the nhgri action plan for training of underrepresented minority groups in genomics dialogue with...

Post on 13-Jan-2016

218 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

The NHGRI Action Planfor Training of Underrepresented

Minority Groups in Genomics

Dialogue with Professional Societies

Francis S. Collins, M.D., Ph.D.

National Human Genome Research Institute

April 15, 2002

Two universal principles of human genetics

• Virtually all diseases (except some cases of trauma) have a genetic component

• There are no perfect human specimens – all of us carry a significant number of DNA glitches

Sickle cell anemia Adult onset diabetes AIDS

ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTATACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG

A typical page of the human instruction book

ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTATACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGCCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTATTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG

Our instruction books are not quite the same

How do health disparities arise?

• Most genetic variation is shared amongst all groups, though frequencies of disease-associated variants may vary.

• Differences in disease incidence between populations may also be due to diet, lifestyle, or other environmental factors.

• Sorting this out requires research on large numbers of individuals where both environment and heredity are carefully investigated.

In order for all populations to benefit fully from genomic

medicine, all populations need to be part of genomic research

The major contributing genes for diabetes, heart disease, cancer, mental illness, Alzheimer’s and Parkinson’s disease, asthma, etc. will be identified within the next

5 – 7 years.

Ethical, Legal, and Social Implications

An integral component of the

Human Genome Project

2010 -- Predictive genetic tests available for a dozen conditions

-- Interventions to reduce risk available for several of these

-- Will reasonably effective legislative solutions to genetic

discrimination be in place?

BUT….

Mainstreaming of individualized preventive medicine

-- Will access be inequitable? Will health disparities persist?

-- Pharmacogenomics is standard of care for several drugs

2020 -- Gene-based designer drugs available for diabetes, Alzheimer’s…

-- Gene therapy standard of care for several conditions

BUT….

Genomic therapeutic revolution in full swing

-- Intense debate underway on non-medical uses of genetics

None of this can happen without the best and

brightest minds of the current scientific generation

National Human Genome Research Institute

National Institutes of Health

http://www.nhgri.nih.gov/Policy_and_public_affairs/

Minority_Activities/index.htm

GOAL

1/ African American, Alaskan Natives, Hispanic American, Native Americans, and Pacific Islanders. 2/ Ethical, legal and social implications of genetics and genomics research.

To increase the number of underrepresented1

minorities trained in genomics and ELSI2 research

PRINCIPLES

Underrepresented communities must be involved.

Opportunities must be available at all career levels.

Programs must be anchored in institutions involved in genome and ELSI research.

All NHGRI programs must be responsive to the Plan.

Plan must have achievable goals, measurable outcomes, appropriate reviews, and undergo evaluation.

1. Research Training

2. Research Collaborations

3. Education

4. Outreach/Communications

5. Partnerships

COMPONENTS

Research TrainingOpportunities in Genomics

U.S. Universities and Research Institutions

Fellowships in Genomic and ELSI ResearchCareer Development AwardsSupport for Research ExperiencesTravel Awards for Courses and Scientific MeetingsDissertation Awards for Research in ELSI Topics

Research TrainingOpportunities in Genomics

NHGRI’s Bethesda Campus

Fellowships

Visiting Investigators’ Program for Faculty

Summer Research Internships

Summer Short Course in Genomics for Faculty

1. Research Training

2. Research Collaborations

3. Education

4. Outreach/Communications

5. Partnerships

COMPONENTS

Partnerships

National Institute of General Medical Sciences

• Undergraduate/ graduate traineeships and travel awards in genomics and ELSI

• Postdoctoral fellowships in research and teaching• Institutional training grant to the Meharry/

Vanderbilt Consortium• Expansion of the ‘Minority Access to Research

Careers’ program into genomics

Partnerships

Professional and Scientific Societies

Goal: Pursue innovative approaches to increase the number of underrepresented minorities that are pursuing doctoral studies in genomics, including

ELSI research

top related