welcome! take any seat! we will have assigned seats tomorrow. mr. baker rm. 107e to anatomy and...
Post on 12-Jan-2016
215 Views
Preview:
TRANSCRIPT
WELCOME!
Take any seat!We will have assigned seats tomorrow.
Mr. Baker Rm. 107E
toAnatomy and
Physiology
any student with schedule issues can see a counselor in room 193
• Schedule issues are:1. I have a hole in my schedule2. I am scheduled in a course I have already taken
and passed3. I failed the pre-requisite course
• Schedule issues are not: 1. I don't want this class anymore.2. I don't want to be in this teacher's class.
Classroom Mechanics
• Randomizers• Paperwork Flow• Assignment types• Syllabus• Letters Home• Dissections
TARDY POLICY
Your butt is in your seat by the time the bell finishes ringing.
What is considered on-time?
http://workoutsforhome.com/wp-content/uploads/2012/02/thumbs_up_large.png
Please take a moment to locate your Butt and Your Seat
http://www.totallygeeze.com/2012/04/glutesignoring-them-is-more-than-pain.html http://www.seatingzone.com/products/thumbs/3700BR_thumb_522.jpg
&
If the bell rings and you are:• Just entering the room.• Walking to your seat.• Near but NOT in your seat.• Sharpening your pencil.• In someone else’s seat.• ANYTHING other than sitting PROPERLY in YOUR seat.
http://blogs.discovery.com/.a/6a00d8341bf67c53ef0147e386287a970b-800wi
What is considered “tardy”?
Warm-Ups
• Most days we will have them. You will have 3 minutes from the start of class to complete them.
• They will mostly be a review of the material we covered the previous day.
• These will be useful for you to study with.• I will spot check this for a weekly grade.
Intro to Anatomy & Physiology
What is this class about?
• Write down a description or definition of Anatomy
• Write down a description or definition of Physiology.
• Take about 1 min.
Introduce yourself to a person near by.
• Compare your answers!• Are they similar? Different? Who has a better
description.• Come to an agreement on a final definition for
each.• Take 1 min.
Share!
• What were your descriptions?
http://www.umm.edu/graphics/images/en/15845.jpg
Anatomy: the study of the structure of body parts and their relationships to one another
Anatomy vs. Physiology
http://www.pinktentacle.com/images/anatomy_godzilla.jpg
Anatomy vs. Physiology
Anatomy:Naming and describing the shape and location of a structure.
You can talk about the Anatomy of just about anything.
• Gross/Macroscopic: Large easily observable structures.– i.e. The heart, Bones
• Microscopic anatomy: Structures requiring a microscope or magnifying device to see– i.e. Tissues, Cells
Topics in Anatomy
• Physiology: the functioning of the body’s structural machinery (how the body parts work and sustain life)
Anatomy vs.
Physiology
http://www.uml.edu/SHE/PT/Programs/Exercise-Physiology.aspx
Structure determines what functions can take place!
Anatomy/Physiology are inseparable
Understanding the shape and structure of something can tell you something about how it functions!
So why are you taking this course?
• Find a new partner and introduce yourself!• Get to know their name.• Why they are taking the course.• What do they plan to do with the information
they get here?
• Take 3 minutes.
Introductions!
Body Outline Sheet.
Warm-Up 1/21/15
1. What is anatomy?2. What is physiology?3. How much of your grade are tests worth?
Levels of Structural Organization• Chemical level- Atoms combine to form
molecules such as water, sugar, and protein.
Levels of Structural Organization• Cellular level- Cells, the smallest unit of all
living things.
Levels of Structural Organization• Histological level- Simple organisms can be
single cells. Complex organisms such as humans have tissues. Groups of similar cells that have a common function. 4 Basic types.
Levels of Structural Organization• Organ level- Composed of two or more tissue
types that performs a specific function. Allows for extremely complex processes.
Levels of Structural Organization• Organ system level- Groups of organs that
cooperate to accomplish a common purpose.
• Subdivisions based upon the operations of specific organ systems
• Examples:– Renal physiology (urine production and kidney
function) – Neurophysiology (nervous system)– Cardiovascular physiology (operation of heart and
blood vessels)
Topics in Physiology
System Functions
• provides a protective barrier for the body, contains sensory receptors for pain, touch, temperature!
Integumentary System
• protects major organs, provides levers and support for body movement
• Blood cells formed within bones
Skeletal System
• Moves bones and maintains posture!
• PRODUCES HEAT
Muscular System
• Processes sensory information and initiates reactions.
Nervous System
• SECRETES HORMONES THAT REGULATE GROWTH, REPRODUCTION, AND METABOLISM
Endocrine System
Transports nutrients, chemical messengers, gases and wastes in blood!
Cardiovascular System
Returns fluid to cardiovascular system, detects, filters, and eliminates disease causing organisms!
Lymphatic System
Adds oxygen to the blood and removes carbon dioxide from blood.
Respiratory System
Breaks down food into units that can be absorbed by the body
Digestive System
Removes wastes, maintains body fluid volume, pH and electrolyte levels.
Urinary/Excretory System
• PRODUCES SEX CELLS AND HORMONES
Reproductive System
Male
Female
Review Chart as Class
System Failure
• Gave 20 min to complete the chart. About 80% were finished at end.
• Didn’t do system failure discussion. Didn’t have time. Keep a note as a time filler in the future on this unit.
What would happen if these systems stop working?
• Address each system and discuss the physiological result if the system were to not function.
• Link this to the idea that they all have to work together to keep an individual alive and maintain homeostasis.
Cards
Card sortingHand them a sheet to fill out. Function.
And Organs involvedIdentifying organs (use book)
Review as class
Card Sorting activity working with a partner. Turn around.
Have 5 min.Then review as class.
• This is actually good because the descriptions are not verbatim. So the need to understand the functionality to do this well.
• Then have them Identify the organs associated with each system in their book.
• Integumentary• Skeletal • Muscular• Lymphatic• Circulatory• Respiratory
•Nervous•Endocrine•Digestive•Urinary•Reproductive
• Schedule• Video is it anatomy or physiology?• Review organs in systems• Homeostasis• Muscleman.• Recap.• If time do card sorting or name game.
Warm-Up 1/22/15
1. What would happen if your urinary system stopped working?
2. What functions are associated with lymphatic system?
3. What is an organ?
ANATOMY & PHYSIOLOGY
Maintaining Life
http://marketmatch.blogspot.com/2012/04/6-degrees-of-kevin-bacon.html
Our body requires interdependence of all body cells. No organ works in isolation. All organs work together to promote the well-being of the entire body
Each organ systems make major contributions to specific functional processes…
Homeostasis• Ability to maintain a relatively stable internal
conditions even though the outside world is continuously changes. The word roughly translates to “unchanging”.– Homeo- The same or similar– Stasis = Standing still
Is “unchanging” a good term for life? Why or why not?
Dynamic equilibrium
• Homeostasis is better described as a dynamic equilibrium.
• Internal conditions will change and vary, but always within relatively narrow limits.
• What are some ways your body maintains homeostasis?• How does it do this?• What occurs when your body cannot maintain
homeostasis?
Homeostatic Control Mechanisms
• Communication is key!• Nervous system and endocrine systems are
critical!• Use electrical and blood-borne hormones,
respectively as information carriers.• But all homeostatic control mechanisms have
at least three components.
• Receptor: Type of sensor that monitors and responds to changes in the environment, called stimuli, by sending information (input) to the control center.
• Information flowing from the receptor to the control center is known as the afferent pathway.
Homeostatic Control Mechanisms
Homeostatic Control Mechanisms
• Control center determines the level (set point) at which a variable (the factor or event being regulated) is to be maintained.
• Analyses information received and determines response.
Homeostatic Control Mechanisms
• Effector provides the means for the control center’s response (output) to the stimulus.
• Information flowing from control center to the effector is the efferent pathway.
• The results of the response then feedback to influence the stimuli either shutting it off, or speeding it up.
Feedback Mechanisms
• Most homeostatic control mechanism are negative feedback mechanisms. They try to shut off or reduce the intensity of the original stimulus.– Example: A thermostat in your house!– You have a thermostat in your body. In the
hypothalamus. Triggers fevers and sweating.
Feedback Mechanisms
• Positive feedback tries to increase the original disturbance and push the variable farther from the original point. Relatively rare in the body.– Examples: Microphone feedback– Blood clotting, contractions during labor.
• ReceptorControl Center: afferent pathway• Control CenterEffector: efferent pathway
Pathways
Muscleman Case Study
• What is a testable hypothesis?• How do you design an experiment? What are
the parts?
• Groups of 2-3• Complete on separate sheet of paper, answer
in complete sentences, ensure that all group member’s names are on the paper.
Warm-Up 1/26
1. What are the three parts of a feedback loop?2. What is homeostasis? Why is it important?3. What is the difference between positive and
negative feedback loops?
Agenda:Warm-upVideoMuscleman Case study
Warm Up 1/27/15
1. What is Trenbalone?2. Testicular shrinkage due to Trenbalone
administration is an example of what type of feedback?
3. Testicular shrinkage due to Trenbalone is due to its DIRECT interaction with what structures?
The Language of Anatomy
If I told you to drive to the intersection and take a left. Which direction would you go?
• To limit confusion, correct anatomical position is always assumed regardless of the position a person is currently in. This gives us a reference point.
Correct Anatomical Position
• Standing erect, facing directly forward, feet pointed forward and slightly apart, and arms hanging down at the sides with palms facing forward.
• Note: when talking about right/left, you are talking about the patients right or left side, not your own.
Directional Terms• Used to explain exactly where one body structure is
in relation to another. Allows for more effective communication.
• Describes the location of one part of the body in relation to another.
Relative Positions
• Superior (cranial): Toward the hear end or upper part of a structure or the body; above.
• Inferior (Caudal): Away from the hear end or toward the lower part of a structure or the body; below.
• Anterior (ventral): Toward the front of the body; in front of
• Posterior (dorsal): Toward the backside of the body; behind
• Medial: toward the midline of the body; on the inner side of
• Lateral: away from the midline of the body; on the outer side of
• Intermediate: Between a more medial and a more lateral structure.
• Proximal: closer to the point of attachment to the trunk
• Distal: farther from the point of attachment to the trunk
• Superficial: toward or at the body surface
• Deep: away from the body surface; more internal
Masking Tape ActivityAnd Horror Story.
Warm-Up 1/28/15
1. Name a structure distal to the knee.2. Name a region inferior to the sural region.3. What is a region medial of the axillary
region?
Body planes and sections - cut into sections along a flat surface called a plane
(also called XS – cross section)
(also called coronal)
Body planes
• Body is 3D
• Can be split into three planes
• Sagittal• Coronal• Transverse
Sagittal Plane
• Plane splitting the body into two parts (left and right)
• Sagittal section is a cut made longitudinally along the body
• If it splits into two equal parts = midsagittal
Coronal Plane
• Plane which splits body into anterior and posterior section
• Ie. Facelift
Transverse Plane• Separates body along
horizontal plane
• Also called a cross section
• Will divide an organism into superior and inferior parts
Body Cavities
http://en.wikipedia.org/wiki/File:Scheme_body_cavities-en.svg
Cavities
• Opening within body which protects internal organs, and allows transfer of materials/information
• 2 Divisions– Dorsal– Ventral
Dorsal Cavities
• Made up of two smaller cavities
• 1) Cranial Cavity – holds and protects brain
• 2) Spinal Cavity – column which runs through vertebra and protects spinal chord
Ventral Cavities Thoracic Abdominopelvic
Ventral Cavities
1) Thoracic – chest area (holds heart, lungs, and diaphragm)
2) Abdominopelvic – lower torso (holds digestive and reproductive organs)
Bovine Pleural Cavity Collapsed Lung in Pleural Cavity
Pleural cavity is the space containing the lungs
Pleural cavity
Mediastinum Space in the thoracic cavity between the pleural cavities.Contains the pericardial cavity which contains the heart.
Pericardial Cavity
Abdominopelvic
• Contains:• Abdominal cavity• Pelvic cavity
Imaging Technology Reading And TableReview as class.
What's in the MRIMRI safety.
Short StoryIncorporate the following terms into a story describing your
describing your worst nightmare.Underline the term(s) in the story.
• Superior• Inferior• Anterior• Abdominal Cavity• Dorsal• Pelvic Cavity• Medial• Oral Cavity• Lateral
• Proximal• Distal• Superficial• Deep• Skeletal System• Cardiovascular System
Warm Up 1/29
1. What body cavity contains the brain?2. What cavity contains the heart?3. In what cavity would you find the intestines?
Unit 1 Test Next Friday.
What Body Plane are these in?
• We are composed of matter. Energy is the mover of all matter.
• Energy: the capacity to do work. Can be stored or in action– Kinetic: energy in motion– Potential: stored or inactive energy
Basic Chemistry
• Chemical: stored in bonds (ATP)• Electrical: movement of charged particles• Mechanical: moving matter• Radiant/Electromagnetic: travels in waves
Forms of energy
Atomic Structure
•Atoms are made up of 3 subatomic particles:
•Protons: positive charge•Neutrons: neutral charge•Electrons: negative charge
• Most atoms combine with other atoms to form a molecule. Molecules can be a combination of the same atoms or different atoms
Combining atoms
• Result of atoms sharing electrons.
• Stable and Strong.
Covalent Bonds
• Slightly positive charge on Hydrogen bound to other atoms is attracted to negative charge on another atom.
• Relatively weak.• Holds water molecules together.
Hydrogen Bonds
• Chemical reactions involve making and breaking bonds between atoms.
• Number of atoms remain the same but appear in new combinations.
Reaction types• Synthesis- When two or more atoms or molecules
combine to forma a larger more complex molecule.– A + B => AB– Bonds formed– Anabolic (constructive)– Requires energy
Reaction types• Decomposition- when a molecule is broken down
into smaller molecules or atoms.– AB => A + B– Bonds broken– Catabolic (destructive)– Energy released
Reaction types• Exchange reaction- involve both synthesis and
decomposition. – AB + C => A + BC– AB + CD => AD + CB– Bonds formed and broken
Webquest
Warm-Up 1/30
1. What type of bonds are stronger, hydrogen or covalent?
2. Where do humans gain potential chemical energy from?
3. What type of reaction is the most important, catabolic or anabolic?
• Found as long carbon chains• 4 main types (called macromolecules)
– Carbohydrates– Lipids– Proteins– Nucleic Acids
Organic Compounds
Macromolecule Types
Monomer Polymer
• Sugars and Starches• Made of C, H, O• Generally contain H:O ratio of 2:1, same as
water.• Hydrated Carbon• C6H12O6
Carbohydrates
• Types classified according to size:–Monosaccharide–Disaccharide–Polysaccharide
• Monosaccharide: one sugar unit• Simple sugar• Composed of 5-7 carbon atoms• Glucose (blood sugar) most important type. Other
sugar types are converted to glucose before the body can use them.– Examples:
• Fructose• Galactose• Ribose• Deoxyribose
Carbohydrates
glucose
• Dissacharide: two sugar unit–Example:
• Maltose (glucose + glucose)• Sucrose (glucose + fructose)• Lactose (glucose + galactose)
Carbohydrates
glucoseglucose
• Polysaccharide: many sugar units– Example: – Starch (glucose storage in plants)– Glycogen (animal starch in muscles and liver)
Carbohydrates
glucoseglucose
glucoseglucose
glucoseglucose
glucoseglucose
• All lipids are insoluble in water.
• Contain C, H, O• Types:
–Triglycerides–Phospholipids–Steroids
Lipids
• Composed of 1 glycerol and 3 fatty acids• Body’s most concentrated source of usable energy.
Triglycerides
H
H-C----O
H-C----O
H-C----O
H
glycerol
O
C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3
=
O
C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3
=
fatty acidsO
C-CH2-CH2-CH2-CH =CH-CH2 -CH
2 -CH2 -CH
2 -CH3
=
• Saturated fatty acids: single bonds; solid at room temperature
• Unsaturated fatty acids: double bonds; liquid at room temperature
Fatty Acids
O
C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3
=
saturated
O
C-CH2-CH2-CH2-CH=CH-CH2 -CH
2-CH2 -CH
2 -CH3
=
unsaturated
Triglycerides• Animal Fat• Tristearin: C57H110O6
Warm Up 2/3/15
1. What is the difference between a monomer and a polymer?
2. What is the technical term for the monomers of a starch molecule?
3. What is the most important carbohydrate in the human body?
• Composed of 1 glycerol and 2 fatty acids.• Has a Phosphate group rather than a 3rd fatty acid.• Makes up the plasma membrane
Phospholipids
Steroids• Flat molecules made of interlocking rings• Most important: Cholesterol• Raw material for human steroids• Examples:
– Vitamin D– Sex hormones– Cortisol– Bile salts
• Amino acids (20 different types) bonded together by peptide bonds
Proteins (Polypeptides)
• All amino acids have the same basic structure and vary only in their “R” group.
• Humans have 20 different “R” groups.
Every protein in your body is simply written in the alphabet of Amino acids in the same way
that every written work of the English language, whether it is Shakespeare or baking instructions
are just different arrangements of 26 letters.
• Change one letter in a word and a sentence can change its meaning.–Flour => Floor
• Or stop making sense–Flour => Fluur
• Proteins are the same.• Change an amino acid and they can
change function, or stop working entirely.
Categories of proteins
• Structural- bind structures together and provide strength in certain body tissues.
• Example:– Collagen- Found in bones, cartilage
and tendons. It is the most abundant protein in the body.
Categories of proteins
• Functional- do things rather than just form structures. Mediate virtually all biological processes.
• Examples:– Antibodies– Hormones– Enzymes
Enzymes• Hydrogen bonds important for maintaining
structure, but are easily broken.• Excess heat and pH can break these bonds.
Enzymes• When three dimensional structures are destroyed
the proteins are said the be denatured and can no longer perform their physiological roles
A denatured paperclip.
Enzymes
• Function depends on structure.• Most importantly the active site where they
interact with other molecules. Highly specific.
Enzymes
• Enzymes are as biological catalysts, increasing the rate of a chemical reaction.
• Enzymes not changed during reaction so are reusable.
• Control rate and type of reactions that can occur.• Many enzymes end with –ase suffix.
• Highly specific! May only control ONE reaction.
• Nearly all end in –ase. Beginning of word characterizes its function/substrate (Ex. Hydrolase- adds water during a chemical reaction)
Enzymes
Warm Up 2/4
1. What does the term denatured mean with regards to a protein?
2. What type of bonds are critical to a protein’s shape but are easily broken?
3. What is the name of bonds that hold amino acids together?
• Two types:– Deoxyribonucleic acid (DNA)-double helix– Ribonucleic acid (RNA)-single
• Nucleic acids are composed of long chains of nucleotides
Nucleic Acids
• Nucleotide Structure:–Phosphate group–Pentose sugar (5-Carbon)–Nitrogenous bases:
• Adenine (A)• Thymine (T) DNA only• Uracil (U) RNA only• Cytosine (C)• Guanine (G)
Nucleic Acids
Nucleotide
OO=P-O O
Phosphate Group
CH2
O
C1C4
C3 C2
5
Sugar(deoxyribose)
NNitrogenous base (A, G, C, or T)
ATP
Base PairingC-GT-A
P
P
P
O
O
O
1
23
4
5
5
3
3
5
G C
T A
P
P
PO
O
O
1
2 3
4
5
5
3
5
3
2 step process “Central Dogma”
• Transcription (DNA to RNA)• Translation (RNA to Amino Acid sequence)
Transcription TranslationDNA RNA Protein
• A gene is a functional segment of DNA that provides the genetic information necessary to build a protein
ATGACCGAGAATTCCACGTCCGCCCCTGCGGCCAAGCCCAAGCGGGCCAAGGCCTCCAAGAAGTCCACAGACCACCCCAAGTATTCAGACATGATCGTGGCTGCTATCCAGGCCGAGAAGAACCGCGCTGGCTCCTCGCGCCAGTCCATTCAGAAGTATATCAAGAGCCACTACAAGGTGGGTGAGAACGCTGACTCGCAGATCAAGTTGTCCATCAAGCGCCTGGTCACCACCGGTGTCCTCAAGCAGACCAAAGGGGTGGGGGCCTCGGGGTCCTTCCGGCTAGCCAAGAGCGACGAGCCCAAGAAGTCAGTGGCCTTCAAGAAGACCAAGAAGGAAATCAAGAAGGTAGCCACGCCAAAGAAGGCATCCAAGCCCAAGAAGGCTGCCTCCAAAGCCCCAACCAAGAAACCCAAAGCCACCCCAGTCAAGAAAGCCAAGAAGAAGCTGGCTGCCACACCCAAGAAAGCCAAAAAACCCAAGACTGTCAAAGCCAAGCCGGTCAAGGCATCCAAGCCCAAAAAGGCCAAACCAGTGAAACCCAAAGCAAAGTCCAGTGCCAAGAGGGCCGGCAAGAAGAAGTGA
One of the shortest human genes. ~585 base pairs. Encodes a Histone protein.
Human salivary amylase
A three dimensional structural model of stem bromelain
END.
top related