what do genes do? chapter 17 - protein synthesis 96% 36% 7% 21% 15%

What do genes do?• Chapter 17 - Protein Synthesis

96%

36% 7%

21%

15%

• MOUSE EMBRYO GROWN FROM SKIN CELLS!

Human Skin cells can be converted to Pluripotent (make 220 types of cells!) Embryonic Stem cells - Nov 2007!

• How did they do it?• Skin cell and Embryonic stm cell - what’ the

difference?• Which genes are active - many genes are silenced in

the differentiated skin cell.• Turn on those genes needed to dedifferentiate the

skin cells.• OOPS can it lead to problems?• Cancers! Virus vector used to deliver the genes can

cause problems.

What makes a plant short?

TT Tt

Tt tt

T

T

t

tMutation in gene coding for Gibberellin – a plant growth hormone

What causes dwarfism?

TT Tt

Tt tt

T

T

t

t

Mutation in gene coding for fibroblast growth factor– one of many factors needed for cell division

Early clues- The study of metabolic defects provided evidence that genes specify proteins

Alkaptonuria –hereditary disease - change in metabolism due to lack of a particular enzyme (1909 - Garrod)

Phenylthiocarbamide –PTC paper taste test

Taster = dominant alleleNontaster = recessive allele

Presence of gene = presence of taste receptor (protein) on tongue!

• Mutation in eye color = synthesis of specific protein is blocked in a metabolic pathway (1930s)

2amino –4hydroxypteridine à xanthopterin(blue) (green-blue)â

tetrahydroiopterin(violet-blue)

biopterin drosopterin sepiapterin(blue) (orange) (yellow)

âisosepiapterin (yellow)

• Beadle and Edward Tatum - link between genes and enzymes in bread mold, Neurospora crassa.– complete growth medium includes all 20 amino acids.

• ONE GENE ONE ENZYME HYPOTHESIS: A gene makes an enzyme (1941)

Not always - gene products can be nonenzymatic proteinsAlso, a protein may have several POLYPEPTIDE chains (remember quarternary structure?) - each has its own gene.Changed hypothesis to one gene one polypeptide. BUT….

• ONE GENE ONE POLYPEPTIDE HYPOTHESIS

1 polypeptide

Gene Therapy

•

Within hours after doctors shot the normal OTC gene attached to a therapeutic virus into his liver, Jesse developed a high fever. His immune system began raging out of control, his blood began clotting, ammonia levels climbed, his liver hemorrhaged and a flood of white blood cells shut down his lungs.

• Genes provide the instructions for making specific proteins.

• The bridge between DNA and protein synthesis is RNA.

Transcription and translation are two main processes linking gene to protein

•The molecular chain of command in a cell is :

DNA -> RNA -> protein.

What are the differences in protein synthesis between prokaryotic and eukaryotic cells?

• RNA = Bases are adenine, guanine, cytosine, uracil (NO THYMINE)

• Sugar is Ribose (not deoxyribose)

• Mostly single stranded• Many types – mRNA,

tRNA, rRNA

RNA – Ribonucleic acid

• DNA strand provides a template for the synthesis of a complementary RNA strand.

• Transcription of a gene produces a messenger RNA (mRNA) molecule.

Transcription

• Messenger RNA is transcribed from the template strand of a gene.

• Genes are read 3’->5’, creating a 5’->3’ mRNA molecule.

Transcription is the DNA-directed synthesis of RNA: a closer look

What will the mRNA code be?5’ …A U G G C C U G G A C U U C A …. 3’

Template Strand

• Transcriptioncan beseparatedinto threestages:initiation, elongation, andtermination.

Fig. 17.6a

Use the HW assignment link for protein synthesis flash animation

• RNA polymerase attaches at PROMOTOR SITE upstream of the gene/transcription unit

1) Initiation (Promotor + transcription factors + RNA Polymerase)

• RNA polymerase scans and recognizes the promotor sequence (TATA BOX) with the aid of proteins that can bind to DNA called - ‘transcription factors’. RNA polymerase separates the DNA strands and bonds the RNA nucleotides as they base-pair along the DNA template.

1) Initiation (unwinding of DNA strands + RNA synthesis begins)

• RNA polymerase moves downstream adding nucleotides to 3’ end of RNA transcript according to base paring rules => A-U; G-C.

2)Elongation (RNA transcript elongates in 5’ -> 3’ direcion)

Fig. 17.7

• RNA Polymerase and RNA transcript are released. Remember - this is premRNA in eukaryotes.

3)Termination (RNA Polymerase reaches termination sequence)

• At the 5’ end of the pre-mRNA molecule, a modified form of guanine is added, the 5’ cap. (prevents breakdown and attch to ribosomes)

• At the 3’ end, an enzyme adds 50 to 250 adenine nucleotides, the poly(A) tail. (protection from hydrolysis/breakdown of mRNA; helps export it)

Eukaryotic cells modify RNA after transcription

In eukaryotes this is still only pre-mRNA - the preview before the show!

• RNA splicing: Removal of Introns and attachment of exons

• Noncoding segments, introns, lie between coding regions.

• The final mRNA transcript includes coding regions, exons, that are translated into amino acid sequences, plus the leader and trailer sequences.

• This splicing is accomplished by a spliceosome.– spliceosomes consist

of a variety of proteins and RNA (snRNPs). Important - the RNA acts as an enzyme in the spliceosome! Specific sequences are recognized on the DNA and introns cut out; exons joined.

– Now m-RNA is READY for export to cytoplasm in eukaryotes - about time!

All this to make mRNA…LE 19-5

Enhancer(distal control elements)

Proximal control elements

Upstream

DNA

Promoter

Exon Intron Exon Intron Exon

DownstreamTranscription

Poly-A signalsequence

Terminationregion

Intron Exon Intron Exon

RNA processing:Cap and tail added;introns excised andexons spliced together

Poly-A signal

Cleaved 3¢ endof primarytranscript

3¢

Poly-Atail

3¢ UTR(untranslated

region)

5¢ UTR(untranslated

region)

Startcodon

Stopcodon

Coding segment

Intron RNA

5¢ Cap

mRNA

Primary RNAtranscript(pre-mRNA)

5¢

Exon

Exon shuffling/Alternate splicing - makes different mRNA from a single transcription event

WHY SPLICE mRNA (remove introns and join exons) in eukaryotes?

• mRNA splicing appears to have several functions.– First, at least some introns contain sequences that control gene

activity in some way.– Splicing itself may regulate the passage of mRNA from the nucleus

to the cytoplasm.– One clear benefit of split genes is to enable one gene to encode for

more than one polypeptide (EXON SHFFLING or ALTERNATE RNA SPLICING). (So what happened to the one gene one polypeptide hypothesis?)

– Alternative RNA splicing gives rise to two or more different polypeptides, depending on which segments are treated as exons.

– Split genes may also facilitate the evolution of new proteins/genes (important) - how?

Thalassemia is due to splicing errors

Translation•During translation, the information contained in the order of nucleotides in mRNA is used to determine the amino acid sequence of a polypeptide.

–Translation occurs at ribosomes in both prokaryotes and eukaryotes.

Transcription Translation

Central Dogma

•Transcription = DNA → RNA •Translation = RNA → protein

Taken together, they make up the "central dogma" of biology: DNA → RNA → protein.

• In the triplet code, three consecutive bases specify an amino acid, creating 43 (64) possible code words. Why not use 2 bases?

• Genetic code is ‘triplet and degenerate’ - why?

In the genetic code, nucleotide triplets specify amino acids

http://gslc.genetics.utah.edu/units/basics/transcribe/

Make your own protein:

AAAAAAAAAAAAAAAAAA - artificial mRNA

Phe – Phe – Phe – Phe – Phe – Phe

Khorana and Nirenberg (1960) - which triplet code for which aminoacid. {Crick, Brenner - “ do you realize - we are the only two people in the world who know it is a triplet code?”}

61 of 64 triplets code for 20 amino acids.

– It would take more than 300 nucleotides to code for a polypeptide that is 100 amino acids long.

• How many nucleotides will it take to code for a polypeptide that is 100 amino acids long?

• Why not ‘exactly 300 nucleotides’?

– Some codes specify start (AUG) and stop signals (UGA, UAA, UAG)

– Some specify other sequences needed to get transcription rolling (promotor)

• The genetic code is redundant/degenerate but not ambiguous.– There are typically several different codons that

would indicate a specific amino acid.– However, any one codon indicates only one amino

acid.• [If you have a specific codon, you can be sure of the

corresponding amino acid, but if you know only the amino acid, there may be several possible codons.]

• Both GAA and GAG specify glutamate, but no other amino acid.

– Codons synonymous for the same amino acid often differ only in the third codon position.

• To extract the message from the genetic code requires specifying the correct starting point.– This establishes the reading frame and subsequent

codons are read in groups of three nucleotides.– The cell’s protein-synthesizing machinery reads the

message as a series of nonoverlapping three-letter words.

• The genetic code is nearly universal, shared by organisms from the simplest bacteria to the most complex plants and animals.

The genetic code must have evolved very early in the history of life

What Have They Done To Our Food? – (60 Minutes- 2001)

Up to 70 percent of processed food in the American market contains products of genetic engineering, including soft drinks, catsup, potato chips, cookies, ice cream and corn flakes.

Characters:• mRNA – messenger

carrying code for amino acid sequence

• tRNA – transfer RNA reads RNA code and transcribes it into aminoacid sequence

• Ribosomes – docking station for mRNA and tRNA

Translation is the RNA-directed synthesis of a polypeptide: a closer look

Fig. 17.12

mRNA

tRNA

• Each tRNA has 2 parts:

• A code reading part: called ANTICODON

• An amino acid attachment site

How many nucleotides will each tRNA use in its ANTICODON? Why?

How many different tRNA molecules will be needed? Why?

One for every codon dictates 61, but there are 45 tRNAs

• Wobble hypothesis: explains why there are only 45 tRNAs and not 61 tRNAs

• 3rd base in codon is not specific – ex. U can pair with A or G

• You are given the DNA sequence:• Construct the amino acid chain that results from

transcription and translation.

3'TACGATCATATAAAACCGTTTGGGACT5'

5'AUGCUAGUAUAUUUUGGCAAACCCUGA3'

‘UACGAUCAUAUAAAACCGUUUGGGACU'

5‘Met- Leu- Val- Tyr- Phe- Gly- Lys – Pro - Stop3'

DNA -> mRNA codon -> tRNA anticodon -> Amino acid sequence

5‘M- L - V- T- P- G - L – P 3'

• Each amino acid is joined to the correct tRNA by aminoacyl-tRNA synthetase.

• The 20 different synthetases match the 20 different amino acids.

Fig. 17.14

• Ribosomes facilitate the specific coupling of the tRNA anticodons with mRNA codons.– Each ribosome has a large and a small subunit.– These are composed of proteins and ribosomal

RNA (rRNA), the most abundant RNA in the cell.Fig. 17.15a

• Each ribosome has a binding site for mRNA and three binding sites for tRNA molecules.– The P site holds the tRNA carrying the growing

polypeptide chain.– The A site carries the tRNA with the next amino

acid.– Discharged tRNAs leave the ribosome at the E site.

Fig. 17.16

• Translation can be divided into three stages: Initiation, Elongation,Termination

• Needs protein factors and energy (GTP)

• 1) Initiation brings together mRNA, a tRNA with the first amino acid, and the two ribosomal subunits.– First, a small ribosomal subunit binds with mRNA

and a special initiator tRNA, which carries methionine and attaches to the start codon.

– Initiation factors bring in the large subunit such that the initiator tRNA occupies the P site.

2) Elongation- amino acids (aa) are added to make a polypeptide chain

• Codon-Anticodon recognition by hydrogen bonding between mRNA codon under the

A site with the anticodon of tRNA. Needs GTP. • Transfer of aa from tRNA at P site to tRNA at A site and

formation of peptide bond• Ribosome translocates moving tRNA with aa chain to P site;

new tRNA arrives at next A site

2) Elongation-

• Peptide bond formation between aminoacids carried by tRNAs at P and A sites

• Translocation- the ribosome moves the tRNA with the attached polypeptide from A to P site.

GTP

Fig. 17.18

3) Termination occurs when one of the three stop codons reaches the A site.

Fig. 17.19

• Typically a single mRNA is used to make many copies of a polypeptide simultaneously.

• Multiple ribosomes, polyribosomes, may trail along the same mRNA.

Fig. 17.20

• Two populations of ribosomes- free and bound.

• Free ribosomes -proteins that reside in the cytosol.

• Bound ribosomes -proteins of the endomembrane system as well as proteins secreted from the cell.

Signal peptides target some eukaryotic polypeptides to specific destinations in the cell

RNA plays multiple roles in the cell• The diverse functions of RNA range from

structural to informational to catalytic.

Comparing protein synthesis in prokaryotes and eukaryotes

Prokaryotes can transcribe and translate the same gene simultaneously.

•Eukaryotes- the nuclear envelope segregates transcription from translation.

•RNA processing/splicing between transcription and translation

•Targeting proteins to the appropriate organelle using signals.

• Mutations are changes in the genetic material of a cell (or virus).

• Large-scale mutations (translocations,duplications, and inversions).

• Point Mutations- A chemical change in just one base pair of a gene

Point mutations can affect protein structure and function

• Sickle-cell disease

Fig. 17.23

• 1) Substitution -Base-pair substitution.– Some are silent mutations (redundancy in the

genetic code/non critical aminoacid switch).

• 1) Substitution mutations can be:

• Missense mutations change the amino acid. (OR)

• Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein.

• 2) Insertions and 3) Deletions are additions or losses of nucleotide pairs in a gene.– Disastrous

effects. They usually cause a frameshift mutation.

• Mutations can occur in a number of ways.– Errors can occur during DNA replication, DNA

repair, or DNA recombination.– These can lead to base-pair substitutions, insertions,

or deletions, as well as mutations affecting longer stretches of DNA.

– These are called spontaneous mutations.                                                        

• Mutagens are chemical or physical agents that interact with DNA to cause mutations.

• Physical agents include high-energy radiation like X-rays and ultraviolet light.

• Chemical mutagens may operate in several ways.

Base Analogues:

Intercalating Agents:

– AMES TEST- used as a preliminary screen of chemicals to identify those that may cause cancer.

– Most carcinogens are mutagenic and most mutagens are carcinogenic.

• Mendel- discrete unit of inheritance that affects phenotype.

• Morgan - specific loci on chromosomes.

• Specific nucleotide sequence along a region of a DNA molecule.

• DNA sequence that codes for a specific polypeptide chain.

What is a gene? revisiting the question

• Even the one gene-one polypeptide definition must be refined and applied selectively.– Most eukaryotic genes contain large introns that

have no corresponding segments in polypeptides.– Promotors and other regulatory regions of DNA are

not transcribed either, but they must be present for transcription to occur.

– Our definition must also include the various types of RNA that are not translated into polypeptides.

• A gene is a region of DNA whose final product is either a polypeptide or an RNA molecule.