An unlikely role for the NAT2 genotypes and haplotypes inthe oral cancer of south Indians

Lakshmi Balaji a, Balaji Singh Krishna b, Bhaskar L.V.K.S. c,*aDepartment of Endodontics, Sri Ramachandra Dental College and Hospital, Sri Ramachandra University, Chennai, IndiabDepartment of General Surgery, Sri Ramachandra Medical College and Hospital, Sri Ramachandra University, Chennai, IndiacDepartment of Biomedical Sciences, Sri Ramachandra University, Chennai, India

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8

a r t i c l e i n f o

Article history:

Accepted 30 October 2011

Keywords:

NAT2

Haplotypes

Allele

Oral cancer

a b s t r a c t

The arylamine N-acetyltransferase 2 (NAT2) enzyme detoxifies a wide spectrum of naturally

occurring xenobiotics including carcinogens and drugs. Acetylation catalysed by the NAT2 is

an important process in metabolic activation of arylamines to electrophilic intermediates

that initiate carcinogenesis. Polymorphism in N-acetyltransferase 2 gene was reported to be

associated with the susceptibility of various cancers.

Objective: The aim of our study was to determine whether there is any association between

the susceptibility to oral cancer amongst the variations of NAT2 genotypes.

Design: This study was carried out in 157 patients with oral cancer. The control group

consisted of 132 healthy volunteers. The most common polymorphisms rs1799929,

rs1799930 and rs1799931 on the NAT2 gene were screened for the genotypes using TaqMan

allelic discrimination.

Results: All the three SNPs were polymorphic with minor allele frequency of 0.339, 0.372 and

0.061 for rs1799929, rs1799930 and rs1799931, respectively. None of the polymorphic site

deviated from HWE in controls. There were no significant differences in genotype or allele

frequencies of three SNPs between controls and cases with oral cancer. Risk of oral cancer

development for the carriers of the individual deduced phenotypes was also not statistically

significant. Of the 3 studied polymorphisms, 2 were in strong LD and form one haplotype

block. None of the haplotype had shown significant association with the oral cancer.

Conclusions: Our study concludes that the NAT2 genotypes, phenotypes and haplotypes are

not involved in the susceptibility to oral cancer in South Indian subjects.

# 2011 Elsevier Ltd. All rights reserved.

Available online at www.sciencedirect.com

journal homepage: http://www.elsevier.com/locate/aob

1. Introduction

Oropharyngeal cancer is more common in developing coun-

tries than in developed countries [1]. Oral Cancer is the third

most common cancer in India after Cervical and Breast Cancer

amongst women [2]. In India, the age standardised incidence

rate of oral cancer is reported at 12.6 per 100,000 people. The

accessibility and visibility of the oral cavity to the patient and

clinician makes the diagnosis of oral squamous cell carcinoma

* Corresponding author. Tel.: +91 9940524037.E-mail address: lvksbhaskar@gmail.com (B. L.V.K.S.).

0003–9969/$ – see front matter # 2011 Elsevier Ltd. All rights reservedoi:10.1016/j.archoralbio.2011.10.019

(OSCC) relatively straight forward [3]. The use of tobacco and

alcohol are the most common risk factors for the development

of oral cavity cancer. The development of cancer is a multistep

process which involves accumulation of DNA alterations,

resulting in neoplastic transformation and uncontrolled

growth. Several genetic polymorphisms of the genes that

involved in xenobiotic metabolism, DNA repair, hormone

metabolism, immune system regulation and development,

apoptosis and cell cycle control may play an important role in

carcinogenesis process [4–6].

d.

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8514

The N-acetyltransferases (NAT; E.C.2.3.1.5) are xenobiotic-

metabolising enzymes (XME) that involved in the metabolism of

drugs, environmental toxins and aromatic amine carcinogens

present in cigarette smoke. N-Acetyltransferases catalyse the

transfer of an acetyl group from acetylCoA (Ac-CoA) to the

nitrogen or oxygen atom of arylamines, hydrazines, and their N-

hydroxylated metabolites [7]. NAT2 gene (MIM # 243400) codes

for the NAT2 proteins that have variable enzymatic activity or

stability, leading to slow or rapid acetylation [8,9]. The human

NAT2 gene spans 9.9 kb and is located on chromosome 8p22.

NAT2 consists of a non-coding exon at the 50 end separated by a

9 kb intron from an uninterrupted coding region of 873 bp that

encodes a 290 amino acid protein. The NAT2 gene is polymor-

phic and 36 alleles have been described till date (http://

louisville.edu/medschool/pharmacology/NAT.html). Several

of the NAT2* alleles share sequence variations, and not all

sequence variations would lead to change in the enzyme

activity of the encoding protein. Early genotyping studies

screened for the presence of the C481T, the G590A, the G857A

and sometimes the G191A nucleotide changes, all of which were

shown to cause a slow acetylation phenotype [10]. A threefold

decrease in clearance was reported between fast acetylators

and slow acetylators [11]. The frequency of the slow acetylator

phenotype varies considerably amongst ethnic groups [12], and

this is due to the different frequencies of the polymorphisms

that correspond to the slow acetylator alleles. In Caucasian and

African populations, the frequency of the slow acetylation

phenotype varies between 40 and 70%, whilst in Asian

populations, such as Japanese, Chinese, Korean, and Thai, it

ranges from 10 to 30% [13]. The present study was aimed to

investigate association between oral cancer and three sequence

variations, which were reported to result in impaired acetyla-

tion.

2. Materials and methods

2.1. Subjects

The study group consisted of 157 oral cancer patients (all were

confirmed by histopathology to be squamous cell carcinoma)

Table 1 – Primers and probes used for genotyping NAT2 gene

Gene/polymorphism Primers/probe

NAT2/rs1799929 Forward

Reverse

Probe 1 (VIC)a

Probe 2 (FAM)

NAT2/rs1799930 Forward

Reverse

Probe 1 (VIC)

Probe 2 (FAM)

NAT2/rs1799931 Forward

Reverse

Probe 1 (VIC)

Probe 2 (FAM)

a Probes corresponding to different alleles were labelled with VIC and FAb Polymorphic bases are underlined.

and 132 controls. For cases and controls, the information

regarding age, gender, occupation and details about duration,

frequency, nature of tobacco habit (smoking or smokeless) and

alcohol consumption were noted through a detailed question-

naire. The diagnosis of oral cancer patients was confirmed

histopathologically in the Kanchipuram cancer hospital

between the years 2006 and 2009. Genetically unrelated

healthy individuals, who had no personal history of cancer

of any organ, were recruited from the Sri Ramachandra

hospital as the control subjects. Sample sizes for this study

were calculated using power and sample size calculation

program software (version 2.1.31). Previous studies indicated

that the probability of slow acetylators amongst controls is

0.52. Based on a power analysis, 133 oral cancer and 133

controls are large enough to detect a significant odds ratio of

0.5, with a power of 80% and an alpha of 5%. All the patients

participated in the study had given informed written consent

prior to the study. This study was approved by Ethics

Committee of Sri Ramachandra University, Chennai, and

Department of Health and Family welfare, Government of

Tamil Nadu state, India.

2.2. Genotyping

Three millilitres of blood sample were collected from all the

participants. Genomic DNA from blood samples was extracted

using the published protocol [14]. Three SNPs of the NAT2 gene

[c.481C>T (p.L161L, dbSNP rs1799929), c.590G>A (p.R197Q,

dbSNP rs1799930) and c.857G>A (p.G286E, dbSNP rs1799931),

were genotyped. The primers and probes for all the SNPs

(Table 1) used in this study were purchased from Applied

Biosystems, Foster City, CA, USA. Each reaction contained

2.5 mL TaqMan Universal PCR Master Mix, 0.125 mL TaqMan

SNP Genotyping Assay, 1.375 mL distilled water and 1 mL DNA

(10 ng/mL), with a final reaction volume of 5 mL. For each SNP, a

positive control for wild type, heterozygote and variant

genotype was provided. The plate also contained at least

two no template controls without any DNA. Before analysing

the DNA, a pilot test was conducted to confirm the accuracy of

the assay. After a successful pilot test, sample analysis was

carried out in 384-well optical reaction microplates (Applied

polymorphisms.

Sequence

CTGCTTGACAGAAGAGAGAGGAATC

AGAAATTCTTTGTTTGTAATATACTGCTCTCTCC

TGATTTGGTCCAGGTACCAb

TGATTTGGTCCAAGTACCA

CCTGCCAAAGAAGAAACACCAAAA

GAGACGTCTGCAGGTATGTATTCAT

CTTGAACCTCAAACAAT

TTGAACCTCGAACAAT

GGAGAAATCTCGTGCCCAAAC

GGGTGATACATACACAAGGGTTTATTTTG

CTGGTGATGAATCCCTT

TGGTGATGGATCCCTT

M fluorescent dyes (Applied Biosystems).

Table 2 – NAT2 gene polymorphisms and oral cancers.

Genotype Oral cancern (%)

Controln (%)

%MAF case/control Unadjusted Adjusteda

OR (95% CI) P value OR (95% CI) P value

rs1799929

CC 62 (39.49) 56 (42.42) 34.4/33.3 Ref. Ref.

TC 82 (52.23) 64 (48.48) 1.157 (0.711–1.884) 0.557 1.26 (0.74–2.12) 0.394

TT 13 (8.28) 12 (9.09) 0.978 (0.412–2.321) 0.961 0.97 (0.38–2.47) 0.952

TC + TT 95 (60.51) 76 (57.58) 1.129 (0.705–1.808) 0.613 1.21 (0.73–2.01) 0.460

HWE p 0.049 0.296

rs1799930

GG 57 (36.31) 55 (41.67) 38.9/35.2 Ref. Ref.

AG 78 (49.68) 61 (46.21) 1.234 (0.749–2.033) 0.410 1.26 (0.74–2.15) 0.396

AA 22 (14.01) 16 (12.12) 1.327 (0.631–2.789) 0.456 1.51 (0.67–3.40) 0.318

AG + AA 100 (63.69) 77 (58.33) 1.253 (0.779–2.015) 0.352 1.31 (0.79–2.17) 0.300

HWE p 0.568 0.885

rs1799931

GG 136 (86.62) 119 (90.15) 6.7/5.3 Ref. Ref.

AG 21 (13.38) 12 (9.09) 1.531 (0.723–3.244) 0.266 1.63 (0.72–3.65) 0.240

AA 0 (0) 1 (0.76)

AG + AA 21 (13.38) 13 (9.85) 1.413 (0.678–2.945) 0.356 1.48 (0.67–3.27) 0.328

HWE p 0.369 0.276

Abbreviations: MAF, minor allele frequency; CI, confidence interval; OR, odds ratio; and HWE p, Hardy–Weinberg equilibrium P value.a OR and P-values were adjusted for age, sex and smoking habits.

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8 515

Biosystem). Fluorescence was measured with an Applied

Biosystems 7900HT Fast Real-Time PCR System and analysed

with its System SDS software version 2.3.

2.3. Statistical analysis

Allele frequencies were determined by direct gene counting.

The genotype distribution for each site in each sample was

evaluated for Hardy–Weinberg equilibrium using the HWSIM

program [15]. The strength of the association of oral cancer

and controls between NAT2 gene polymorphisms was

assessed using binary logistic regression analysis, with

adjustment for age, sex and smoking habits. Based on the

human NAT2 nomenclature (http://louisville.edu/medschool/

pharmacology/NAT.html), allele NAT2*4 refers to NAT2 refer-

ence sequence (Genbank accession X14672). The NAT2*4 allele

acts dominantly to result in rapid acetylation, and the

presence of mutant genotype (rs1799929, rs1799930,

rs1799931) would lead to slow acetylation [16]. Based on this

assumption acetylator status of all samples in oral cancer and

control groups was determined. Samples possessing at least

two mutant alleles were considered as slow acetylators. Odds

ratios were calculated with respect to this reference genotype

(NAT2*4/*4: (rs1799929-CC + rs1799930-GG + rs1799930-GG).

For the computation of percentages, odds ratios (OR) with

95% confidence interval and x2 tests, we used the statistical

package SPSS 14.0. Linkage disequilibrium (LD) values of D0

and r2 were estimated using HaploView 3.12 [17]. We also used

the THESIAS program (www.genecanvas.org) to perform

haplotype–phenotype analysis.

3. Results

The present study includes 54.8% and 34.8% men in oral cancer

and control groups, respectively. The mean age was

53.08 � 10.72 years for the controls and 55.07 � 10.59 years

for the entire oral cancer group, and there was no significant

difference between control and cancer groups (P = 0.113). All

the three SNPs were polymorphic with minor allele frequency

of 0.339, 0.372 and 0.061 for rs1799929, rs1799930 and

rs1799931, respectively. None of the polymorphic site deviated

from HWE. There were no significant differences in genotype

or allele frequencies of three SNPs (rs1799929, rs1799930 and

rs1799931) between controls and cases with oral cancer (Table

2). The OR and 95% confidence intervals calculated for the

heterozygous and high risk homozygous genotypes before and

after adjusting to covariates were presented in Table 2.

(rs1799929-CC versus TC: OR = 1.157, 95% CI = 0.711–1.884,

P = 0.557; CC versus TT: OR = 0.978, 95% CI = 0.412–2.321,

P = 0.961), (rs1799930-GG versus AG: OR = 1.234, 95%

CI = 0.749–2.033, P = 0.410; GG versus AA: OR = 1.327, 95%

CI = 0.631–2.789, P = 0.456), (rs1799931-GG versus AG:

OR = 1.531, 95% CI = 0.723–3.244, P = 0.266). In general, con-

sumption of tobacco in the form of active smoking was

significantly different between cases and controls (P = 0.001)

with OR (CI) 2.485 (1.375–4.512), but the stratified analysis by

smoking status did not support neither interaction nor

confounding (supplementary Table 1). The distribution of

overall deduced phenotypes was 36.3% (57/157) rapid and

63.7% (100/157) slow acetylator in the oral cancer patients, and

49.3% (65/132) rapid and 50.7% (67/132) slow acetylator in the

control group, and the odds ratio (OR) we obtained for slow

acetylator status in cases vs. controls was 1.702 (95% CI, 1.063–

2.724, P = 0.018), which was significant. The genotype NAT2*4/*4

(rs1799929-CC, rs1799930-GG and rs1799931-GG) was also used

as reference for the calculation of individual ORs. In the same

manner, the ORs measure the chance for increased risk of oral

cancer as compared to the reference, if a certain genotype is

present. The ORs obtained for individual deduced phenotypes

were not significant (Table 3). The pairwise LD values (D0 and r2)

amongst studied SNPs are provided in Table 4. Of the 3 studied

Table 3 – NAT2 deduced phenotype in controls and oral cancer groups.

rs1799929 rs1799930 rs1799931 Deducedphenotype

Casesn = 157

Controln = 132

Totaln = 289

Odds ratio (95% CI) P value

CC GG GG Rapid 6 (3.8) 5 (3.8) 11 (3.8) Ref. –

CT Rapid 24 (15.3) 30 (22.7) 54 (18.7) 0.667 (0.191–2.333) 0.827

GA Rapid 24 (15.3) 29 (22.0) 53 (18.3) 0.690 (0.197–2.418) 0.814

GA Rapid 3 (1.9) 1 (0.8) 4 (1.4) 2.50 (0.245–22.337) 0.462

TT Slow 13 (8.3) 12 (9.1) 25 (8.7) 0.903 (0.228–3.594) 0.691

AA Slow 22 (14.0) 15 (11.4) 37 (12.8) 1.222 (0.331–4.539) 0.519

AA Slow 0 (0.0) 1 (0.8) 1 (0.3) – –

AA GA Slow 0 (0.0) 0 (0.0) 0 (0.0) – –

CT GA Slow 47 (29.9) 28 (21.2) 75 (26.0) 1.399 (0.413–4.759) 0.419

CT GA Slow 11 (7.0) 6 (4.5) 17 (5.9) 1.528 (0.341–6.910) 0.442

GA GA Slow 7 (4.5) 5 (3.8) 12 (4.2) 1.167 (0.235–5.809) 0.593

Table 4 – Paired linkage disequilibrium statistics of NAT2polymorphisms.a

rs1799929 rs1799930 rs1799931

rs1799929 0.980 1.0

rs1799930 0.292 1.0

rs1799931 0.033 0.038

a D0 and r2, above and below diagonal, respectively.

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8516

polymorphisms, rs1799929 and rs1799930 were in strong LD and

form a haplotype block. The D0 value between these markers

was 0.980. The SNP located outside this block (rs1799931) was

not in LD with the other 2 SNPs (rs1799929 and rs1799930).

Haplotype analysis using all the three SNPs and only two SNPs

that were located in the LD block are provided in Table 5. None of

the haplotype had shown significant association with oral

cancer.

4. Discussion

Systematic investigation of three NAT2 gene functional SNPs

(rs1799929, rs1799930 and rs1799931) in 157 oral cancer patients

and 132 controls, both of south Indian origin, showed that these

SNPs of NAT2 are not associated with oral cancer either at

genotype or haplotype level. Furthermore, the NAT2 individual

deduced acetylator phenotypes have not yielded statistically

significant ORs, when calculated in relation to NAT2*4/*4 as

reference genotype. But the overall acetylator genotypes

(deduced phenotype based on NAT2 allele nomenclature)

Table 5 – NAT2 gene haplotypes and oral cancer.

Haplotype Control Case

rs1799929 and rs1799930

CA 0.348 0.388

CG 0.319 0.268

TA 0.004 0.001

TG 0.329 0.343

rs1799929, rs1799930 and rs1799931

CAG 0.348 0.388

CGG 0.266 0.201

CGA 0.053 0.067

TAG 0.004 0.001

TGG 0.329 0.343

showed statistically significant association, in particular rapid

acetylator genotypes, to oral cancer risk. Approximately 55

years ago, the differences in response to isoniazid toxicity in

patients with tuberculosis led to the identification of NAT2

acetylation polymorphism [18]. This polymorphism was known

as ‘‘isoniazid acetylation polymorphism’’ until its pharmaco-

genetics was fully comprehended [19]. Since the identification

of NAT2 functional polymorphisms, a large number of studies

have been conducted to study the association between NAT2

genotypes and several cancers [20–24].

Majority of the initial studies have not distinguished OSCC

from other HNSCC and yielded conflicting results [25–27].

Furthermore, the studies with clearly defined phenotype of

OSCC in relation to NAT2 genotype have not produced

consistent results [28–30]. The data from two King and

Snohomish population-based study with 341 cases and 552

controls failed to show overall association between acetylator

status with OSCC risk; the odds ratios for slow and

intermediate acetylators, as compared with the rapid acet-

ylators, were 1.2 (95% CI 0.7–2.2) and 1.1 (95% CI 0.6–2.0),

respectively [31]. Almost identical genotype distributions

between German Caucasian cases and controls were observed

for all three NAT2 acetylators [32]. A case–control study from

Brazil suggests that NAT2 polymorphism, alone or combined

with GSTM3, may modulate susceptibility to oral cancer [33].

Analysis of NAT2 polymorphisms for squamous cell carcino-

ma of the head and neck (HNSCC) also revealed lack of

interaction between the polymorphisms and the environmen-

tal exposures suggests that chronic consumption of tobacco

and alcohol overwhelm enzyme defences, irrespective of

OR (95% CI) P value

Ref.

0.738 (0.471–1.158) 0.186

0.939 (0.000–3.1E+31) 0.999

0.959 (0.639–1.439) 0.84

Ref.

0.665 (0.415–1.066) 0.090

1.090 (0.525–2.261) 0.817

0.972 (0.000–2.9E+43) 0.999

0.951 (0.633–1.428) 0.807

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8 517

genotype [34]. Analysis of variation in the genes of eight

metabolic enzymes revealed that the NAT2 fast acetylators

were overrepresented in cases (53.7%) compared with controls

(43.9%) (P value = 0.03) indicating that the fast NAT2 acetyla-

tion as a risk factor for oral cancer in whites [35]. A largest

genetic epidemiologic study on upper aerodigestive tract

(UADT) cancers in Europe that analysed 115 SNPs from 62

genes in the subjects from 14 centres within 10 European

countries failed to demonstrate the association of NAT2 with

oral cancer [36]. Similar results were observed in relation to

cancers of the upper aerodigestive tract, including oral cavity,

pharynx, larynx and oesophagus, in northern Italy [37].

However, the present study did not show a significant

association between the NAT2 slow acetylator genotype and

oral cancer in our population.

Our study has both strengths and limitations. A potential

limitation of our study would be the use of hospital controls,

and therefore the results are likely to be affected by selection

bias or population stratification. However, our current report

is based on specific regions of the NAT2 gene that harbour

functional genetic variants. Furthermore, this study also

adopted a range of methods to test the association at

genotype, haplotype and deduced phenotype level. In conclu-

sion, the NAT2 gene does not have a key role in conferring risk

for oral cancer. Additional studies considering gene–gene and

gene–environment interactions should be investigated to

estimate the overall risk of a large sample to clarify the role

of the NAT2 gene in causing oral cancer.

Funding

This research work was supported by an intramural grant

from Sri Ramachandra University, Chennai.

Competing interests

The authors declare that they have no competing interests.

Ethical approval

The Study protocol is approved by Sri Ramachandra Institu-

tional ethical committee and Department of health and family

welfare, Government of Tamilnadu state, India.

Appendix A. Supplementary data

Supplementary data associated with this article can be

found, in the online version, at doi:10.1016/j.archoralbio.

2011.10.019.

r e f e r e n c e s

[1]. Fenley J, Bray F, DMe P. Health Organization. GLOBOCAN2000 cancer incidence mortality and prevalence worldwide, 2000.Lyon, France: IARC Press; 2001.

[2]. Jhavar S, Sarin R, Mulherkar R, Benner A, Agarwal JP,Dinshaw K. Glutathione S-transferase M1 or T1 nullgenotype as a risk factor for developing multiple primaryneoplasms in the upper aero-digestive tract, in Indianmales using tobacco. Oral Oncol 2004;40(1):84–91.

[3]. Ow TJ, Myers JN. Current management of advancedresectable oral cavity squamous cell carcinoma. Clin ExpOtorhinolaryngol 2011;4(1):1–10.

[4]. Bau DT, Chang CH, Tsai MH, Chiu CF, Tsou YA, Wang RF,et al. Association between DNA repair gene ATMpolymorphisms and oral cancer susceptibility.Laryngoscope 2010;120(12):2417–22.

[5]. Huang SH, Chang PY, Liu CJ, Lin MW, Hsia KT. O6-methylguanine-DNA methyltransferase gene codingregion polymorphisms and oral cancer risk. J Oral PatholMed 2010;39(8):645–50.

[6]. Hsu CF, Tseng HC, Chiu CF, Liang SY, Tsai CW, Tsai MH,et al. Association between DNA double strand break geneKu80 polymorphisms and oral cancer susceptibility. OralOncol 2009;45(9):789–93.

[7]. Riddle B, Jencks WP. Acetyl-coenzyme A: arylamine N-acetyltransferase. Role of the acetyl-enzyme intermediateand the effects of substituents on the rate. J Biol Chem1971;246(10):3250–8.

[8]. Butcher NJ, Boukouvala S, Sim E, Minchin RF.Pharmacogenetics of the arylamine N-acetyltransferases.Pharmacogenomics J 2002;2(1):30–42.

[9]. Grant DM, Goodfellow GH, Sugamori K, Durette K.Pharmacogenetics of the human arylamine N-acetyltransferases. Pharmacology 2000;61(3):204–11.

10. Hickman D, Risch A, Camilleri JP, Sim E. Genotyping humanpolymorphic arylamine N-acetyltransferase: identificationof new slow allotypic variants. Pharmacogenetics1992;2(5):217–26.

[11]. Dorne JL, Walton K, Renwick AG, Polymorphic CYP2C19. N-acetylation: human variability in kinetics and pathway-related uncertainty factors. Food Chem Toxicol2003;41(2):225–45.

[12]. Evans DA. N-acetyltransferase. Pharmacol Ther1989;42(2):157–234.

[13]. Meyer UA, Zanger UM. Molecular mechanisms of geneticpolymorphisms of drug metabolism. Annu Rev PharmacolToxicol 1997;37:269–96.

[14]. Thangaraj K, Joshi MB, Reddy AG, Gupta NJ, Chakravarty B,Singh L. CAG repeat expansion in the androgen receptorgene is not associated with male infertility in Indianpopulations. J Androl 2002;23(6):815–8.

[15]. Cubells JF, Kobayashi K, Nagatsu T, Kidd KK, Kidd JR,Calafell F, et al. Population genetics of a functional variantof the dopamine beta-hydroxylase gene (DBH). Am J MedGenet 1997;74(4):374–9.

[16]. Cascorbi I, Drakoulis N, Brockmoller J, Maurer A, SperlingK, Roots I. Arylamine N-acetyltransferase (NAT2)mutations and their allelic linkage in unrelated Caucasianindividuals: correlation with phenotypic activity. Am J HumGenet 1995;57(3):581–92.

[17]. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis andvisualization of LD and haplotype maps. Bioinformatics2005;21(2):263–5.

[18]. Hughes HB, Biehl JP, Jones AP, Schmidt LH. Metabolism ofisoniazid in man as related to the occurrence of peripheralneuritis. Am Rev Tuberc 1954;70(2):266–73.

[19]. Weber WW, Hein DW. N-acetylation pharmacogenetics.Pharmacol Rev 1985;37(1):25–79.

[20]. Malik MA, Upadhyay R, Modi DR, Zargar SA, Mittal B.Association of NAT2 gene polymorphisms withsusceptibility to esophageal and gastric cancers in theKashmir Valley. Arch Med Res 2009;40(5):416–23.

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 1 3 – 5 1 8518

[21]. Song DK, Xing DL, Zhang LR, Li ZX, Liu J, Qiao BP.Association of NAT2, GSTM1, GSTT1, CYP2A6, andCYP2A13 gene polymorphisms with susceptibility andclinicopathologic characteristics of bladder cancer inCentral China. Cancer Detect Prev 2009;32(5–6):416–23.

[22]. Yoshida K, Osawa K, Kasahara M, Miyaishi A, Nakanishi K,Hayamizu S, et al. Association of CYP1A1, CYP1A2, GSTM1and NAT2 gene polymorphisms with colorectal cancer andsmoking. Asian Pac J Cancer Prev 2007;8(3):438–44.

[23]. Nikishina MV, Vavilin VA, Makarova SI, Lyakhovich VV.Analysis of associations of NAT2 gene polymorphismswith the risk of lung cancer. Bull Exp Biol Med2007;143(1):83–6.

[24]. Suzuki S, Muroishi Y, Nakanishi I, Oda Y. Relationshipbetween genetic polymorphisms of drug-metabolizingenzymes (CYP1A1, CYP2E1, GSTM1, and NAT2), drinkinghabits, histological subtypes, and p53 gene pointmutations in Japanese patients with gastric cancer. JGastroenterol 2004;39(3):220–30.

[25]. Drozdz M, Gierek T, Jendryczko A, Pilch J, Piekarska J. N-acetyltransferase phenotype of patients with cancer of thelarynx. Neoplasma 1987;34(4):481–4.

[26]. Gonzalez MV, Alvarez V, Pello MF, Menendez MJ, Suarez C,Coto E. Genetic polymorphism of N-acetyltransferase-2,glutathione S-transferase-M1, and cytochromes P450IIE1and P450IID6 in the susceptibility to head and neck cancer.J Clin Pathol 1998;51(4):294–8.

[27]. Henning S, Cascorbi I, Munchow B, Jahnke V, Roots I.Association of arylamine N-acetyltransferases NAT1 andNAT2 genotypes to laryngeal cancer risk. Pharmacogenetics1999;9(1):103–11.

[28]. Jourenkova-Mironova N, Wikman H, Bouchardy C,Mitrunen K, Dayer P, Benhamou S, et al. Role of arylamineN-acetyltransferase 1 and 2 (NAT1 and NAT2) genotypes insusceptibility to oral/pharyngeal and laryngeal cancers.Pharmacogenetics 1999;9(4):533–7.

[29]. Katoh T, Kaneko S, Boissy R, Watson M, Ikemura K, BellDA. A pilot study testing the association between N-acetyltransferases 1 and 2 and risk of oral squamous cell

carcinoma in Japanese people. Carcinogenesis1998;19(10):1803–7.

[30]. Morita S, Yano M, Tsujinaka T, Akiyama Y, Taniguchi M,Kaneko K, et al. Genetic polymorphisms of drug-metabolizing enzymes and susceptibility to head-and-necksquamous-cell carcinoma. Int J Cancer 1999;80(5):685–8.

[31]. Chen C, Ricks S, Doody DR, Fitzgibbons ED, Porter PL,Schwartz SM. N-acetyltransferase 2 polymorphisms,cigarette smoking and alcohol consumption, and oralsquamous cell cancer risk. Carcinogenesis 2001;22(12):1993–9.

[32]. Hahn M, Hagedorn G, Kuhlisch E, Schackert HK, Eckelt U.Genetic polymorphisms of drug-metabolizing enzymesand susceptibility to oral cavity cancer. Oral Oncol2002;38(5):486–90.

[33]. Marques CF, Koifman S, Koifman RJ, Boffetta P, Brennan P,Hatagima A. Influence of CYP1A1, CYP2E1, GSTM3 andNAT2 genetic polymorphisms in oral cancer susceptibility:results from a case–control study in Rio de Janeiro. OralOncol 2006;42(6):632–7.

[34]. Boccia S, Cadoni G, Sayed-Tabatabaei FA, Volante M,Arzani D, De Lauretis A, et al. CYP1A1, CYP2E1, GSTM1,GSTT1, EPHX1 exons 3 and 4, and NAT2 polymorphisms,smoking, consumption of alcohol and fruit and vegetablesand risk of head and neck cancer. J Cancer Res Clin Oncol2008;134(1):93–100.

[35]. Buch SC, Nazar-Stewart V, Weissfeld JL, Romkes M. Case–control study of oral and oropharyngeal cancer in whitesand genetic variation in eight metabolic enzymes. HeadNeck 2008;30(9):1139–47.

[36]. Canova C, Hashibe M, Simonato L, Nelis M, Metspalu A,Lagiou P, et al. Genetic associations of 115 polymorphismswith cancers of the upper aerodigestive tract across 10European countries: the ARCAGE project. Cancer Res2009;69(7):2956–65.

[37]. Canova C, Richiardi L, Merletti F, Pentenero M, Gervasio C,Tanturri G, et al. Alcohol, tobacco and genetic susceptibilityin relation to cancers of the upper aerodigestive tract innorthern Italy. Tumori 2010;96(1):1–10.