Molecular and Cellular Probes (2002) 16, 93–97doi:10.1006/mcpr.2001.0390, available online at http://www.idealibrary.com on

An RT-PCR assay using oral fluid samples to detect rubellavirus genome for epidemiological surveillance

A. J. Vyse∗ and L. Jin

Enteric, Respiratory and Neurological Virus Laboratory,Central Public Health Laboratory, London NW9 5HT, UK

(Received 7 June 2001; accepted for publication 10 September 2001)

A reverse transcription nested polymerase chain reaction (RT-PCR) method was developed fordetecting rubella virus (RV) RNA using primer pairs which targeted a variable region of the E1gene. RV genome was detected in oral fluid, throat swabs, serum and tissue samples. This is thefirst report to show that RV genome can be detected in oral fluid samples, including acute casesΖ2 days after onset of symptoms, which have previously only been used for antibody testing. Thissuggests that PCR is useful for assisting with early diagnosis when a sufficient IgM response maynot have been mounted. The PCR amplicon of 553 nucleotides was also useful for moleculargenotyping, which contributes to RV epidemiological surveillance.

2002 Elsevier Science Ltd

KEYWORDS: rubella virus, oral fluid, genome.

Infection with rubella virus (RV) is usually mild or using commercially available devices with con-siderable compliance advantages over other types ofsubclinical but infection during early pregnancy can

result in congenital rubella syndrome (CRS). Wide- specimen13 that are more traditionally used, such asblood, naso-pharyngeal aspirates and throat swabs.spread use of vaccine has greatly reduced the in-

cidence of RV in developed countries though sporadic Oral fluid specifically refers to those specimens ob-tained using absorptive devices that are placed in thecases or small outbreaks still occur because of sub-

optimal vaccination rates and importations.1–4 A vari- mouth as opposed to other types of oral secretion,11

such as those obtained using pharyngeal swabs,ety of PCR assays have been described for detectingrubella genome5–7 directly from clinical specimens which have previously been used for RV RT-PCR and

are not suitable for antibody detection.12 Oral fluidsuch as foetal blood, chorionic villus, amniotic fluidand products of conception. These assays are de- samples are routinely collected in the UK for the

surveillance of measles, mumps and rubella infectionsigned specifically for diagnostic purposes and pro-duce short amplicons not appropriate for nucleotide by the detection of specific antibody.14–16 We report

the development of a nested RT-PCR suitable forsequencing and phylogenetic analysis. Other RT-PCRassays have been described for sequencing the RV routine use that targets a region of the E1 gene and

produces a second round amplicon of suitable lengthgenome.8–10 However, these tend to target large re-gions of the genome, use RV isolated from clinical for phylogenetic analysis. The majority of samples

tested were oral fluid specimens. This study thereforespecimens and grown up in cell culture and are notappropriate for routine use.9,10 demonstrates the molecular detection and genetic

characterisation of RV directly from oral fluid, usefulOral fluid samples are simply and easily collected

∗ Author to whom all correspondence should be addressed: A. J. Vyse, Enteric, Respiratory and Neurological Virus Laboratory, CentralPublic health Laboratory, London NW9 5HT, UK. Tel. 44 20 8200 4400; Fax. 44 20 8200 1569; E-mail:avyse@phls.org.uk

0890–8508/02/020093+05 $35.00/0 2002 Elsevier Science Ltd

A. J. Vyse and L. Jin94

Table 1. The result of RV RNA detection in clinical samples screened by RT-PCR

Collection Specimen RT-PCR Period: onset of symptoms to samplepurpose POS (%) collection (where known)

n mean (days) range (days)

Antibody Serum 6/49 (12.2) — — —

Detection Oral Fluid 14/200 (7) 147 20·1 1–56(Total) 20/249 (8)

Oral Fluid 13/19 (68.4) 19 5·1 1–12RT-PCR Throat swab 26/41 (63.4) 32 4·1 0–13

Foetal tissue 2/2 (100) — — —

(Total) 41/62 (66)

for both confirming suspected cases of rubella to 10×PCR buffer (Bioloine UK), 1·5 �l of 50 mm MgCl2

and made up to 50 �l with Nuclease Free Watersupplement specific antibody tests using the samesample, and for tracing chains of transmission.17 (Promega). PCR mixtures were then overlaid with one

drop of light mineral oil (Sigma). Initial denaturationA total of 311 clinical specimens received at theEnteric, Respiratory and Neurological Virus Laborat- for 2 min at 95°C was followed by 25 (for the first

round) or 30 (for the nested) cycles of 1 min at 95°C,ory (ERNVL) from patients with clinical evidence ofRV infection were tested by RT-PCR (Table 1). These 1·5 min at 55°C (for the first round) or 57·5°C (for the

nested), and 2 min at 72°C. 10 �l of the nested RT-included 219 oral fluid samples, all collected byOracol (Malvern Medical Developments, Worcester, PCR product was then visualized by ethidium bromide

staining after electrophoresis on a 2% agarose gel.UK). Oral fluid was extracted as previously de-scribed.18 The majority of samples (80%), which in- The nested PCR detected approximately 2 copies

of target, consistent with the performance of a nestedcluded all serum samples and 200/219 (91%) oralfluid samples, had been collected within eight weeks PCR assay. This was estimated by serial dilution of

first round PCR amplicon cloned using the TOPOafter onset of symptoms specifically for the detectionof RV specific IgM for surveillance rather than for RT- cloning kit (Invitrogen). Specificity was determined

by testing specimens containing other single strandedPCR. They had been stored at −20°C and subjectedto cycles of freeze thawing. The remainder, including RNA viruses including hepatitis C virus (HCV),

measles virus and polio virus, and specimens con-19/219 (9%) oral fluid samples and all throat swabsand foetal tissue samples, were collected specifically taining parvovirus B19 and human herpes virus 6

(HHV-6) DNA which can also cause rash. No PCRfor RT-PCR within two weeks after onset and cryo-preserved at −70°C (Table 1). RNA was extracted products were generated.

All 219 oral fluid specimens used in this study werefrom clinical specimens using the guanidinium thi-ocyanate-silica method.19,20 RNA was transcribed to screened for RV specific IgM. Of these, 200 were

screened for antibody before RT-PCR testing and 19,cDNA using Moloney murine leukaemia virus reversetranscriptase (M-MLV Rtase, Gibco BRL) with random specifically obtained for molecular studies, after being

used for RT-PCR (Table 1). All 49 serum samples andhexamers (Pharmacia) as primers.20

Two pairs of specific primers were chosen for the 214 of 219 (98%) oral fluid specimens used in thisstudy were positive for RV specific IgM antibody.21nested RT-PCR to amplify a 553 nucleotide region of

the RV E1 gene. For the first round of PCR, 10 pmol Of five oral fluid samples which did not contain RVspecific IgM, RV genome was detected in four andof primers RE1.1a (5′ GTTCCATACAGAGACCAGGA)

and RE1.2Ra (5′ ACTGGTAGCACCCGGTCACA) all were collected <2 days after the onset of symptomssuggesting sufficient time had not elapsed for a de-were used, and for the nested PCR 25 pmol of primers

RE1.3 (5′ ACCGTCTGGCAACTCTCCGT) and RE1.4R tectable IgM response to have been mounted whencollected.22 The remaining oral fluid was negative for(5′ ACCCGGTCACACGCACATTG). 20 �l of cDNA

was used in the first round PCR and 10 �l of the first- RV specific IgM and genome. The detection rateof rubella genome declined with increasing timeround PCR amplicon was used as template for the

nested PCR. Both PCR mixtures contained 200 �mol between disease onset and sampling (Table 1). Thoseoral fluids obtained for antibody testing were col-of deoxynucleoside triphosphates (dNTPs), 4·0 U of

Taq polymerase (Life Technologies, UK), 5 �l of lected a mean of 20·1 days after the onset of symptoms

An RT-PCR assay using oral fluid samples 95

Table 2. Samples used for phylogenetic analysis

Strain Name Country City/region Specimen GenBank(Spor/CRS/OB)a type Accession No.

Colch13UNK99 UK (Spor) Colchester Oral fluid AF480418Shrop59UNK99 UK (Spor) Shropshire Oral fluid AF480419Aberd25UNK99 UK (Spor) Aberdeen Oral fluid AF480420Liver177UNK99 UK (CRS) Liverpool Foetal tissue AF480421Thess102GRE99 Greece (OB) Thessaloniki Oral fluid AF480422Thess103GRE99 Greece (OB) Thessaloniki Oral fluid AF480423Thess130GRE99 Greece (OB) Thessaloniki Oral fluid AF480424Thess146GRE99 Greece (OB) Thessaloniki Throat swab AF480425

aSpor=sporadic case; CRS=congenital rubella; OB=outbreak.

and only 7% were RT-PCR positive. In contrast oral RV detection for early diagnosis in acutely collectedoral fluids. However, results demonstrate both timingfluids and throat swabs obtained for RT-PCR were

collected a mean of 5·1 and 4·1 days respectively of sample collection and appropriate storage to becritical if oral fluid is to be used for molecular studies.after the onset of symptoms and 68·4% and 63·4%

respectively were RT-PCR positive (Table 1). These Detection of RV genome decreased with time afteronset. Appropriate storage for samples that were toresults therefore suggest that RT-PCR is a useful for

Fig. 1. Phylogenetic tree showing the relative relatedness of RV isolates from Greece and the UK, collected in 1999.The tree is based on a 553 nucleotide region of the E1 gene and was constructed using Megalign programme (DNAStar,USA). Shown are four strains from the UK and four from Greece compared to 24 other rubella sequences available inthe GenBank, including the positive control (JD-UK62) and vaccine strain (RA273VAC).

A. J. Vyse and L. Jin96

be used for molecular studies minimised damage ACKNOWLEDGEMENTSto copies of genome present. This is particularly

We thank Dr BJ Cohen for his comments on the manuscript,important when investigating sporadic cases whereRashpal Hunjan for performing rubella specific IgM assaysthe opportunity to collect samples is limited (Tableand Stuart Beard for assistance with cloning (ERNVL, Cent-

1). Oral fluids for RT-PCR should therefore ideally be ral Public Health Laboratory, London). We also thankcollected within 7 days from onset of illness and Professor V. Kyriazopoulou-Dalaina (University of Thess-

aloniki, Thessaloniki, Greece) for providing some of theeither tested immediately or stored at−70°C withoutsamples used in this study.repeated freeze-thawing.

Phylogenetic analysis of rubella is currently rel-atively limited. Previous studies8–10 show that rubella

REFERENCESvirus strains can be divided into two genotypes, withan interstrain variation of the nucleotide sequence up 1. Cooper, L. (1985). The history and medical con-to 10%. All use E1 gene nucleotide sequences. The sequences of rubella. Reviews of Infectious Diseases

7, S2–S9.last resurgence of RV infection in the UK occurred in2. Miller, E. (1991). Rubella in the United Kingdom.1996. The majority of confirmed cases were young

Epidemiol. Infect. 107, 31–42.adult males who had never been offered rubella 3. Miller, E., Waight, P., Gay, N., Ramsay, M., Vurdien,vaccine and outbreaks occurred nationwide in res- J., Morgan-Capner, P. et al. (1997). The epidemiologyidential establishments such as university campuses.3 of rubella in England and Wales before and after

the 1994 measles and rubella vaccination campaign:In December 1998 a rubella epidemic began infourth joint report from the PHLS and the NationalGreece that peaked in January 1999. SubsequentlyCongenital Rubella Surveillance Programme. Com-

at least four universities in the UK reported cases municable Disease Report Review 7, R26–R32.of rubella, all of which included students from 4. Wolinsky, J., Rubella. In: Fields, B., Knipe, D., Ch-

anock, R., Melnick, L., Roizmann, B. & Shope, R.,Greece.23–25 Nine cases of rubella from the UK ineditors. (1996). Virology. Philadelphia: Lipincott-1999 (which included two cases of CRS) and fiveRaven, 899–921.from Greece in 1999 provided samples which were

5. Bosma, T., Corbett, K., Eckstein, M., O’Shea, S., Vi-positive by RT-PCR and genotyped by directly se- jayalakshmi, P., Banatvala, J. et al. (1995). Use of PCRquencing the PCR amplicon. Four representative se- for prenatal and postnatal diagnosis of congenital

rubella. Journal of Clinical Microbiology 33, 2881–7.quences from the UK and four from Greece were6. Revello, M., Baldanti, F., Sarasini, A., Zavattoni, M.,submitted to the GenBank (Table 2). Phylogenetic

Torsellini, M. & Gerna, G. (1997). Prenatal diagnosisanalysis including 24 other rubella sequences avail- of rubella virus infection by direct detection and se-able in the Genbank9 showed there was a high degree miquantitation of viral RNA in clinical samples by

reverse transcription-PCR. Journal of Clinical Mi-of similarity in sequence between samples collectedcrobiology 35, 708–13.in 1999 from the UK and from Greece (Fig. 1), with

7. Tanemura, M., suzumori, K., Yagami, Y. & Katow, S.an average difference of 4 nucleotides seen for the (1995). Diagnosis of fetal rubella infection with reverseamplicon generated (0·8%, range 0·2–1·8%). Com- transcription and nested polymerase chain reaction:paring with the 24 rubella sequences held in the A study of 34 cases diagnosed in fetuses. Am J Obstet

Gynecol 174, 578–82.GenBank showed the sequences from the UK and8. Bosma, T., Best, J., Corbett, K., Banatvala, J. & Starkey,Greece used in this study were most closely related

W. (1996). Nucleotide sequence analysis of a majorto a strain isolated in Hong Kong in 1985 (C31-HK85). antigenic domain of the E1 glycoprotein of 22 rubellaOur data therefore supported other epidemiological virus isolates. Journal of General Virology 77, 2523–

30.evidence that UK cases of rubella in 1999 can be9. Frey, T., Abernathy, E., Bosma, T., Starkey, W., Corbett,epidemiologically linked to the Greek outbreak.25 The

K., Best, J. et al. (1998). Molecular analysis of rubellasmall differences in nucleotide sequence observed virus epidemiology across three continents, Northmay be due to RNA polymerase errors, which lacks America, Europe, and Asia, 1961–1997. Journal ofa proof reading capability. Infectious Diseases 178, 642–50.

10. Katow, S., Minahara, H., Fukushima, M. & Yamaguchi,This study has provided a simple method for de-Y. (1997). Molecular epidemiology of rubella by nuc-tecting RV genome directly from clinical samples,leotide sequences of the rubella virus E1 gene in three

including oral fluid specimens which have high com- east Asian countries. Journal of Infectious Diseasespliance properties and are also used for antibody 176, 602–16.

11. Vyse, A. & Cohen, B. (1999). In saliva veritas. Com-testing. Subsequent genomic sequencing of the am-municable Disease and Public Health 2, 298.plicon enables cases to be epidemiologically linked,

12. Bosma, T., Corbett, K., O’Shea, S., Banatvala, J. &contributes to the global view of RV divergence and Best, J. (1995). PCR for detection of rubella virus RNAis useful supplementary information for surveillance in clinical samples. Journal of Clinical Microbiology

33, 1075–9.purposes.

An RT-PCR assay using oral fluid samples 97

13. Parry, J. (1993). Simple and reliable salivary tests 19. Boom, R., Sol, C., Salimans, H., Jansen, C., Dillen,PW-v. & Noordaa, J. V. D. (1990). Rapid and simplefor HIV and hepatitis A and B virus diagnosis and

surveillance. Annals of the New York Academy of method for purification of nucleic acids. Journal ofClinical Microbiology 28, 495–503.Sciences 694, 216–33.

14. Ramsay, M., Brugha, R., Brown, D., Cohen, B. & 20. Jin, L., Richards, A. & Brown, D. (1996). Developmentof a dual target-PCR for detection and characterizationMiller, E. (1998). Salivary diagnosis of rubella: a study

of notified cases in the United Kingdom, 1991–4. of measles virus in clinical specimens. Molecular andCellular Probes 10, 191–200.Epidemiology and Infection 120, 315–19.

15. Gay, N., Miller, E., Hesketh, L., Morgan-Capner, P., 21. Perry, K., Brown, D., Parry, J., Panday, S., Pipkin, C.& Richards, A. (1993). Detection of measles, mumpsRamsay, M., Cohen, B. et al. (1997). Mumps sur-

veillance in England and Wales supports introduction and rubella antibodies in saliva using antibody captureradioimmunoassay. J. Med. Virol. 40, 235–40.of two dose vaccination schedule. Communicable

disease Report Review 7, R21–R26. 22. Helfand, R., Heath, J., Anderson, L., Maes, E., Guris,D. & Bellini, W. (1997). Diagnosis of measles with16. Gay, N., Ramsay, M., Cohen, B., Hesketh, L., Morgan-

Capner, P., Brown, D. et al. (1997). The epidemiology an IgM capture EIA: th optimal timing of specimencollection after rash onset. Journal of Infectious Dis-of measles in England and Wales since the 1994

vaccination campaign. Communicable Disease Report eases 175, 195–9.23. Giannakos, G., Pirounaki, M. & Hadjichristodoulou,Review 7, R17–R21.

17. Peltola, H. & Leinikki, P. (1998). Rubella gene se- C. (2000). Incidence of congenital rubella in Greecehas decreased. BMJ 320, 1408.quencing as a clinician’s tool. The Lancet 352, 1799–

800. 24. Report SCflaEHW. (1999). Rubella in Grampian HealthBoard. SCIEH Weekly Report 33, 77.18. Brown, D., Ramsay, M., Richards, A. & Miller, E.

(1994). Salivary diagnosis of measles: a study of no- 25. Tookey, P., Molyneaux, P. & Helms, P. (2000). UKcases of congenital rubella can be linked to Greektified cases in the United Kingdom, 1991–3. British

Medical Journal 308, 1015–7. cases. BMJ 321, 766.