruce C, Mar J, Lin M, Ji Y, Francone OL & Tall AR (1999) Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. Journal of Clinical Investigation 103 907–914. John G. Menke at al. (2002) A novel liver X receptor agonist establishes species differences in the regulation of cholesterol 7a-hydroxylase (CYP7a) Endocrinology vol. 143, No. 7 2548-2558 Joseph SB, Bradley MN, Castrillo A, Bruhn KW, Mak PA, Pei L, Hogenesch J, O'connell RM, Cheng G, Saez E, Miller JF, Tontonoz P (2004). LXR-dependent gene expression is important for macrophage survival and the innate immune response. Cell 119(2):299-309. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, and Tontonoz P (2003) Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med 9:213–219. Joseph SB, Laffitte BA, Patel PH, Watson MA, Matsukuma KE, Walczak R, Collins JL, Osborne TF, Tontonoz P (2002) Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J Biol Chem. 277(13):11019-25.

119

Juvet LK, Andresen SM, Schuster GU, Dalen KT, Tobin KA, Hollung K, Haugen F, Jacinto S, Ulven SM, Bamberg K, Gustafsson JA, Nebb HI (2003) On the role of liver X receptors in lipid accumulation in adipocytes. Mol Endocrinol. 17(2):172-82. Kennedy MA, Venkateswaran A, Tarr PT, Xenarios I, Kudoh J, Shimizu N, Edwards PA (2001) Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. J Biol Chem. (42):39438-47 Kratzer A, Buchebner M, Pfeifer T, Becker TM, Uray G, Miyazaki M, Miyazaki-Anzai S, et al. (2009) Synthetic LXR agonist attenuates plaque formation in apoE-/- mice without inducing liver steatosis and hypertriglyceridemia. J. Lipid Res. 50 (2): 312–26. Kumar R, Thompson EB (1999) The structure of the nuclear hormone receptors. Steroids. 64(5): 310–9. Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, Tontonoz P (2003) The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol. 23(6):2182-91. Lee JH, Zhou J & Xie W (2008) PXR and LXR in hepatic steatosis: a new dog and an old dog with new tricks. Molecular Pharmaceutics 5 60–66. Lee M, Metso J, Jauhiainen M & Kovanen PT (2003) Degradation of phospholipid transfer protein (PLTP) and PLTP-generated pre-beta-high density lipoprotein by mast cell chymase impairs high affinity efflux of cholesterol from macrophage foam cells. Journal of Biological Chemistry 278 13539–13545. Lee MH, Lu K & Patel SB (2001) Genetic basis of sitosterolemia. Current Opinion in Lipidology 12 141–149. Li W, Wu Y, Min F, Li Z, Huang J, Huang R (2010) A nonhuman primate model of Alzheimer's disease generated by intracranial injection of amyloid-β42 and thiorphan. Metab Brain Dis. 25(3):277-84. Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, Lala DS (2002) Induction of human liver X receptor alpha gene expression via an autoregulatory loop mechanism. Mol Endocrinol.16(3):506-14. Liang G, Yang J, Horton JD, Hammer RE, Goldstein JL, Brown MS (2002) Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J Biol Chem. 277(11):9520-8.

120

Lo Sasso G, Murzilli S, Salvatore L, D'Errico I, Petruzzelli M, Conca P, Jiang ZY, Calabresi L, Parini P, Moschetta A (2010) Intestinal specific LXR activation stimulates reverse cholesterol transport and protects from atherosclerosis. Cell Metab. 12(2):187-93. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, and Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors α and β. J Biol Chem 277:31900–31908. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM (1995) The nuclear receptor superfamily: the second decade. Cell. 83(6): 835–9 Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K (1985) Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proc Natl Acad Sci USA.82(12):4245-9. Melchor JP, Pawlak R, Strickland S. (2003) The tissue plasminogen activator-plasminogen proteolytic cascade accelerates amyloid-beta (Abeta) degradation and inhibits Abeta-induced neurodegeneration. J Neurosci. 23(26):8867-71. Morales JR, Ballesteros I, Deniz JM, Hurtado O, Vivancos J, Nombela F, Lizasoain I, Castrillo A, Moro MA (2008) Activation of liver X receptors promotes neuroprotection and reduces brain inflammation in experimental stroke. Circulation. 118(14):1450-9. Morikawa M, Fryer JD, Sullivan PM, Christopher EA, Wahrle SE, DeMattos RB, O'Dell MA, Fagan AM, Lashuel HA, Walz T, et al. (2005) Production and characterization of astrocyte-derived human apolipoprotein E isoforms from immortalized astrocytes and their interactions with amyloid-beta. Neurobiol Dis 19:66–76 Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Mol Pharmacol. 82(4):719-27. Novak N, Heinzel T (2004) Nuclear receptors: overview and classification. Curr Drug Targets Inflamm Allergy 3(4):335–46. Park MC, Kwon YJ, Chung SJ, Park YB, Lee SK (2010) Liver X receptor agonist prevents the evolution of collagen-induced arthritis in mice. Rheumatology (Oxford). 49(5):882-90. Peng D, Hiipakka RA, Dai Q, Guo J, Reardon CA, Getz GS, Liao S (2008). Antiatherosclerotic effects of a novel synthetic tissue-selective steroidal liver X receptor agonist in low-density lipoprotein receptor-deficient mice. J Pharmacol Exp Ther 327(2):332-342.

121

Quinet EM, Basso MD, Halpern AR, Yates DW, Steffan RJ, Clerin V, Resmini C, Keith JC, Berrodin TJ, Feingold I, et al. (2009) LXR Ligand Lowers LDL Cholesterol in Primates, is Lipid Neutral in Hamster, and Reduces Atherosclerosis in Mouse. J Lipid Res. 50(12):2358-70. Quinet EM, Savio DA, Halpern AR, Chen L, Miller CP, Nambi P (2004) Gene-selective modulation by a synthetic oxysterol ligand of the liver X receptor. J Lipid Res. 45(10):1929-42. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ (2002) Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem. 277(21):18793-800. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000) Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 14 (22): 2819–30. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K et al. (2007) The LXR agonist TO901317 selectively lowers hippocampal Abeta42 and improves memory in the Tg2576 mouse model of Alzheimer's disease. Mol Cell Neurosci. 34(4):621-8. Roger T, Miconnet I, Schiesser AL, Kai H, Miyake K, Calandra T (2005) Critical role for Ets, AP-1 and GATA-like transcription factors in regulating mouse Toll-like receptor 4 (Tlr4) gene expression. Biochem J. 387:355–365. Roher AE, Lowenson JD, Clarke S, Woods AS, Cotter RJ, Gowing E, Ball MJ (1993) beta-Amyloid-(1-42) is a major component of cerebrovascular amyloid deposits: implications for the pathology of Alzheimer disease. Proc Natl Acad Sci USA. 90(22):10836-40. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B (2000) Role of LXRs in control of lipogenesis. Genes Dev. 14(22):2831-8. Selkoe DJ (1993) Physiological production of the beta-amyloid protein and the mechanism of Alzheimer's disease. Trends Neurosci. 16(10):403-9. Shoji M, Golde TE, Ghiso J, Cheung TT, Estus S, Shaffer LM, Cai XD, McKay DM, Tintner R, Frangione B, et al. (1992) Production of the Alzheimer amyloid beta protein by normal proteolytic processing. Science. 2;258(5079):126-9. Sironi L, Mitro N, Cimino M, Gelosa P, Guerrini U, Tremoli E, Saez E (2008) Treatment with LXR agonists after focal cerebral ischemia prevents brain damage. FEBS Lett. 582(23-24):3396-400. Song C, Kokontis JM, Hiipakka RA, Liao S (1994). Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. Proc. Natl. Acad. Sci. USA. 91 (23): 10809–13.

122

Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci USA. 90(5):1977-81. Strittmatter WJ, Weisgraber KH, Huang DY, Dong LM, Salvesen GS, Pericak-Vance M, Schmechel D, Saunders AM, Goldgaber D, Roses AD (1993b) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc Natl Acad Sci USA. 90(17):8098-102. Su AI, Wiltshire T, Batalov S, et al (2004) A gene atlas of the mouse and human protein-encoding transcriptomes. Proc. Natl. Acad. Sci. USA. 101 (16): 6062–7. Sun Y, Hao M, Luo Y, Liang CP, Silver DL, Cheng C, Maxfield FR, Tall AR (2003) Stearoyl-CoA desaturase inhibits ATP-binding cassette transporter A1-mediated cholesterol efflux and modulates membrane domain structure. J Biol Chem. 278(8):5813-20. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, and Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats. Mol Neurodegener 5:44. Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K, Akira S (1999) Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity. 11:443–451. Terpstra, V., van Amersfoort, E.S., van Velzen, A.G., Kuiper, J., and van Berkel, TJ (2000). Hepatic and extrahepatic scavenger receptors: function in relation to disease. Arterioscler. Thromb. Vasc. Biol. 20, 1860–1872. Tokuda T, Calero M, Matsubara E, Vidal R, Kumar A, Permanne B, Zlokovic B, Smith JD, Ladu MJ, Rostagno A, et al. (2000) Lipidation of apolipoprotein E influences its isoform-specific interaction with Alzheimer's amyloid beta peptides. Biochem J 348(Pt 2):359–365. van Haperen R, van Tol A, Vermeulen P, Jauhiainen M, van Gent T, van den Berg P, Ehnholm S, Grosveld F, van der Kamp A, de Crom R (2000) Human plasma phospholipid transfer protein increases the antiatherogenic potential of high density lipoproteins in transgenic mice. Arteriosclerosis, Thrombosis, and Vascular Biology 20 1082–1088. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci USA 97(22):12097-102.

123

Wagner BL, Valledor AF, Shao G, Daige CL, Bischoff ED, Petrowski M, Jepsen K, Baek SH, Heyman RA, Rosenfeld MG, Schulman IG, Glass CK (2003) Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression. Mol Cell Biol. 23(16):5780-9. Wahrle SE, Jiang H, Parsadanian M, Legleiter J, Han X, Fryer JD, Kowalewski T, Holtzman DM (2004) ABCA1 is required for normal central nervous system ApoE levels and for lipidation of astrocyte-secreted apoE. J Biol Chem 279:40987–40993. Whitney KD, Watson MA, Collins JL, Benson WG, Stone TM, Numerick MJ, Tippin TK, Wilson JG, Winegar DA, Kliewer SA (2002) Regulation of cholesterol homeostasis by the liver x receptors in the central nervous system. Mol Endocrinol 2002, 16:1378-1385. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, and Mangelsdorf DJ (1995) LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 9:1033–1045.

Yi Luo and Alan R. Tall (2000) Sterol upregulation of human CETP expression in vitro and in transgenic mice by an LXR element. J Clin Invest 105(4): 513–520. Yu L, Hammer RE, Li-Hawkins J, Von Bergmann K, Lutjohann D, Cohen JC & Hobbs HH (2002) Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. PNAS 99 16237–16242. Zhang Y, Repa JJ, Gauthier K, Mangelsdorf DJ (2001) Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. J Biol Chem. 276(46):43018-24. Zelcer N, Hong C, Boyadjian R & Tontonoz P (2009) LXR regulates cholesterol uptake through idol-dependent ubiquitination of the LDL receptor. Science 325 100–104. Zelcer N, Khanlou N, Clare R, Jiang Q, Reed-Geaghan EG, Landreth GE, Vinters HV, Tontonoz P (2007) Attenuation of neuroinflammation and Alzheimer's disease pathology by liver x receptors. Proc Natl Acad Sci USA. 104(25):10601-6. Zhong S, Sharp DS, Grove JS, Bruce C, Yano K, Curb JD, Tall AR (1996) Increased coronary heart disease in Japanese-American men with mutation in the cholesteryl ester transfer protein gene despite increased HDL levels. J Clin Invest 97 (12): 2917–23.

124

APPENDIX A Supplemental data from chapter 2 Supplemental Figure 1

Supplemental Figure 1. Western Blot analysis of SMPDL3A protein HEK293 cells were transiently transfected with either a control empty vector (lane

1) or a plasmid encoding the full-length human SMPDL3A fused to Myc-DDK

tag at the C-terminus (lane 2). 100 μg of total cell lysates were resolved by SDS-

PAGE, blotted to nitrocellulose, and stained with 1.7 μg/ml anti-SMPDL3A

followed by DAM-HRP (1:2,000)

β-Actin

51

1 2

125

Supplemental Figure 2

Supplemental Figure 2. Knockdown of LXRs in THP-1-derived macrophages Cells were treated with either 30 nM scrambled siRNA or LXR-specific siRNA

(using RNAiMAX Lipofectamine) for 24 hours. After transfection, cells were

treated with either DMSO or 1 µM T090 for 4, 8 and 24 hours. RNA was isolated

and subjected to RT-PCR for both LXR genes.

126


Supplemental Figure 3. Treatment of THP-1 macrophages with a PPARγ

agonist

Cells were treated with various concentrations of Rosiglitazone for 24 hours.

T090 was used as a positive control for SMDPL3A gene induction.

127


Supplemental Figure 4. Induction of LXR-regulated genes in human cell lines

Cells were treated with 1 µM T090 for 24 hours. RNA was isolated and subjected

to RT-PCR for ABCA1 and SREBP1c genes.

128

VITA

Paul Bart Noto

EDUCATION Ph.D. Biological Sciences Drexel University, Philadelphia, PA. February 2009 – May 2013 (anticipated completion) MS Pharmacology Thomas Jefferson University, Philadelphia, PA. September 2005 – April 2007. BS/MS Biological Sciences/Molecular Biology (summa cum laudae) University of Palermo, Palermo, Italy. October 2000 – July 2004.

129

RESEARCH EXPERIENCE Doctoral Research (2009-2013)

Dissertation Title: “Analysis of Liver X Receptor target gene expression across

species”

Senior Research Associate (2008-present)

Discovery Biology, Vitae Pharmaceuticals, Inc. Fort Washington, PA.

Projects and responsibilities: Biochemical and cell-based assay development for

pharmacological characterization of small molecule agents for the treatment of

hypertension (Renin and Mineralocorticoid Receptor), Alzheimer’s disease

(BACE1 and LXRs) and inflammatory disorders (RORγt, SYK, JAK3 and LXRs).

Research Associate (2007).

Screening Sciences Department, Wyeth Research, Collegeville, PA.

Projects and responsabilities: Cell- based assay development for high throughput

screening of therapeutic compounds.

Research Assistant (2005 to 2007). S.H.R.O. for Cancer Research and Molecular Medicine, College of Science and Technology, Temple University. Thesis Title: “Expression of Rb proteins in Small and Non-Small Lung Cancer cells” Clerkship title: “Alternative stabilities of a proline-rich antibacterial peptide in vitro and in vivo” Research Trainee (2003-2004) Department of Developmental and Cell Biology, University of Palermo, Italy. Thesis Title: "Physical Mapping of Re-arranged DNA in Human Colorectal Cancer"

130

PUBBLICATIONS Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Molecular Pharmacology 82(4):719-27. Noto PB, Abbadessa G, Cassone M, Mateo GD, Agelan A, Wade JD, Szabo D, Kocsis B, Nagy K, Rozgonyi F, Otvos L Jr. (2008) Alternative stabilities of a proline-rich antibacterial peptide in vitro and in vivo. Protein Science 17(7):1249-55. Macaluso M, Montanari M, Noto PB, Gregorio V, Bronner C, Giordano A (2007) Epigenetic modulation of estrogen receptor-alpha by pRb family proteins: a novel mechanism in breast cancer. Cancer Research 67(16):7731-7. Macaluso M, Montanari M, Noto PB, Gregorio V, Surmacz E, Giordano A (2006) Nuclear and cytoplasmic interaction of pRb2/p130 and ER-beta in MCF-7 breast cancer cells. Annals of Oncology 17 Suppl 7:vii27-9. Laszlo Otvos, Jr, M. Cassone, V. de Olivier Inacio, Paul Noto, J.J Rux, J.D. Wade and Predrag Cudic. Synergy between a lead proline-rich antibacterial peptide derivative and small molecule antibiotics. From the book: Peptides for Youth, American Peptide Society, 2007. Noto PB, Bukhtiyarov Y, McGeehan GM and Lala DS (2013) LXR transcriptome in Cynomolgus monkey brains (manuscript in preparation).

analysis of liver x receptor target gene expression across ...4198... · analysis of liver x...

Documents